MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-250H04
Chromosome	7 (Build37)
Map Location	47,180,207 - 47,336,927
singlet/doublet	doublet
Overlap gene	none
Upstream gene	LOC100038955, LOC100038967, LOC620018, LOC100038914, EG668531, EG628058, EG668618, EG330513, EG434168, 9430025M13Rik, LOC100038985, 3000002G13Rik, EG215208, LOC100039133, LOC100039050, EG668540, 4930558N11Rik
Downstream gene	EG628161, LOC100039094, 2900093B09Rik, 4930433I11Rik, EG233164
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100038955 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100038967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 7 Proteins

name	LOC620018 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 7 Proteins

name	LOC100038914 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668531 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668531 MGI:3644713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins pseudo : _no_value

name	EG628058 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628058 MGI:3645553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 Proteins

name	EG668618 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668618 MGI:3646449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 7 Proteins

name	EG330513 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330513 MGI:3647631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434168 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434168 MGI:3645451
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	9430025M13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233147 MGI:3036240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC100038985 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	3000002G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70227 MGI:1917477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG215208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215208 MGI:3646468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 3 Proteins

name	LOC100039133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 103 ESTs, 7 Proteins

name	LOC100039050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG668540 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668540 MGI:3648549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	4930558N11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78211 MGI:1925461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG628161 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628161 MGI:3643618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 42 ESTs, 4 Proteins

name	LOC100039094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	2900093B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58188 MGI:1914525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930433I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243944 MGI:2685327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG233164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233164 MGI:3649090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038967 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257189 GeneID:100038967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 7 Proteins product : hypothetical protein LOC100038967 transcript_id : XM_001471962.1

name	LOC620018 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257192 GeneID:620018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 7 Proteins product : hypothetical LOC620018 transcript_id : XM_001472000.1

name	LOC100038914 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257182 GeneID:100038914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038914 transcript_id : XM_001471509.1

name	EG628058 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380350 GeneID:628058 MGI:3645553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 Proteins product : predicted gene, EG628058 transcript_id : XM_892788.2

name	EG668618 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380380 GeneID:668618 MGI:3646449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 7 Proteins product : predicted gene, EG668618, transcript variant 2 transcript_id : XM_001004349.1

name	EG330513 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089289 GeneID:330513 MGI:3647631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG330513 transcript_id : NM_177890.3

name	EG434168 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257198 GeneID:434168 MGI:3645451
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : predicted gene, EG434168 transcript_id : XM_001472192.1

name	9430025M13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380388 GeneID:233147 MGI:3036240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 9430025M13 gene, transcript variant 2 transcript_id : XM_912283.2

name	LOC100038985 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257194 GeneID:100038985
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to crooked legs CG14938-PB transcript_id : XM_001472042.1

name	3000002G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921278 GeneID:70227 MGI:1917477
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3000002G13 gene transcript_id : NM_001004139.1

name	EG215208 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257196 GeneID:215208 MGI:3646468
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 3 Proteins product : predicted gene, EG215208 transcript_id : XM_001472136.1

name	LOC100039133 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257202 GeneID:100039133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 103 ESTs, 5 Proteins product : similar to Ubiquitin-conjugating enzyme UbcH2, transcript variant 1 transcript_id : XM_001472265.1

name	LOC100039133 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257204 GeneID:100039133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Ubiquitin-conjugating enzyme UbcH2, transcript variant 2 transcript_id : XM_001472300.1

name	4930558N11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257206 GeneID:78211 MGI:1925461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4930558N11 gene transcript_id : XM_001472327.1

name	EG628161 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380356 GeneID:628161 MGI:3643618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 42 ESTs, 4 Proteins product : predicted gene, EG628161 transcript_id : XM_892890.2

name	LOC100039094 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257200 GeneID:100039094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039094 transcript_id : XM_001472249.1

name	2900093B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370338 GeneID:58188 MGI:1914525
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900093B09 gene transcript_id : NM_021387.2

name	4930433I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801797 GeneID:243944 MGI:2685327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930433I11 gene transcript_id : NM_207248.2

name	EG233164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948924 GeneID:233164 MGI:3649090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG233164 transcript_id : NM_183166.2

name	LOC100038967 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257190 GeneID:100038967
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472012.1

name	LOC620018 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257193 GeneID:620018
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472050.1

name	LOC100038914 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257183 GeneID:100038914
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471559.1

name	EG628058 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905237 GeneID:628058 MGI:3645553
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897881.1

name	EG668618 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380381 GeneID:668618 MGI:3646449
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001004349.1

name	EG330513 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089290 GeneID:330513 MGI:3647631
definition	codon_start : 1 product : hypothetical protein LOC330513 protein_id : NP_808558.2

name	EG434168 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257199 GeneID:434168 MGI:3645451
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472242.1

name	9430025M13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380389 GeneID:233147 MGI:3036240
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_917376.2

name	LOC100038985 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257195 GeneID:100038985
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472092.1

name	3000002G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921279 GeneID:70227 MGI:1917477
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70227 protein_id : NP_001004139.1

name	EG215208 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257197 GeneID:215208 MGI:3646468
definition	codon_start : 1 product : similar to zinc finger protein 709 protein_id : XP_001472186.1

name	LOC100039133 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257203 GeneID:100039133
definition	codon_start : 1 product : similar to Ubiquitin-conjugating enzyme UbcH2 isoform 1 protein_id : XP_001472315.1

name	LOC100039133 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257205 GeneID:100039133
definition	codon_start : 1 product : similar to Ubiquitin-conjugating enzyme UbcH2 isoform 2 protein_id : XP_001472350.1

name	4930558N11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257207 GeneID:78211 MGI:1925461
definition	codon_start : 1 product : hypothetical protein LOC78211 protein_id : XP_001472377.1

name	EG628161 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905251 GeneID:628161 MGI:3643618
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897983.1

name	LOC100039094 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257201 GeneID:100039094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472299.1

name	2900093B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946730 CCDS:CCDS21160.1 GeneID:58188 MGI:1914525
definition	codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : hypothetical protein LOC58188 protein_id : NP_067362.1

name	4930433I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402245 GeneID:243944 MGI:2685327
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC243944 protein_id : NP_997131.1

name	EG233164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948925 GeneID:233164 MGI:3649090
definition	codon_start : 1 product : hypothetical protein LOC233164 protein_id : NP_898989.2

name	LOC100038955 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038955
definition	number : 2 pseudo : _no_value

name	LOC100038955 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100038955
definition	number : 1 pseudo : _no_value

name	LOC100039050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039050
definition	number : 2 pseudo : _no_value

name	LOC100039050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039050
definition	number : 1 pseudo : _no_value

name	EG668540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668540
definition	number : 3 pseudo : _no_value

name	EG668540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668540
definition	number : 2 pseudo : _no_value

name	EG668540 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668540
definition	number : 1 pseudo : _no_value

name	EG668531 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257191 GeneID:668531 MGI:3644713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : predicted gene, EG668531 pseudo : _no_value transcript_id : XR_002196.2

clone name	MSMg01-301E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506E03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-370J19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-476E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-085J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-087I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470J23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318G16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427A03
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-061P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093M11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-250H04.b	B6Ng01-250H04.g
ACC	GA057991	GA057992
length	1,159	1,181
definition	B6Ng01-250H04.b	B6Ng01-250H04.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(47,335,760 - 47,336,927)	(47,180,207 - 47,181,393)
sequence	gaattccaggcaatggaaacccaagtagcaaaatagagaggtacaaaggt acggaatacatctgccagggtgggggttagcaagctacacagcagcatag gaaagaggggaagatgaagtcagaacccaaagagttgcgaatgccaatct aaaagctttgactttggtaactacattagttagtttttgttgctgtgatg aaagtgaccaaaagtgacttatagaagaatcagtttactttggcttatag ttacagggagatgaagttcataatgataagggcacgtgctaatggcagga gcaggaagctggctgattacatcctcaaccataaaagccaaacagagagc aaactggaacaagaaaggatataaaatctcaaagcaatccgtaaagatgt gcctcctccagcaagtttactgctcctaaaggtttcatgacatccccaaa cagtgctaccaactcgggaccaagtattcaagtacaagagtctaggggga ccattcctcattgaaactaccacagtaatcaaatactattggcaaaggtg gaaggaagaaagaggtcagttagcagtcttttaaggcagtctgggtttct tcagtttgatcccaatccagtgggtgtgaggcttaggtccaggagcaaaa aagaagaaacaagatttagtgcctgtgaatgggcagtgaggttttgagcc taagttttttaaaaaggtaataaatatgaaccttcttttggattaatgag gtgtaaacagcaggtaccgaggggcagacaaaaaattccgtaagttcaat gttattttctttaaaactaaaagattgttttagacattagctgcagagtt ctataatatccaattggaaaatgcaagtttatttcatcatcttacaaact tcttactcagtaaaagctgacctttttacctttgtgtgacattgggatgc ctaattgattctgctacaaggggttcggctactctgtgcacggctctata ggccacatagagactaaactgaagtactgtgtgcccagcctcacgtgaga cctggctcgcagaagctcagtcagtgtctgctatattatgcaatgggatg aatattaagatcatgaaatcctgctgtcactactgctctcaccaaggctt catacagct	gaattcagtgatggctgcagggagagaggagcccagcctctctgctgtct gactgctcttcctgctgtctggcttcagccaaccccaactgcaatttgga gagttgaggagtatggtaaggcagcccccaaatggctacttcatacagca gagagctgacaagacatggtggagtggtagttaatctagagggcataaag gcagaagctccagctcaggtgagtgctgttgttggtgctcctccctagat gagaaaaggagagatgaggtgacatgagacatacgttttcaaagagcctg taagagacggagtcagaaatgagatgttggagctagagaaatggctcaga gattaggacgcttgctatcctcacagaggaccttagttcagtccctagca tccaatttgagtagctgacaagtgcctgtcactccagctctgaggaatct gacacctttttgtgcctcttcaggtaactgcatacacatgtgtgagcaca tgtataacacacacacacacacaccaaataaaaaagatcttaagaataaa tcagtttggttctggaagggcatgggtgtggatatcaagacttgtgctct taaacatcattccatgtgtctgctgttttccttctagacatctctgagta cctgggctggaatttctggttccttcttttctgtctcactccttcattca aagttcaagagaaggtgtacctgttaagcgtctatgagactttgctagtg tccacagagctgtgaatattcggattggatttcacatttcaacaggaccc gagagcccaggggaagaagtagcaattgaatgagcactgtcaccatctcc ttgctgtgtctgtccatgtccacagctctgggtgaatcctgttttaattc actaacagctttattttcagaaataaaatatggaagctgttgggttgact gtgaaattctaattatttgaatgtcagatgtgaactccagcctagatctt cccttggtggtgacgcttctgagtcgggagtgtttgtcactggaaagcga ggcaagattagtatggaccgagacctgtgacatgtcgtggcttatgctct tatcgatctgcctgcctgtacttaatgctagctgagcctcagtctaaggc ctttcaatggagggtgggcccctcacacaga
quality values	Open. Hide. 58 34 42 38 62 62 38 13 62 62 47 56 62 54 62 62 47 62 62 51 62 47 47 62 62 49 54 62 62 62 62 51 41 43 27 23 50 27 38 38 37 50 59 62 59 59 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 54 62 62 54 54 62 62 62 62 62 62 59 54 54 62 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 46 49 58 43 49 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 54 54 58 54 58 54 58 58 54 58 58 58 58 58 58 58 51 58 58 54 54 41 54 58 58 58 58 47 53 54 58 51 39 58 58 58 58 42 53 53 58 58 58 58 58 53 58 58 38 49 48 58 58 52 40 58 50 54 58 39 51 58 49 24 58 51 58 58 58 58 58 46 58 54 39 58 58 53 53 51 54 49 38 41 58 51 41 49 58 58 43 58 51 58 58 54 58 52 52 58 58 50 50 49 51 52 58 39 29 38 32 58 58 58 49 54 40 49 58 35 39 51 41 53 58 58 58 58 41 29 58 54 54 40 39 51 32 53 52 52 38 51 51 40 52 49 49 53 51 49 44 50 52 53 53 51 54 54 30 44 28 20 49 34 40 42 53 47 15 27 35 51 33 26 54 29 39 37 45 45 42 14 54 37 31 30 54 44 31 13 54 54 54 30 39 34 53 31 23 54 52 52 52 30 32 53 33 53 32 32 32 28 25 31 37 36 31 33 32 53 31 34 40 32 53 53 52 53 32 51 34 35 52 52 47 32 31 27 46 46 45 28 33 17 42 38 24 51 51 34 31 30 31 29 32 33 31 34 34 39 42 33 31 29 24 37 17 35 36 32 36 32 43 26 32 32 28 37 36 42 16 29 21 20 21 31 33 46 46 27 31 31 26 32 30 15 21 47 30 26 28 48 31 27 23 32 34 28 31 32 22 30 30 26 16 46 28 31 26 37 31 25 27 31 25 33 33 25 26 30 37 48 46 33 23 31 31 31 37 16 22 20 46 47 46 31 33 26 25 22 47 36 31 25 32 29 31 38 27 31 32 26 29 41 31 32 29 31 20 24 18 19 25 17 17 25 31 15 21 31 21 24 33 32 28 33 19 15 24 47 43 24 9 22 24 26 13 31 32 9 8 11 22 27 24 12 22 32 24 15 26 23 18 29 19 15 15 21 10 15 11 22 13 17 19 19 32 21 14 29 15 21 24 32 23 40 13 11 19 11 17 24 20 28 24 22 13 16 7 11 18 20 15 40 6 5 5 7 7 11 21 20 13 26 17 24 28 10 22 8 20 15 15 17 6 8 13 5 3 5 10 10 15 12 5 11 5 7 6 13 28 7 4 3 4 13 16 16 23 21 12 7 20 7 7 15 9 12 6 12 10 14 3 5 6 14 20 16 21 11 13 7 7 4 18 15 5 5 17 16 16 16 7 8 15 28 17 4 7 6 18 4 4 1 6 12 6 5 4 4 7 9 10 5 4 7 9 6 5 8 21 12 6 5 3 7 6 6 10 5 6 4 4 6 8 7 5 2	Open. Hide. 62 59 51 59 62 59 59 62 62 62 39 39 32 30 28 28 38 28 23 34 54 54 54 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 54 42 62 54 54 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 54 58 58 58 58 58 58 58 58 58 58 58 45 58 58 58 58 58 52 58 58 54 58 58 58 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 44 49 58 52 58 58 58 58 58 58 58 58 58 58 58 52 54 52 54 54 54 58 58 48 58 58 58 58 58 58 58 51 58 49 53 58 58 50 39 58 58 49 58 58 58 42 35 49 58 58 58 58 58 58 58 48 50 58 51 58 58 54 50 58 58 54 58 52 53 49 51 37 50 54 53 58 58 58 51 49 28 51 40 35 58 54 58 58 58 50 41 54 48 49 53 40 58 58 40 49 54 46 32 53 42 51 41 51 42 54 58 58 42 41 50 58 40 58 53 42 42 47 51 58 58 41 38 37 32 41 54 52 31 38 54 51 54 50 39 36 53 53 54 16 49 38 21 46 28 53 42 31 37 44 40 54 52 37 27 53 40 54 39 44 52 40 45 37 45 54 32 35 26 35 36 51 45 53 52 37 37 51 53 42 41 42 32 39 32 37 41 31 45 41 39 52 52 48 38 40 32 45 46 23 6 13 45 34 31 53 31 45 25 51 45 39 28 34 30 45 53 52 39 28 29 27 31 31 52 31 31 47 33 19 32 17 27 23 18 41 46 31 25 47 47 30 33 39 23 31 29 16 31 33 33 42 31 33 33 33 45 46 26 33 35 31 18 43 26 30 27 41 28 36 29 32 31 28 36 33 38 36 35 31 21 32 31 34 43 29 41 27 31 22 42 28 34 30 13 21 31 15 12 31 20 29 14 16 31 30 31 34 33 48 39 24 31 23 25 25 20 25 27 30 6 32 32 15 25 16 27 31 35 28 32 29 17 29 26 29 32 34 34 48 31 21 30 44 44 31 28 20 14 33 48 28 18 11 48 44 44 24 16 21 9 7 31 20 31 32 34 38 18 32 18 48 22 29 24 15 33 20 15 30 22 13 24 43 7 17 32 18 33 21 19 19 19 22 22 43 25 19 29 26 4 9 13 33 21 18 31 12 22 17 21 19 18 18 22 20 25 10 8 21 15 13 22 17 28 20 24 11 24 9 40 21 7 13 18 5 5 24 12 11 20 17 20 7 19 28 19 15 10 10 21 9 22 21 10 27 7 31 12 8 16 12 40 10 27 19 18 8 11 10 12 7 22 47 21 13 28 7 14 10 14 7 10 6 15 11 8 5 18 5 4 5 11 5 6 7 5 4 5 15 11 3 3 8 13 15 7 5 8 4 6 8 5 5 3 3 2 8 6 7 4 4 8 8 15 10 9 16 6 11 5 10 8 6 23 21 9 9 6 16 18 4 18 4 5 9 15 8 8 8 13 9 3 2 1 2 2 2 2 1 3 2 3 5 3 3 14 18 11 6 6 5 11 5 6 6 4 2 1 5 11 27 25 6 8 5 9 5 8 13 5 10 5 7 11 28 21 5 14 25 10 8 7 5 14 3 2 3 7 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_47335760_47336927
seq2: B6Ng01-250H04.b_43_1201 (reverse)

seq1  AGCTGATATGAAGCCTTGGTGAGAGCAAGTAGTGACAGGCAAGATTTCAT  50
      ||||| |||||||||||||||||||| |||||||||| ||| ||||||||
seq2  AGCTG-TATGAAGCCTTGGTGAGAGC-AGTAGTGACA-GCAGGATTTCAT  47

seq1  GATCTTAATA-TCATCACAATTGCAATAATAATAGCAGACACTGACTGAA  99
      |||||||||| ||||| | ||||| ||||| ||||||||||||||||| |
seq2  GATCTTAATATTCATC-CCATTGC-ATAAT-ATAGCAGACACTGACTG-A  93

seq1  GCCTCTGGCGAGCCAGGTCTCACGTGAGGCCTTGGGCACACAGTACTTCA  149
      || ||| |||||||||||||||||||||||  ||||||||||||||||||
seq2  GCTTCT-GCGAGCCAGGTCTCACGTGAGGC--TGGGCACACAGTACTTCA  140

seq1  GTTTAGTCTCTATGTGGCCTATAGAGCCGTGCACAGAGTAGCCGAACCCC  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAGTCTCTATGTGGCCTATAGAGCCGTGCACAGAGTAGCCGAACCCC  190

seq1  TTGTAGCAGAATCAATTAGGCATCCCAATGTCACACAAAGGTAAAAAGGT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAGCAGAATCAATTAGGCATCCCAATGTCACACAAAGGTAAAAAGGT  240

seq1  CAGCTTTTACTGAGTAAGAAGTTTGTAAGATGATGAAATAAACTTGCATT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTTTTACTGAGTAAGAAGTTTGTAAGATGATGAAATAAACTTGCATT  290

seq1  TTCCAATTGGATATTATAGAACTCTGCAGCTAATGTCTAAAACAATCTTT  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAATTGGATATTATAGAACTCTGCAGCTAATGTCTAAAACAATCTTT  340

seq1  TAGTTTTAAAGAAAATAACATTGAACTTACGGAATTTTTTGTCTGCCCCT  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTTTAAAGAAAATAACATTGAACTTACGGAATTTTTTGTCTGCCCCT  390

seq1  CGGTACCTGCTGTTTACACCTCATTAATCCAAAAGAAGGTTCATATTTAT  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGTACCTGCTGTTTACACCTCATTAATCCAAAAGAAGGTTCATATTTAT  440

seq1  TACCTTTTTAAAAAACTTAGGCTCAAAACCTCACTGCCCATTCACAGGCA  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCTTTTTAAAAAACTTAGGCTCAAAACCTCACTGCCCATTCACAGGCA  490

seq1  CTAAATCTTGTTTCTTCTTTTTTGCTCCTGGACCTAAGCCTCACACCCAC  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAATCTTGTTTCTTCTTTTTTGCTCCTGGACCTAAGCCTCACACCCAC  540

seq1  TGGATTGGGATCAAACTGAAGAAACCCAGACTGCCTTAAAAGACTGCTAA  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATTGGGATCAAACTGAAGAAACCCAGACTGCCTTAAAAGACTGCTAA  590

seq1  CTGACCTCTTTCTTCCTTCCACCTTTGCCAATAGTATTTGATTACTGTGG  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACCTCTTTCTTCCTTCCACCTTTGCCAATAGTATTTGATTACTGTGG  640

seq1  TAGTTTCAATGAGGAATGGTCCCCCTAGACTCTTGTACTTGAATACTTGG  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTTCAATGAGGAATGGTCCCCCTAGACTCTTGTACTTGAATACTTGG  690

seq1  TCCCGAGTTGGTAGCACTGTTTGGGGATGTCATGAAACCTTTAGGAGCAG  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCGAGTTGGTAGCACTGTTTGGGGATGTCATGAAACCTTTAGGAGCAG  740

seq1  TAAACTTGCTGGAGGAGGCACATCTTTACGGATTGCTTTGAGATTTTATA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACTTGCTGGAGGAGGCACATCTTTACGGATTGCTTTGAGATTTTATA  790

seq1  TCCTTTCTTGTTCCAGTTTGCTCTCTGTTTGGCTTTTATGGTTGAGGATG  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTTCTTGTTCCAGTTTGCTCTCTGTTTGGCTTTTATGGTTGAGGATG  840

seq1  TAATCAGCCAGCTTCCTGCTCCTGCCATTAGCACGTGCCCTTATCATTAT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCAGCCAGCTTCCTGCTCCTGCCATTAGCACGTGCCCTTATCATTAT  890

seq1  GAACTTCATCTCCCTGTAACTATAAGCCAAAGTAAACTGATTCTTCTATA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTTCATCTCCCTGTAACTATAAGCCAAAGTAAACTGATTCTTCTATA  940

seq1  AGTCACTTTTGGTCACTTTCATCACAGCAACAAAAACTAACTAATGTAGT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCACTTTTGGTCACTTTCATCACAGCAACAAAAACTAACTAATGTAGT  990

seq1  TACCAAAGTCAAAGCTTTTAGATTGGCATTCGCAACTCTTTGGGTTCTGA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCAAAGTCAAAGCTTTTAGATTGGCATTCGCAACTCTTTGGGTTCTGA  1040

seq1  CTTCATCTTCCCCTCTTTCCTATGCTGCTGTGTAGCTTGCTAACCCCCAC  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCATCTTCCCCTCTTTCCTATGCTGCTGTGTAGCTTGCTAACCCCCAC  1090

seq1  CCTGGCAGATGTATTCCGTACCTTTGTACCTCTCTATTTTGCTACTTGGG  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCAGATGTATTCCGTACCTTTGTACCTCTCTATTTTGCTACTTGGG  1140

seq1  TTTCCATTGCCTGGAATTC  1168
      |||||||||||||||||||
seq2  TTTCCATTGCCTGGAATTC  1159

seq1: chr7_47180207_47181393
seq2: B6Ng01-250H04.g_66_1246

seq1  GAATTCAGTGATGGCTGCAGGGAGAGAGGAGCCCAGCCTCTCTGCTGTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTGATGGCTGCAGGGAGAGAGGAGCCCAGCCTCTCTGCTGTCT  50

seq1  GACTGCTCTTCCTGCTGTCTGGCTTCAGCCAACCCCAACTGCAATTTGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGCTCTTCCTGCTGTCTGGCTTCAGCCAACCCCAACTGCAATTTGGA  100

seq1  GAGTTGAGGAGTATGGTAAGGCAGCCCCCAAATGGCTACTTCATACAGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTGAGGAGTATGGTAAGGCAGCCCCCAAATGGCTACTTCATACAGCA  150

seq1  GAGAGCTGACAAGACATGGTGGAGTGGTAGTTAATCTAGAGGGCATAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGCTGACAAGACATGGTGGAGTGGTAGTTAATCTAGAGGGCATAAAG  200

seq1  GCAGAAGCTCCAGCTCAGGTGAGTGCTGTTGTTGGTGCTCCTCCCTAGAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGAAGCTCCAGCTCAGGTGAGTGCTGTTGTTGGTGCTCCTCCCTAGAT  250

seq1  GAGAAAAGGAGAGATGAGGTGACATGAGACATACGTTTTCAAAGAGCCTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAAGGAGAGATGAGGTGACATGAGACATACGTTTTCAAAGAGCCTG  300

seq1  TAAGAGACGGAGTCAGAAATGAGATGTTGGAGCTAGAGAAATGGCTCAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAGACGGAGTCAGAAATGAGATGTTGGAGCTAGAGAAATGGCTCAGA  350

seq1  GATTAGGACGCTTGCTATCCTCACAGAGGACCTTAGTTCAGTCCCTAGCA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTAGGACGCTTGCTATCCTCACAGAGGACCTTAGTTCAGTCCCTAGCA  400

seq1  TCCAATTTGAGTAGCTGACAAGTGCCTGTCACTCCAGCTCTGAGGAATCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAATTTGAGTAGCTGACAAGTGCCTGTCACTCCAGCTCTGAGGAATCT  450

seq1  GACACCTTTTTGTGCCTCTTCAGGTAACTGCATACACATGTGTGAGCACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACCTTTTTGTGCCTCTTCAGGTAACTGCATACACATGTGTGAGCACA  500

seq1  TGTATAACACACACACACACACACCAAATAAAAAAGATCTTAAGAATAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATAACACACACACACACACACCAAATAAAAAAGATCTTAAGAATAAA  550

seq1  TCAGTTTGGTTCTGGAAGGGCATGGGTGTGGATATCAAGACTTGTGCTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTTGGTTCTGGAAGGGCATGGGTGTGGATATCAAGACTTGTGCTCT  600

seq1  TAAACATCATTCCATGTGTCTGCTGTTTTCCTTCTAGACATCTCTGAGTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACATCATTCCATGTGTCTGCTGTTTTCCTTCTAGACATCTCTGAGTA  650

seq1  CCTGGGCTGGAATTTCTGGTTCCTTCTTTTCTGTCTCACTCCTTCATTCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGGCTGGAATTTCTGGTTCCTTCTTTTCTGTCTCACTCCTTCATTCA  700

seq1  AAGTTCAAGAGAAGGTGTACCTGTTAAGCGTCTATGAGACTTTGCTAGTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTCAAGAGAAGGTGTACCTGTTAAGCGTCTATGAGACTTTGCTAGTG  750

seq1  TCCACAGAGCTGTGAATATTCGGATTGGATTTCACATTTCAACAGGACCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACAGAGCTGTGAATATTCGGATTGGATTTCACATTTCAACAGGACCC  800

seq1  GAGAGCCCAGGGGAAGAAGTAGCAATTGAATGAGCACTGTCACCATCTCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGCCCAGGGGAAGAAGTAGCAATTGAATGAGCACTGTCACCATCTCC  850

seq1  TTGCTGTGTCTGTCCATGTCCACAGCTCTGGGTGAATCCTG-TTTAATTC  899
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TTGCTGTGTCTGTCCATGTCCACAGCTCTGGGTGAATCCTGTTTTAATTC  900

seq1  ACTAACAGCTTTATTTTCAGAAATAAAATAT-GAAGCTGTTGGTTGAACT  948
      ||||||||||||||||||||||||||||||| ||||||||||| |  |||
seq2  ACTAACAGCTTTATTTTCAGAAATAAAATATGGAAGCTGTTGGGTTGACT  950

seq1  GTGAAATTCTAATTATTTGAAATGTCAGATGTGAACTCCCAGCCTAGATC  998
      ||||||||||||||||||| ||||||||||||||||| ||||||||||||
seq2  GTGAAATTCTAATTATTTG-AATGTCAGATGTGAACT-CCAGCCTAGATC  998

seq1  TTCCCTTGGGTGGTGACGCTTCTGAGTCGGAAGTGTTTGTCACT-GAAAG  1047
      ||||||| |||||||||||||||||||||| ||||||||||||| |||||
seq2  TTCCCTT-GGTGGTGACGCTTCTGAGTCGGGAGTGTTTGTCACTGGAAAG  1047

seq1  CGAGGCAAGATAAGTATTGACAGAGGAACTGTGAACATTGTCCTTGCTCA  1097
      ||||||||||| ||||| ||| || || ||||| ||| |||| | ||| |
seq2  CGAGGCAAGATTAGTATGGACCGA-GACCTGTG-ACA-TGTCGTGGCTTA  1094

seq1  TGGCTCCTTATCGATCTGCCCTGCTGTACTTACATGCTCAGCCTGAGCCT  1147
      | ||| ||||||||||||||   ||||||||| ||||| || ||||||||
seq2  T-GCT-CTTATCGATCTGCCTGCCTGTACTTA-ATGCT-AG-CTGAGCCT  1139

seq1  TCCAGTCATAGCGCTTTCATTGAA--GTGGG--CCTCACACAGA  1187
        |||||  ||  |||||| || |  |||||  |||||||||||
seq2  --CAGTCTAAGGCCTTTCAATGGAGGGTGGGCCCCTCACACAGA  1181

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information