MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-250J04
Chromosome	7 (Build37)
Map Location	15,248,584 - 15,249,708
singlet/doublet	singlet
Overlap gene	EG194588
Upstream gene	LOC100042624, LOC100043194, Sult2a1, EG620627, EG434121, EG629203, LOC677512, EG629219, EG434123, 2810007J24Rik, EG638251, B430211C08Rik
Downstream gene	LOC666352, EG666312, LOC666365, LOC671978, LOC100042677, LOC100042685, EG666381, LOC100042691, LOC100042702, LOC100042707, LOC100042711, LOC100042714, LOC100042717, LOC100042721, LOC100042728, LOC100042731, LOC100042735, LOC100042739, LOC100042742, LOC235841, EG666407, LOC666337, Obox2, LOC100042753, LOC100042756, LOC100042758, EG545921, LOC100042762, Obox1, LOC100042765, Obox3
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042624 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 4 Proteins

name	Sult2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20859 MGI:98430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620627 MGI:3645687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG434121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434121 MGI:3645854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 14 Proteins

name	EG629203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629203 MGI:3645873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins

name	LOC677512 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG629219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629219 MGI:3648915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434123 MGI:3645855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	2810007J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76971 MGI:1924221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG638251 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638251 MGI:3645246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	B430211C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627280 MGI:3612342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG194588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194588 MGI:3646231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 8 Proteins

name	LOC666365 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	LOC671978 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100042677 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	EG666381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666381 MGI:3643193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins

name	LOC100042691 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042711 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC235841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:235841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG666407 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666407 MGI:3645947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins

name	LOC666337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 7 Proteins

name	Obox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246792 MGI:2149033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC100042753 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042756 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042758 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042758
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG545921 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545921 MGI:3704111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 7 Proteins

name	LOC100042762 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Obox1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71468 MGI:1918718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042765 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Obox3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246791 MGI:2149032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256466 GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : similar to androgen-repressible liver protein SMP-2, transcript variant 3 transcript_id : XM_001479814.1

name	LOC100043194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256464 GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to androgen-repressible liver protein SMP-2, transcript variant 1 transcript_id : XM_001479804.1

name	LOC100043194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256468 GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to androgen-repressible liver protein SMP-2, transcript variant 2 transcript_id : XM_001479810.1

name	Sult2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256075 GeneID:20859 MGI:98430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 transcript_id : XM_001471625.1

name	EG620627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82915970 GeneID:620627 MGI:3645687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG620627 transcript_id : XM_885022.1

name	EG434121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379450 GeneID:434121 MGI:3645854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 14 Proteins product : predicted gene, EG434121 transcript_id : XM_485863.4

name	EG629203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256471 GeneID:629203 MGI:3645873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : predicted gene, EG629203 transcript_id : XM_894052.3

name	EG629219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486756 GeneID:629219 MGI:3648915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG629219 transcript_id : NM_001081325.1

name	EG434123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379459 GeneID:434123 MGI:3645855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG434123 transcript_id : XM_485865.4

name	2810007J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801867 GeneID:76971 MGI:1924221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810007J24 gene transcript_id : NM_175250.4

name	EG638251 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256189 GeneID:638251 MGI:3645246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG638251 transcript_id : XM_983034.2

name	B430211C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702339 GeneID:627280 MGI:3612342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B430211C08 gene transcript_id : NM_001039146.1

name	EG194588 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579822 GeneID:194588 MGI:3646231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG194588 transcript_id : NM_001038676.1

name	EG666312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379457 GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 8 Proteins product : predicted gene, EG666312, transcript variant 2 transcript_id : XM_986100.1

name	EG666312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256477 GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 8 Proteins product : predicted gene, EG666312, transcript variant 1 transcript_id : XM_986068.2

name	LOC671978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256195 GeneID:671978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to G protein-binding protein CRFG transcript_id : XM_001478621.1

name	LOC100042677 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256197 GeneID:100042677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to OBOX4 transcript_id : XM_001478628.1

name	EG666381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256485 GeneID:666381 MGI:3643193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : predicted gene, EG666381 transcript_id : XM_983494.2

name	LOC100042691 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256212 GeneID:100042691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to OBOX4 transcript_id : XM_001478641.1

name	LOC100042702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256220 GeneID:100042702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478649.1

name	LOC100042707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256228 GeneID:100042707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478653.1

name	LOC100042711 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256230 GeneID:100042711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478659.1

name	LOC100042714 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256232 GeneID:100042714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478665.1

name	LOC100042717 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256234 GeneID:100042717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478673.1

name	LOC100042721 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256236 GeneID:100042721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478688.1

name	LOC100042728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256244 GeneID:100042728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478696.1

name	LOC100042731 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256246 GeneID:100042731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478707.1

name	LOC100042735 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256248 GeneID:100042735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478714.1

name	LOC100042739 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256250 GeneID:100042739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478722.1

name	LOC100042742 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256252 GeneID:100042742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478731.1

name	LOC235841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256254 GeneID:235841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478739.1

name	EG666407 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379475 GeneID:666407 MGI:3645947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins product : predicted gene, EG666407 transcript_id : XM_983633.1

name	LOC666337 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379466 GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 7 Proteins product : similar to OBOX3, transcript variant 2 transcript_id : XM_986171.1

name	LOC666337 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256492 GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 7 Proteins product : similar to OBOX3, transcript variant 1 transcript_id : XM_986137.2

name	LOC100042753 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256256 GeneID:100042753
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478746.1

name	LOC100042756 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256259 GeneID:100042756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478756.1

name	EG545921 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379469 GeneID:545921 MGI:3704111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 7 Proteins product : predicted gene, EG545921, transcript variant 2 transcript_id : XM_900102.2

name	EG545921 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379468 GeneID:545921 MGI:3704111
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 7 Proteins product : predicted gene, EG545921, transcript variant 1 transcript_id : XM_620426.3

name	LOC100042762 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256261 GeneID:100042762
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to OBOX4 transcript_id : XM_001478771.1

name	Obox1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130390 GeneID:71468 MGI:1918718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 1 transcript_id : NM_027802.2

name	Obox3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560755 GeneID:246791 MGI:2149032
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 3 transcript_id : NM_145707.2

name	LOC100043194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256467 GeneID:100043194
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 isoform 3 protein_id : XP_001479864.1

name	LOC100043194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256465 GeneID:100043194
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 isoform 1 protein_id : XP_001479854.1

name	LOC100043194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256469 GeneID:100043194
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 isoform 2 protein_id : XP_001479860.1

name	Sult2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256076 GeneID:20859 MGI:98430
definition	codon_start : 1 product : sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 protein_id : XP_001471675.1

name	EG620627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82915971 GeneID:620627 MGI:3645687
definition	codon_start : 1 product : similar to sulfotransferase:ISOTYPE=a1 protein_id : XP_890115.1

name	EG434121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256470 GeneID:434121 MGI:3645854
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 protein_id : XP_485863.4

name	EG629203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256472 GeneID:629203 MGI:3645873
definition	codon_start : 1 product : similar to sulfotransferase:ISOTYPE=a1 protein_id : XP_899145.3

name	EG629219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486757 GeneID:629219 MGI:3648915
definition	GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA] codon_start : 1 product : predicted gene, EG629219 protein_id : NP_001074794.1

name	EG434123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762917 GeneID:434123 MGI:3645855
definition	codon_start : 1 product : similar to Hoxb-4 homeodomain protein protein_id : XP_485865.1

name	2810007J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202011 CCDS:CCDS20833.1 GeneID:76971 MGI:1924221
definition	GO_function : GO:0004027 - alcohol sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76971 protein_id : NP_780459.1

name	EG638251 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256190 GeneID:638251 MGI:3645246
definition	codon_start : 1 product : similar to sulfotransferase:ISOTYPE=a1 protein_id : XP_988128.2

name	B430211C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702340 GeneID:627280 MGI:3612342
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC627280 protein_id : NP_001034235.1

name	EG194588 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579823 GeneID:194588 MGI:3646231
definition	codon_start : 1 product : hypothetical protein LOC194588 protein_id : NP_001033765.1

name	EG666312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379456 GeneID:666312 MGI:3647077
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_991162.1

name	EG666312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379458 GeneID:666312 MGI:3647077
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_991194.1

name	LOC671978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256196 GeneID:671978
definition	codon_start : 1 product : similar to G protein-binding protein CRFG protein_id : XP_001478671.1

name	LOC100042677 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256198 GeneID:100042677
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478678.1

name	EG666381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256486 GeneID:666381 MGI:3643193
definition	codon_start : 1 product : similar to OBOX3 protein_id : XP_988588.2

name	LOC100042691 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256213 GeneID:100042691
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478691.1

name	LOC100042702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256221 GeneID:100042702
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478699.1

name	LOC100042707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256229 GeneID:100042707
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478703.1

name	LOC100042711 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256231 GeneID:100042711
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478709.1

name	LOC100042714 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256233 GeneID:100042714
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478715.1

name	LOC100042717 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256235 GeneID:100042717
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478723.1

name	LOC100042721 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256237 GeneID:100042721
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478738.1

name	LOC100042728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256245 GeneID:100042728
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478746.1

name	LOC100042731 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256247 GeneID:100042731
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478757.1

name	LOC100042735 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256249 GeneID:100042735
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478764.1

name	LOC100042739 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256251 GeneID:100042739
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478772.1

name	LOC100042742 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256253 GeneID:100042742
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478781.1

name	LOC235841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256255 GeneID:235841
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478789.1

name	EG666407 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379476 GeneID:666407 MGI:3645947
definition	codon_start : 1 product : similar to p116Rip protein_id : XP_988727.1

name	LOC666337 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94379465 GeneID:666337
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_991231.1

name	LOC666337 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94379467 GeneID:666337
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_991265.1

name	LOC100042753 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256257 GeneID:100042753
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478796.1

name	LOC100042756 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256260 GeneID:100042756
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478806.1

name	EG545921 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555570 GeneID:545921 MGI:3704111
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_620426.1

name	EG545921 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903194 GeneID:545921 MGI:3704111
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_905195.1

name	LOC100042762 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256262 GeneID:100042762
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478821.1

name	Obox1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30841037 CCDS:CCDS20837.1 GeneID:71468 MGI:1918718
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : oocyte specific homeobox 1 protein_id : NP_082078.1

name	Obox3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560756 CCDS:CCDS20838.1 GeneID:246791 MGI:2149032
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : oocyte specific homeobox 3 protein_id : NP_663753.2

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 5 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 4 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 3 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 2 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 1 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 4 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 3 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 2 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 1 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 3 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 2 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 1 pseudo : _no_value

name	LOC100042758 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042758
definition	number : 1 pseudo : _no_value

name	LOC100042758 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042758
definition	number : 2 pseudo : _no_value

name	LOC100042758 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042758
definition	number : 3 pseudo : _no_value

name	LOC666365 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256478 GeneID:666365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to oocyte specific homeobox 3 pseudo : _no_value transcript_id : XR_034428.1

name	LOC100042685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256205 GeneID:100042685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 pseudo : _no_value transcript_id : XR_033800.1

name	Obox2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:118200339 GeneID:246792 MGI:2149033
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oocyte specific homeobox 2 pseudo : _no_value transcript_id : NR_003269.1

name	LOC100042765 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256263 GeneID:100042765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to oocyte specific homeobox 5 pseudo : _no_value transcript_id : XR_033880.1

clone name	MSMg01-072M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-206B24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052N23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112N21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-182B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389K08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-345K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060K08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159O22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-180N02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328F18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079D08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-210O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-435B22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-080K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159N22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459P23
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-284J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108C19
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-250J04.b	B6Ng01-250J04.g
ACC	GA058080	GA058081
length	973	1,106
definition	B6Ng01-250J04.b	B6Ng01-250J04.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcccttacactgggaaacagagccttcacaagaccaagggcctctc ccaacattgatgactgacaaggccatcatctgctacatatgcatctggag ccatgagtcccaccatgtgtactctatggttggtggtttagtccctggga gctctggggcttactggttagttcatatggttgtcccttctatgggactg caaatccttctgctccttaggtcctttctctagctccttcattgaggatc ctgtgctctgtccaatggatggctgtgagcatactatatatttctaatgc tatcctgaaagctccctataccctccccatgccctgctcccctacctacc cactcacacttcttggccctggcactccccttactgggacatataaagtt tgcaagatcaagggtcctctcttcccaacgagtacatacacttctgcatt tgtcagaaactgaaagagcttctttggagactatataaggctcctgtcag aaagcacttttgggcatccaaaatagcgtctgggtttggtgattgtatat gggacagatcctcaggtggatcaatctctgaatggtcattccctcagtct ctagtccacactttgtcttgtaactccttccatggatattttgttccccc ttctaagaagtatcaaagtatccagttttgtcttccttcatcttgagttt catgtggtttgtgaattgtatcttggggtattccaagctactgggctaat attctattatcagtgagtgcatatcatgtgtgctcttttgtgaatgggtt acatcactcaggatgttatcatacagatccatcaatttgcctaagaattt catatagtcattgtttttaataggtgagtagtactccattgtgtaaatgt accacattttctgtatccagtcctcagttgaggtacatctggggtttttt tccagcttctggctattataaaa	gaattcactgagggtcttttaggtatctattgacttggatgccctgagag tcttctcagagttcgtaaacatgggcccattacagcaccttgttgcattt ggatacctgattgtcttgatggtccttcagactcttgctgaagtaggttc ctttcagggactgaaagacttgattgcattgtacttcctggggtcactag gggactctgactcatttgaaaaggtaagttctttgccagttcttgaggta tttgggaactgatttctatgggtatattcgaagccacttgaagttttgga tgcaaggagggaccttcagccatatgtgtgttctgaacttattggagtat gttcctgtactggagaacctgttaaaaggaaaaacaatagaaaagctaca gagaacccccatttacccatcatgcctacctagcatttgttatggacatt ttgtagcaggaatcaatcaggaccctcattctttctgaacaacttcctct gtttcccaatcttaaaagtattttcagtattgccataaacatgcattaaa cagcagtgttaataagagactgttagtccagatagggggagaacacccaa ttgccagcccatgtttaaatgtcctagctcctgtccttctagcaggcaaa ttctgctaaggcagacgaccacctagtctgccccttccatgaaaaaaaaa aacacagcctaaaagcattctgtgcatgcagggaactcccaccagcttct ctgctctactgaagacaccatagcctaaagacatctcagaagttcaaatg caacaaaacatctgataaccagcccatctgcaacccacccctgaaaaaac acagcctgaagtaatcccaggcattgtgctcaaaacgcagccactgtcac aatgactaatcacatcccaggatttcttctacaacaatgcaaacagacaa ctgacaccaaagtctgaagacttcccaggggatctcagtaactgtacaac agtctgaagactccctaagtctgctgcacacagggaaaagaactcacagt cttagcccctggacaaagaacagctacagcagcacacctgactaatctct gagacc
quality values	Open. Hide. 58 31 31 33 62 62 62 62 62 62 62 47 26 62 62 49 49 62 47 62 62 51 37 62 62 62 62 62 62 62 43 34 43 28 24 25 29 28 24 27 46 48 49 62 62 62 62 62 49 54 62 54 46 62 59 59 62 62 62 54 54 62 59 59 62 62 59 62 62 62 62 62 62 59 59 62 62 56 59 49 43 62 59 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 59 62 62 62 62 54 62 62 62 59 62 59 59 62 59 62 59 62 62 59 62 62 62 54 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 58 58 58 58 58 58 54 54 54 58 54 58 58 58 58 58 54 41 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 48 58 58 54 58 54 54 58 58 58 58 58 58 41 52 58 54 58 58 58 58 41 54 54 41 42 58 54 58 58 58 54 58 51 58 58 58 58 49 53 50 58 53 51 58 51 58 58 49 36 50 58 58 42 40 52 51 58 58 58 58 50 48 51 58 58 58 58 51 51 58 39 53 58 35 58 58 32 49 46 52 51 35 58 58 52 50 42 47 50 50 51 53 58 58 58 58 52 41 51 50 43 42 54 50 54 49 39 50 51 54 54 53 51 30 42 58 51 52 41 47 58 52 52 52 50 58 49 51 50 49 50 54 27 54 58 39 53 42 53 42 39 37 54 54 35 35 35 18 19 36 40 31 51 44 50 41 39 37 42 54 54 54 49 39 33 29 39 40 53 50 40 37 50 32 52 45 45 45 53 34 54 47 54 42 54 46 51 32 37 30 34 31 26 42 47 51 30 49 53 45 34 40 42 54 54 40 52 36 32 51 14 15 47 36 31 25 31 31 37 40 45 35 34 35 33 40 10 4 14 32 30 45 32 38 30 32 33 35 42 31 31 25 28 31 31 21 31 26 33 31 31 33 36 45 31 14 14 21 32 21 33 13 51 29 34 51 31 28 25 30 28 30 32 28 29 31 23 31 31 38 33 46 46 46 31 17 28 31 31 37 36 31 31 42 11 31 31 31 36 27 30 31 30 17 23 31 33 32 32 41 11 16 48 33 22 36 33 32 25 31 32 32 21 38 48 48 30 13 14 36 26 29 31 29 31 31 21 17 31 31 34 32 26 9 23 32 29 31 14 19 25 27 32 21 28 31 31 16 41 41 11 31 41 36 41 33 41 23 15 21 32 21 21 25 8 15 12 33 24 10 4 4 24 16 23 12 30 43 47 48	Open. Hide. 62 59 59 59 62 59 49 59 62 62 49 39 38 35 32 48 48 56 56 54 54 54 54 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 59 48 42 54 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 54 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 54 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 54 45 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 54 54 58 54 58 54 58 52 58 58 53 53 51 51 58 51 58 53 51 58 53 51 51 58 58 58 58 54 41 58 42 45 53 49 58 58 50 54 58 58 58 49 41 47 51 51 43 38 44 54 58 58 58 51 50 58 58 54 58 50 58 58 58 54 41 58 51 52 53 53 58 54 50 51 51 51 46 49 50 50 51 50 23 58 50 50 58 53 49 51 52 51 49 43 49 37 41 23 49 23 51 49 39 36 42 53 30 50 40 49 58 51 50 40 49 41 50 51 42 33 33 46 51 49 27 33 37 52 52 51 54 49 54 54 54 54 54 54 54 26 39 39 53 39 52 54 54 35 33 54 54 52 32 41 31 44 51 38 52 42 39 52 37 30 42 42 40 37 38 54 54 53 35 29 45 34 54 44 27 40 44 34 40 45 53 53 31 32 35 34 40 31 52 40 35 33 33 32 45 40 53 35 40 31 28 20 34 30 41 36 25 51 53 39 30 47 32 35 31 27 21 41 35 38 32 38 25 48 34 19 30 15 31 31 46 42 31 30 20 22 26 31 31 46 51 24 30 29 43 45 45 45 42 32 31 26 32 28 16 30 30 46 31 24 31 29 31 36 33 20 31 28 41 26 25 32 40 33 24 26 31 37 48 48 46 46 27 31 16 28 20 14 31 36 19 26 24 27 19 26 16 31 31 29 48 27 26 32 23 19 24 35 22 36 31 31 31 37 32 18 47 48 31 31 27 31 30 14 29 11 9 26 27 30 17 24 10 28 5 21 31 34 32 33 38 29 19 31 27 17 22 13 29 32 44 31 26 25 19 19 19 48 38 32 33 31 21 26 32 34 11 11 14 9 17 14 32 21 21 48 30 31 27 27 32 18 10 24 20 21 26 31 16 17 6 24 8 31 33 22 17 15 18 25 32 30 6 4 5 24 14 8 21 12 7 6 43 43 20 19 24 7 16 9 10 6 13 13 21 14 16 16 6 6 20 13 7 16 7 8 20 24 16 15 27 30 15 28 9 20 11 33 17 19 14 20 8 16 15 10 19 27 15 8 11 8 15 8 9 9 18 31 11 16 32 47 32 13 26 27 11 16 8 15 16 16 10 18 17 6 11 8 15 6 19 15 11 4 9 8 6 7 8 30 21 6 10 22 5 12 16 20 10 9 16 6 24 5 6 5 2 2 4 5 7 17 4 8 18 16 21 8 14 19 8 3 4 15 14 18 8 14 5 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_15248584_15249708
seq2: B6Ng01-250J04.g_68_1173 (reverse)

seq1  GGTCTTCAGAGGATTAGTCAAGGTGTTGCCCTGCCTGTAGCTGTTCTTTG  50
      |||| ||||| |||||||| ||||||    ||| ||||||||||||||||
seq2  GGTC-TCAGA-GATTAGTC-AGGTGT---GCTG-CTGTAGCTGTTCTTTG  43

seq1  TCCAGGGGGGCCTAAGGACTGTGAGTTCTTTTTCCCTGTGTGCAGCAGAA  100
      ||||||||   |||| |||||||||||| |||||||||||||||||||| 
seq2  TCCAGGGG---CTAA-GACTGTGAGTTC-TTTTCCCTGTGTGCAGCAGA-  87

seq1  CTTTAGGGAGTCTTTCAGACTGTTGGTACAGTTACTGAAGATCCCCTGGG  150
        |||||||||| ||||||||||| |||||||||||| ||||||||||||
seq2  -CTTAGGGAGTC-TTCAGACTGTT-GTACAGTTACTG-AGATCCCCTGGG  133

seq1  AAGTCTTCAGACTTTGGTGTCAGTTGTCTGTTTGCATTGTTTGTAGAAGA  200
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  AAGTCTTCAGACTTTGGTGTCAGTTGTCTGTTTGCATTG-TTGTAGAAGA  182

seq1  AATCCTGGGATGTGATTAGTCATTGGTGACAGTGGCTGCGTTTTGAGCAC  250
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  AATCCTGGGATGTGATTAGTCATT-GTGACAGTGGCTGCGTTTTGAGCAC  231

seq1  AATGCCTGGGATTACTTCAGGCTGTGTTTTTTCAGGGGTGGGTTGCAGAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCCTGGGATTACTTCAGGCTGTGTTTTTTCAGGGGTGGGTTGCAGAT  281

seq1  GGGCTGGTTATCAGATGTTTTGTTGCATTTGAACTTCTGAGATGTCTTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTGGTTATCAGATGTTTTGTTGCATTTGAACTTCTGAGATGTCTTTA  331

seq1  GGCTATGGTGTCTTCAGTAGAGCAGAGAAGCTGGTGGGAGTTCCCTGCAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTATGGTGTCTTCAGTAGAGCAGAGAAGCTGGTGGGAGTTCCCTGCAT  381

seq1  GCACAGAATGCTTTTAGGCTGTGTTTTTTTTTTTCATGGAAGGGGCAGAC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAGAATGCTTTTAGGCTGTGTTTTTTTTTTTCATGGAAGGGGCAGAC  431

seq1  TAGGTGGTCGTCTGCCTTAGCAGAATTTGCCTGCTAGAAGGACAGGAGCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTGGTCGTCTGCCTTAGCAGAATTTGCCTGCTAGAAGGACAGGAGCT  481

seq1  AGGACATTTAAACATGGGCTGGCAATTGGGTGTTCTCCCCCTATCTGGAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACATTTAAACATGGGCTGGCAATTGGGTGTTCTCCCCCTATCTGGAC  531

seq1  TAACAGTCTCTTATTAACACTGCTGTTTAATGCATGTTTATGGCAATACT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACAGTCTCTTATTAACACTGCTGTTTAATGCATGTTTATGGCAATACT  581

seq1  GAAAATACTTTTAAGATTGGGAAACAGAGGAAGTTGTTCAGAAAGAATGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATACTTTTAAGATTGGGAAACAGAGGAAGTTGTTCAGAAAGAATGA  631

seq1  GGGTCCTGATTGATTCCTGCTACAAAATGTCCATAACAAATGCTAGGTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTCCTGATTGATTCCTGCTACAAAATGTCCATAACAAATGCTAGGTAG  681

seq1  GCATGATGGGTAAATGGGGGTTCTCTGTAGCTTTTCTATTGTTTTTCCTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGATGGGTAAATGGGGGTTCTCTGTAGCTTTTCTATTGTTTTTCCTT  731

seq1  TTAACAGGTTCTCCAGTACAGGAACATACTCCAATAAGTTCAGAACACAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACAGGTTCTCCAGTACAGGAACATACTCCAATAAGTTCAGAACACAC  781

seq1  ATATGGCTGAAGGTCCCTCCTTGCATCCAAAACTTCAAGTGGCTTCGAAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGGCTGAAGGTCCCTCCTTGCATCCAAAACTTCAAGTGGCTTCGAAT  831

seq1  ATACCCATAGAAATCAGTTCCCAAATACCTCAAGAACTGGCAAAGAACTT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCCATAGAAATCAGTTCCCAAATACCTCAAGAACTGGCAAAGAACTT  881

seq1  ACCTTTTCAAATGAGTCAGAGTCCCCTAGTGACCCCAGGAAGTACAATGC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTTTCAAATGAGTCAGAGTCCCCTAGTGACCCCAGGAAGTACAATGC  931

seq1  AATCAAGTCTTTCAGTCCCTGAAAGGAACCTACTTCAGCAAGAGTCTGAA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAAGTCTTTCAGTCCCTGAAAGGAACCTACTTCAGCAAGAGTCTGAA  981

seq1  GGACCATCAAGACAATCAGGTATCCAAATGCAACAAGGTGCTGTAATGGG  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGACCATCAAGACAATCAGGTATCCAAATGCAACAAGGTGCTGTAATGGG  1031

seq1  CCCATGTTTACGAACTCTGAGAAGACTCTCAGGGCATCCAAGTCAATAGA  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCATGTTTACGAACTCTGAGAAGACTCTCAGGGCATCCAAGTCAATAGA  1081

seq1  TACCTAAAAGACCCTCAGTGAATTC  1125
      |||||||||||||||||||||||||
seq2  TACCTAAAAGACCCTCAGTGAATTC  1106

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information