MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-255M06
Chromosome	7 (Build37)
Map Location	25,260,218 - 25,438,064
singlet/doublet	doublet
Overlap gene	Plaur, Cadm4, Zfp428, Irgq, 2310033E01Rik, Xrcc1, Zfp575, Ethe1, LOC100043138, EG232970, Lypd3
Upstream gene	LOC100043095, EG622032, LOC667651, LOC100043101, LOC100043103, EG546944, V1rd7, V1rd9, EG545934, V1rd22, LOC384573, EG622222, LOC546943, V1rd12, V1rd13, V1rd17, LOC100043121, V1rd16, LOC384575, V1rd20, V1rd18, V1rd15, EG622446, Zfp180, Zfp112, Zfp235, Zfp114, Zfp111, Zfp109, Zfp108, Zfp93, LOC100043690, Zfp61, LOC100043691, Zfp94, 1700008P20Rik, Lypd5, Kcnn4, 1500002O20Rik, Irgc1
Downstream gene	LOC100043706, Tex101, Gm1096, BC049730, EG210155, Cd177, Ceacam10, EG545936, LOC100043712, Lypd4, Dmrtc2, Rps19, Cd79a, Arhgef1, EG232974, Rabac1, Atp1a3, Grik5, Zfp574, Pou2f2, Dedd2, Zfp526, Gsk3a, 9130221H12Rik, Erf, Cic, Pafah1b3, EG623131, Tmem145, Megf8, Cnfn, Lipe, BC024561, LOC434148, Ceacam1, Ceacam2, LOC100043722, EG632778, 2310004L02Rik, B3gnt8, Bckdha
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043095 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	EG622032 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622032 MGI:3644421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC667651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	LOC100043103 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	EG546944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546944 MGI:3644326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	V1rd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81012 MGI:3033476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81010 MGI:3033478
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545934 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545934 MGI:3645760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 Proteins

name	V1rd22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404291 MGI:3033491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384573 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384573
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG622222 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622222 MGI:3648367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	LOC546943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	V1rd12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384572 MGI:3033481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232959 MGI:3033482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404286 MGI:3033486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 293 ESTs, 13 Proteins pseudo : _no_value

name	V1rd16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232962 MGI:3033485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384575 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	V1rd20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404289 MGI:3033489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rd18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404287 MGI:3033487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	V1rd15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209824 MGI:3033484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622446 MGI:3644252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Zfp180 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210135 MGI:1923701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57745 MGI:1929115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp235 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56525 MGI:1929117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232966 MGI:3037815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp111 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56707 MGI:1929114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56869 MGI:1929099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp108 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54678 MGI:1891198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp93 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22755 MGI:107611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043690 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Zfp61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22719 MGI:99663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043691 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Zfp94 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22756 MGI:107610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700008P20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69301 MGI:1916551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Lypd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76942 MGI:1924192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16534 MGI:1277957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500002O20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71997 MGI:1919247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irgc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210145 MGI:2685948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plaur (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18793 MGI:97612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cadm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260299 MGI:2449088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp428 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232969 MGI:1916463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irgq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210146 MGI:2667176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310033E01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:641361 MGI:3615324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xrcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22594 MGI:99137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101544 MGI:2141921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ethe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66071 MGI:1913321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043138 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG232970 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232970 MGI:3642959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 4 Proteins

name	Lypd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72434 MGI:1919684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Tex101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56746 MGI:1930791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1096 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381959 MGI:2685942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	BC049730 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232972 MGI:2681843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG210155 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210155 MGI:3643098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd177 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68891 MGI:1916141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26366 MGI:1347248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545936 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545936 MGI:3645761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043712 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 745 ESTs, 1 Protein

name	Lypd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232973 MGI:2687054
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmrtc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71241 MGI:1918491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20085 MGI:1333780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd79a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12518 MGI:101774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16801 MGI:1353510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG232974 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232974 MGI:3642958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	Rabac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14470 MGI:1201692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp1a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232975 MGI:88107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grik5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14809 MGI:95818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp574 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232976 MGI:2442951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pou2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18987 MGI:101897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dedd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67379 MGI:1914629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp526 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210172 MGI:2445181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gsk3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:606496 MGI:2152453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130221H12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77124 MGI:1924374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Erf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13875 MGI:109637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cic (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71722 MGI:1918972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pafah1b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18476 MGI:108414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623131 MGI:3648539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330485 MGI:3607779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Megf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269878 MGI:2446294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 2 Proteins

name	Cnfn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72383 MGI:1919633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lipe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC024561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232983 MGI:2387642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434148 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 112 ESTs, 7 Proteins pseudo : _no_value

name	Ceacam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Ceacam2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26367 MGI:1347246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043722 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins pseudo : _no_value

name	EG632778 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632778 MGI:3646269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310004L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66349 MGI:1913599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Bckdha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12039 MGI:107701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043095 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256436 GeneID:100043095
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : similar to vomeronasal receptor V1RD12 transcript_id : XM_001479476.1

name	EG622032 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82904588 GeneID:622032 MGI:3644421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG622032 transcript_id : XM_886441.1

name	LOC100043101 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256438 GeneID:100043101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : similar to vomeronasal receptor V1RD12 transcript_id : XM_001479495.1

name	LOC100043103 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256440 GeneID:100043103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : similar to pheromone receptor V3R7 transcript_id : XM_001479499.1

name	EG546944 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256442 GeneID:546944 MGI:3644326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : predicted gene, EG546944 transcript_id : XM_621762.3

name	V1rd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723604 GeneID:81012 MGI:3033476
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D7 transcript_id : NM_030737.2

name	V1rd9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507693 GeneID:81010 MGI:3033478
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D9 transcript_id : NM_030735.1

name	EG545934 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380024 GeneID:545934 MGI:3645760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 Proteins product : predicted gene, EG545934 transcript_id : XM_620442.3

name	V1rd22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430547 GeneID:404291 MGI:3033491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D22 transcript_id : NM_207548.1

name	EG622222 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256444 GeneID:622222 MGI:3648367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : predicted gene, EG622222 transcript_id : XM_886633.2

name	LOC546943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256446 GeneID:546943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : similar to pheromone receptor V3R7 transcript_id : XM_001479520.1

name	V1rd12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047413 GeneID:384572 MGI:3033481
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D12 transcript_id : NM_206872.1

name	V1rd13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047403 GeneID:232959 MGI:3033482
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D13 transcript_id : NM_206868.1

name	V1rd17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430549 GeneID:404286 MGI:3033486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D17 transcript_id : NM_207545.1

name	V1rd16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46047416 GeneID:232962 MGI:3033485
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D16 transcript_id : NM_206869.1

name	V1rd20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430543 GeneID:404289 MGI:3033489
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D20 transcript_id : NM_207546.1

name	V1rd18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46518531 GeneID:404287 MGI:3033487
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : vomeronasal 1 receptor, D18 transcript_id : NM_207618.1

name	V1rd15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45237184 GeneID:209824 MGI:3033484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D15 transcript_id : NM_203489.1

name	EG622446 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82904621 GeneID:622446 MGI:3644252
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG622446 transcript_id : XM_897102.1

name	Zfp180 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113866021 GeneID:210135 MGI:1923701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 180 transcript_id : NM_001045486.1

name	Zfp112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865972 GeneID:57745 MGI:1929115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 112 transcript_id : NM_021307.2

name	Zfp235 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392087 GeneID:56525 MGI:1929117
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 235 transcript_id : NM_019941.2

name	Zfp114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113930748 GeneID:232966 MGI:3037815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 114 transcript_id : NM_001029933.2

name	Zfp111 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910605 GeneID:56707 MGI:1929114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 111 transcript_id : NM_019940.1

name	Zfp109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9931981 GeneID:56869 MGI:1929099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 109 transcript_id : NM_020262.1

name	Zfp108 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055387 GeneID:54678 MGI:1891198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 108 transcript_id : NM_018791.1

name	Zfp93 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937380 GeneID:22755 MGI:107611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 93 transcript_id : NM_009567.4

name	LOC100043690 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256648 GeneID:100043690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043690 transcript_id : XM_001480747.1

name	Zfp61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247403 GeneID:22719 MGI:99663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 61 transcript_id : NM_009561.2

name	LOC100043691 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256650 GeneID:100043691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : hypothetical protein LOC100043691 transcript_id : XM_001480753.1

name	Zfp94 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892753 GeneID:22756 MGI:107610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 94 transcript_id : NM_009568.2

name	Lypd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118150403 GeneID:76942 MGI:1924192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/Plaur domain containing 5 transcript_id : NM_029806.1

name	Kcnn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803303 GeneID:16534 MGI:1277957
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4 transcript_id : NM_008433.3

name	1500002O20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130421 GeneID:71997 MGI:1919247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500002O20 gene transcript_id : NM_028047.2

name	Irgc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031979 GeneID:210145 MGI:2685948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunity-related GTPase family, cinema 1 transcript_id : NM_199013.2

name	Plaur (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982773 GeneID:18793 MGI:97612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasminogen activator, urokinase receptor transcript_id : NM_011113.2

name	Cadm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802508 GeneID:260299 MGI:2449088
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell adhesion molecule 4 transcript_id : NM_153112.3

name	Zfp428 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122718 GeneID:232969 MGI:1916463
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 428 transcript_id : NM_146183.1

name	Irgq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328371 GeneID:210146 MGI:2667176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunity-related GTPase family, Q transcript_id : NM_153134.2

name	2310033E01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372919 GeneID:641361 MGI:3615324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310033E01 gene transcript_id : NM_001037143.2

name	Xrcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803238 GeneID:22594 MGI:99137
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-ray repair complementing defective repair in Chinese hamster cells 1 transcript_id : NM_009532.3

name	Zfp575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350679 GeneID:101544 MGI:2141921
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 575 transcript_id : NM_001033205.2

name	Ethe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990178 GeneID:66071 MGI:1913321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ethylmalonic encephalopathy 1 transcript_id : NM_023154.3

name	LOC100043138 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256450 GeneID:100043138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043138 transcript_id : XM_001479598.1

name	EG232970 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256452 GeneID:232970 MGI:3642959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 4 Proteins product : predicted gene, EG232970 transcript_id : XM_001479604.1

name	Lypd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526945 GeneID:72434 MGI:1919684
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/Plaur domain containing 3 transcript_id : NM_133743.1

name	LOC100043706 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256652 GeneID:100043706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043706 transcript_id : XM_001480789.1

name	Tex101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130519 GeneID:56746 MGI:1930791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 101 transcript_id : NM_019981.2

name	Gm1096 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380029 GeneID:381959 MGI:2685942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : gene model 1096, (NCBI) transcript_id : XM_992620.1

name	BC049730 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59933291 GeneID:232972 MGI:2681843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC049730 transcript_id : NM_199150.1

name	EG210155 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559427 GeneID:210155 MGI:3643098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG210155 transcript_id : NM_177593.1

name	Cd177 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328435 GeneID:68891 MGI:1916141
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD177 antigen transcript_id : NM_026862.3

name	Ceacam10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352593 GeneID:26366 MGI:1347248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 10 transcript_id : NM_007675.3

name	LOC100043712 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256655 GeneID:100043712
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 mRNAs, 745 ESTs, 1 Protein product : similar to thymosin, beta 10 transcript_id : XM_001480801.1

name	Lypd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802293 GeneID:232973 MGI:2687054
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ly6/Plaur domain containing 4 transcript_id : NM_182785.2

name	Dmrtc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27532960 GeneID:71241 MGI:1918491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : doublesex and mab-3 related transcription factor like family C2 transcript_id : NM_027732.1

name	Rps19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963510 GeneID:20085 MGI:1333780
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S19 transcript_id : NM_023133.1

name	Cd79a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386539 GeneID:12518 MGI:101774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD79A antigen (immunoglobulin-associated alpha) transcript_id : NM_007655.3

name	Arhgef1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678667 GeneID:16801 MGI:1353510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 1 transcript_id : NM_008488.1

name	EG232974 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256454 GeneID:232974 MGI:3642958
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG232974 transcript_id : XM_992867.2

name	Rabac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676377 GeneID:14470 MGI:1201692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rab acceptor 1 (prenylated) transcript_id : NM_010261.2

name	Atp1a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450320 GeneID:232975 MGI:88107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Na+/K+ transporting, alpha 3 polypeptide transcript_id : NM_144921.1

name	Grik5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680092 GeneID:14809 MGI:95818
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate receptor, ionotropic, kainate 5 (gamma 2) transcript_id : NM_008168.1

name	Zfp574 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363109 GeneID:232976 MGI:2442951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 574 transcript_id : NM_175477.3

name	Pou2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755131 GeneID:18987 MGI:101897
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : POU domain, class 2, transcription factor 2 transcript_id : NM_011138.1

name	Dedd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299735 GeneID:67379 MGI:1914629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death effector domain-containing DNA binding protein 2 transcript_id : NM_207677.3

name	Zfp526 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802142 GeneID:210172 MGI:2445181
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 526 transcript_id : NM_175436.3

name	Gsk3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384360 GeneID:606496 MGI:2152453
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycogen synthase kinase 3 alpha transcript_id : NM_001031667.1

name	9130221H12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341578 GeneID:77124 MGI:1924374
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130221H12 gene transcript_id : NM_178400.2

name	Erf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254587 GeneID:13875 MGI:109637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ets2 repressor factor transcript_id : NM_010155.2

name	Cic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475687 GeneID:71722 MGI:1918972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capicua homolog (Drosophila) transcript_id : NM_027882.2

name	Pafah1b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679200 GeneID:18476 MGI:108414
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit transcript_id : NM_008776.1

name	EG623131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486844 GeneID:623131 MGI:3648539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG623131 transcript_id : NM_001081294.1

name	Tmem145 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637852 GeneID:330485 MGI:3607779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 145 transcript_id : NM_183311.2

name	Megf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256457 GeneID:269878 MGI:2446294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 2 Proteins product : multiple EGF-like-domains 8 transcript_id : XM_194337.7

name	Cnfn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487008 GeneID:72383 MGI:1919633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornifelin transcript_id : NM_001081375.1

name	Lipe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239969 GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, hormone sensitive transcript_id : NM_010719.5

name	Lipe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239971 GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, hormone sensitive transcript_id : NM_001039507.1

name	BC024561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891726 GeneID:232983 MGI:2387642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024561 transcript_id : NM_153576.2

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719312 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039187.1

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719302 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_011926.2

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719300 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039186.1

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719298 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039185.1

name	Ceacam2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802842 GeneID:26367 MGI:1347246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 2 transcript_id : NM_007543.3

name	EG632778 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381235 GeneID:632778 MGI:3646269
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG632778 transcript_id : NM_001039243.2

name	2310004L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377182 GeneID:66349 MGI:1913599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310004L02 gene transcript_id : NM_025504.3

name	B3gnt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92087056 GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 transcript_id : NM_146184.4

name	B3gnt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92087052 GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 transcript_id : NM_001036740.2

name	Bckdha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389002 GeneID:12039 MGI:107701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : branched chain ketoacid dehydrogenase E1, alpha polypeptide transcript_id : NM_007533.3

name	LOC100043095 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256437 GeneID:100043095
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD12 protein_id : XP_001479526.1

name	EG622032 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904589 GeneID:622032 MGI:3644421
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_891534.1

name	LOC100043101 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256439 GeneID:100043101
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD12 protein_id : XP_001479545.1

name	LOC100043103 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256441 GeneID:100043103
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_001479549.1

name	EG546944 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256443 GeneID:546944 MGI:3644326
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_621762.3

name	V1rd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507698 GeneID:81012 MGI:3033476
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R7 product : vomeronasal 1 receptor, D7 protein_id : NP_109662.1

name	V1rd9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507694 CCDS:CCDS20932.1 GeneID:81010 MGI:3033478
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R9 product : vomeronasal 1 receptor, D9 protein_id : NP_109660.1

name	EG545934 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63565483 GeneID:545934 MGI:3645760
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD22 protein_id : XP_620442.1

name	V1rd22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430548 CCDS:CCDS20933.1 GeneID:404291 MGI:3033491
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, D22 protein_id : NP_997431.1

name	EG622222 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256445 GeneID:622222 MGI:3648367
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_891726.2

name	LOC546943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256447 GeneID:546943
definition	codon_start : 1 product : similar to pheromone receptor V3R7 protein_id : XP_001479570.1

name	V1rd12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047414 CCDS:CCDS20934.1 GeneID:384572 MGI:3033481
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor V1RD12 product : vomeronasal 1 receptor, D12 protein_id : NP_996755.1

name	V1rd13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047404 CCDS:CCDS20935.1 GeneID:232959 MGI:3033482
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : vomeronasal receptor V1RD13 product : vomeronasal 1 receptor, D13 protein_id : NP_996751.1

name	V1rd17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430550 CCDS:CCDS20936.1 GeneID:404286 MGI:3033486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D17 protein_id : NP_997428.1

name	V1rd16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46047417 CCDS:CCDS20937.1 GeneID:232962 MGI:3033485
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vomeronasal receptor V1RD16 product : vomeronasal 1 receptor, D16 protein_id : NP_996752.1

name	V1rd20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430544 CCDS:CCDS20938.1 GeneID:404289 MGI:3033489
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, D20 protein_id : NP_997429.1

name	V1rd18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518532 CCDS:CCDS20939.1 GeneID:404287 MGI:3033487
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vomeronasal 1 receptor, D18 protein_id : NP_997501.1

name	V1rd15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45237185 CCDS:CCDS20940.1 GeneID:209824 MGI:3033484
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D15 protein_id : NP_987074.1

name	EG622446 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904622 GeneID:622446 MGI:3644252
definition	codon_start : 1 product : hypothetical protein protein_id : XP_902195.1

name	Zfp180 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866022 GeneID:210135 MGI:1923701
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 180 protein_id : NP_001038951.1

name	Zfp112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865973 GeneID:57745 MGI:1929115
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 112 protein_id : NP_067282.2

name	Zfp235 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392088 GeneID:56525 MGI:1929117
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 235 protein_id : NP_064325.2

name	Zfp114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113930749 GeneID:232966 MGI:3037815
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 114 protein_id : NP_001025104.2

name	Zfp111 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910606 CCDS:CCDS20944.1 GeneID:56707 MGI:1929114
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 111 protein_id : NP_064324.1

name	Zfp109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9931982 GeneID:56869 MGI:1929099
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 109 protein_id : NP_064658.1

name	Zfp108 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055388 GeneID:54678 MGI:1891198
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : zinc finger protein 108 protein_id : NP_061261.1

name	Zfp93 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677629 GeneID:22755 MGI:107611
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 93 protein_id : NP_033593.1

name	LOC100043690 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256649 GeneID:100043690
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480797.1

name	Zfp61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247404 GeneID:22719 MGI:99663
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 61 protein_id : NP_033587.2

name	LOC100043691 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256651 GeneID:100043691
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480803.1

name	Zfp94 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677631 CCDS:CCDS20945.1 GeneID:22756 MGI:107610
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 94 protein_id : NP_033594.1

name	Lypd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118150404 GeneID:76942 MGI:1924192
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : Ly6/Plaur domain containing 5 protein_id : NP_084082.1

name	Kcnn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982238 CCDS:CCDS20948.1 GeneID:16534 MGI:1277957
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0015269 - calcium-activated potassium channel activity [Evidence IDA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0050714 - positive regulation of protein secretion [Evidence IDA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : intermediate conductance calcium-activated potassium channel protein 1 protein_id : NP_032459.2

name	1500002O20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312548 CCDS:CCDS20949.1 GeneID:71997 MGI:1919247
definition	codon_start : 1 product : hypothetical protein LOC71997 protein_id : NP_082323.1

name	Irgc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134031980 GeneID:210145 MGI:2685948
definition	codon_start : 1 note : interferon inducible GTPase 5; interferon inducible GTPase family member 5 product : immunity-related GTPase family, cinema 1 protein_id : NP_950178.2

name	Plaur (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242179 CCDS:CCDS20950.1 GeneID:18793 MGI:97612
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0030377 - U-plasminogen activator receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 function : cell surface binding of urokinase note : urokinase-type plasminogen activator receptor product : urokinase plasminogen activator receptor protein_id : NP_035243.1

name	Cadm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346547 CCDS:CCDS20951.1 GeneID:260299 MGI:2449088
definition	codon_start : 1 note : TSLC1-like 2; membrane glycoprotein Tsll2; SynCAM 4 product : immunoglobulin superfamily, member 4C protein_id : NP_694752.1

name	Zfp428 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122719 CCDS:CCDS20952.1 GeneID:232969 MGI:1916463
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 428 protein_id : NP_666295.1

name	Irgq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328372 CCDS:CCDS20953.1 GeneID:210146 MGI:2667176
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : immunity-related GTPase family, Q1 product : FKSG27 protein_id : NP_694774.2

name	2310033E01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702280 CCDS:CCDS20954.1 GeneID:641361 MGI:3615324
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004859 - phospholipase inhibitor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC641361 protein_id : NP_001032220.1

name	Xrcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56118250 CCDS:CCDS20955.1 GeneID:22594 MGI:99137
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0000012 - single strand break repair [Evidence IEA] codon_start : 1 exception : mismatches in translation product : X-ray repair complementing defective repair in Chinese hamster cells 1 protein_id : NP_033558.2

name	Zfp575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701718 CCDS:CCDS20956.1 GeneID:101544 MGI:2141921
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 575 protein_id : NP_001028377.1

name	Ethe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963539 CCDS:CCDS20957.1 GeneID:66071 MGI:1913321
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ETHE1 protein protein_id : NP_075643.1

name	LOC100043138 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256451 GeneID:100043138
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479648.1

name	EG232970 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256453 GeneID:232970 MGI:3642959
definition	codon_start : 1 product : similar to pleckstrin homology-like domain, family B, member 3 protein_id : XP_001479654.1

name	Lypd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526946 CCDS:CCDS20958.1 GeneID:72434 MGI:1919684
definition	GO_component : GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0043236 - laminin binding [Evidence ISS] GO_process : GO:0006928 - cell motility [Evidence ISS]; GO:0007160 - cell-matrix adhesion [Evidence ISS] codon_start : 1 product : GPI-anchored metastasis-associated protein homolog protein_id : NP_598504.1

name	LOC100043706 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256653 GeneID:100043706
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480839.1

name	Tex101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910582 CCDS:CCDS20959.1 GeneID:56746 MGI:1930791
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : testis-specific protein TES101RP protein_id : NP_064365.1

name	Gm1096 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380030 GeneID:381959 MGI:2685942
definition	codon_start : 1 product : similar to CDNA sequence BC049730 protein_id : XP_997714.1

name	BC049730 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59933292 CCDS:CCDS20960.1 GeneID:232972 MGI:2681843
definition	codon_start : 1 product : hypothetical protein LOC232972 protein_id : NP_954601.1

name	EG210155 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559428 GeneID:210155 MGI:3643098
definition	codon_start : 1 product : hypothetical protein LOC210155 protein_id : NP_808261.1

name	Cd177 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328436 CCDS:CCDS20962.1 GeneID:68891 MGI:1916141
definition	codon_start : 1 product : CD177 antigen protein_id : NP_081138.2

name	Ceacam10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982465 GeneID:26366 MGI:1347248
definition	codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 10 product : CEA-related cell adhesion molecule 10 protein_id : NP_031701.2

name	LOC100043712 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256656 GeneID:100043712
definition	codon_start : 1 product : similar to thymosin, beta 10 protein_id : XP_001480851.1

name	Lypd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33354251 CCDS:CCDS20964.1 GeneID:232973 MGI:2687054
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 product : Ly6/Plaur domain containing 4 protein_id : NP_877586.1

name	Dmrtc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532961 CCDS:CCDS20965.1 GeneID:71241 MGI:1918491
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007548 - sex differentiation [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : doublesex and mab-3 related transcription factor 7 protein_id : NP_082008.1

name	Rps19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963511 CCDS:CCDS20966.1 GeneID:20085 MGI:1333780
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005843 - cytosolic small ribosomal subunit (sensu Eukaryota) [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0030218 - erythrocyte differentiation [Evidence ISS]; GO:0007516 - hemocyte development (sensu Arthropoda) [Evidence ISS]; GO:0051272 - positive regulation of cell motility [Evidence ISS]; GO:0009991 - response to extracellular stimulus [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein S19 protein_id : NP_075622.1

name	Cd79a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677429 CCDS:CCDS20967.1 GeneID:12518 MGI:101774
definition	GO_component : GO:0019815 - B cell receptor complex [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005771 - multivesicular body [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0050853 - B cell receptor signaling pathway [Evidence IDA]; GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 note : Ig alpha; immunoglobulin-associated alpha product : CD79A antigen (immunoglobulin-associated alpha) protein_id : NP_031681.2

name	Arhgef1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678668 GeneID:16801 MGI:1353510
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007266 - Rho protein signal transduction [Evidence IEA] codon_start : 1 note : lymphoid blast crisis like 2 product : Rho guanine nucleotide exchange factor (GEF) 1 protein_id : NP_032514.1

name	EG232974 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256455 GeneID:232974 MGI:3642958
definition	codon_start : 1 product : similar to hCG2040171 protein_id : XP_997961.2

name	Rabac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859558 CCDS:CCDS20968.1 GeneID:14470 MGI:1201692
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : GTP binding protein associated protein 1 product : Rab acceptor 1 protein_id : NP_034391.1

name	Atp1a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450321 CCDS:CCDS20969.1 GeneID:232975 MGI:88107
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005890 - sodium:potassium-exchanging ATPase complex [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0015077 - monovalent inorganic cation transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0015991 - ATP hydrolysis coupled proton transport [Evidence ISS]; GO:0008150 - biological_process [Evidence ND]; GO:0006812 - cation transport [Evidence IEA]; GO:0030641 - hydrogen ion homeostasis [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0015672 - monovalent inorganic cation transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence ISS] [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] [Evidence ISS]; GO:0030317 - sperm motility [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : Na+/K+ -ATPase alpha 3 subunit protein_id : NP_659170.1

name	Grik5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680093 CCDS:CCDS20970.1 GeneID:14809 MGI:95818
definition	GO_component : GO:0008328 - ionotropic glutamate receptor complex [Evidence IC]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005234 - glutamate-gated ion channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0004970 - ionotropic glutamate receptor activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glutamate receptor, ionotropic, kainate 5 (gamma 2) protein_id : NP_032194.1

name	Zfp574 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425222 CCDS:CCDS20971.1 GeneID:232976 MGI:2442951
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 574 protein_id : NP_780686.1

name	Pou2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755132 GeneID:18987 MGI:101897
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0048469 - cell maturation [Evidence IMP]; GO:0048305 - immunoglobulin secretion [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : POU domain, class 2, transcription factor 2 protein_id : NP_035268.1

name	Dedd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299736 CCDS:CCDS20973.1 GeneID:67379 MGI:1914629
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : death effector domain-containing DNA-binding protein 2 product : death effector domain-containing DNA binding protein 2 protein_id : NP_997560.3

name	Zfp526 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425158 CCDS:CCDS20975.1 GeneID:210172 MGI:2445181
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 526 protein_id : NP_780645.1

name	Gsk3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384361 CCDS:CCDS20976.1 GeneID:606496 MGI:2152453
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 product : glycogen synthase kinase 3 alpha protein_id : NP_001026837.1

name	9130221H12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409968 GeneID:77124 MGI:1924374
definition	codon_start : 1 product : hypothetical protein LOC77124 protein_id : NP_848487.1

name	Erf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254588 CCDS:CCDS20978.1 GeneID:13875 MGI:109637
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Est2 repressor factor product : Ets2 repressor factor protein_id : NP_034285.2

name	Cic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16507202 GeneID:71722 MGI:1918972
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : capicua homolog protein_id : NP_082158.1

name	Pafah1b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679201 CCDS:CCDS20979.1 GeneID:18476 MGI:108414
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003847 - 1-alkyl-2-acetylglycerophosphocholine esterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] [Evidence IGI] codon_start : 1 product : platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit protein_id : NP_032802.1

name	EG623131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486845 GeneID:623131 MGI:3648539
definition	codon_start : 1 product : predicted gene, EG623131 protein_id : NP_001074763.1

name	Tmem145 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119637853 GeneID:330485 MGI:3607779
definition	codon_start : 1 product : hypothetical protein LOC330485 protein_id : NP_899134.2

name	Megf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256458 GeneID:269878 MGI:2446294
definition	codon_start : 1 product : multiple EGF-like-domains 8 protein_id : XP_194337.7

name	Cnfn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487009 GeneID:72383 MGI:1919633
definition	GO_component : GO:0001533 - cornified envelope [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cornifelin protein_id : NP_001074844.1

name	Lipe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239970 CCDS:CCDS20981.1 GeneID:16890 MGI:96790
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016298 - lipase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0046340 - diacylglycerol catabolism [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0019433 - triacylglycerol catabolism [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; hormone-sensitive lipase product : lipase, hormone sensitive isoform 1 protein_id : NP_034849.2

name	Lipe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239972 CCDS:CCDS20982.1 GeneID:16890 MGI:96790
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016298 - lipase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0046340 - diacylglycerol catabolism [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0019433 - triacylglycerol catabolism [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; hormone-sensitive lipase product : lipase, hormone sensitive isoform 2 protein_id : NP_001034596.1

name	BC024561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133891727 GeneID:232983 MGI:2387642
definition	codon_start : 1 note : 13.6-kDa protein product : VEGF co-regulated chemokine 1 protein_id : NP_705804.2

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719303 CCDS:CCDS20985.1 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 3 protein_id : NP_036056.2

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719299 CCDS:CCDS20984.1 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 1 protein_id : NP_001034274.1

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719313 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 4 protein_id : NP_001034276.1

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719301 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 2 protein_id : NP_001034275.1

name	Ceacam2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671734 CCDS:CCDS20986.1 GeneID:26367 MGI:1347246
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : biliary glycoprotein 2 product : CEA-related cell adhesion molecule 2 protein_id : NP_031569.1

name	EG632778 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986651 CCDS:CCDS20987.1 GeneID:632778 MGI:3646269
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC632778 protein_id : NP_001034332.1

name	2310004L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560249 CCDS:CCDS20988.1 GeneID:66349 MGI:1913599
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66349 protein_id : NP_079780.2

name	B3gnt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861482 CCDS:CCDS20989.1 GeneID:232984 MGI:2385269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030311 - poly-N-acetyllactosamine biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 7 protein_id : NP_001031817.1

name	B3gnt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122729 CCDS:CCDS20989.1 GeneID:232984 MGI:2385269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030311 - poly-N-acetyllactosamine biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 7 protein_id : NP_666296.1

name	Bckdha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982494 GeneID:12039 MGI:107701
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003863 - 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity [Evidence IEA]; GO:0016536 - cyclin-dependent protein kinase 5 activator regulator activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016624 - oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : BCKAD E1[a] product : branched chain ketoacid dehydrogenase E1, alpha polypeptide protein_id : NP_031559.2

name	LOC667651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667651
definition	number : 1 pseudo : _no_value

name	LOC667651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667651
definition	number : 2 pseudo : _no_value

name	LOC384573 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384573
definition	number : 1 pseudo : _no_value

name	LOC384573 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384573
definition	number : 2 pseudo : _no_value

name	LOC384573 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384573
definition	number : 3 pseudo : _no_value

name	LOC384575 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384575
definition	number : 1 pseudo : _no_value

name	LOC100043121 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256448 GeneID:100043121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 293 ESTs, 13 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9) pseudo : _no_value transcript_id : XR_034255.1

name	1700008P20Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256081 GeneID:69301 MGI:1916551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700008P20 gene pseudo : _no_value transcript_id : XR_035153.1

name	EG545936 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256654 GeneID:545936 MGI:3645761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG545936 transcript_id : XR_035466.1

name	LOC434148 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256657 GeneID:434148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 112 ESTs, 7 Proteins product : similar to GrpE-like 2, mitochondrial pseudo : _no_value transcript_id : XR_034878.1

name	LOC100043722 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256658 GeneID:100043722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to ribosomal protein L15 pseudo : _no_value transcript_id : XR_034880.1

clone name	MSMg01-269H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-135F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-336L04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336P14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-526A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064O07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-488I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-165D24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101P15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-468P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108N21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466C16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-095N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-522M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-267L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519E05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524E20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-322A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477G17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-170L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153D01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-419A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-115A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-412D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206H24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-255M06.b	B6Ng01-255M06.g
ACC	GA061894	GA061895
length	845	1,062
definition	B6Ng01-255M06.b	B6Ng01-255M06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(25,437,242 - 25,438,064)	(25,260,218 - 25,261,280)
sequence	gaattccagggtagcctaggctacattgcatgttctaagccaggttgagt tatgtagttatataccaggaccttgtctggaaagatggatggagcatggg ggtaggaggaggaaaaaggggagggaagagaaagagaaagcccatgttgt caagggaagaagagggaagataaagagtggagctgattaaaaaattaaag ggggggggctggagagatgacttagcagttaagagcactggctacacttt cggaagtccagagttcaattcccagcaaccacatggtggctcacaaccat ctgtaatgcgatctgatgccctcttctggtgtgtctgaagacagctacag tgtactcacatacataaaataaatagatttaaaaacaaaacgaaaacaaa caaaacctaactgggctagagagatagatgtgcaaatcaattttaattaa aaaaaaaactttaaattaaaaaaaagggaaagaaaatcaagagagctaga gagacagctcaggggataaaagcccacaaataaaagctcttgaagagggc atgagctcagttcccagcacgatcaccacgtgcctcacgatcactcttaa ctccgttttcggtggaattcaatgtctcccaccttcggaggtattcattc ccatgcattgcaaaacaccttaattctaaaataaaaataaaataaaataa attttaaaactgtatgggaaaaaatagaaaataaattgcttgcagggcct aaagagatagctcttcaccttaaagagcccgtaacctgctcctggctcag gacctgggttttggtttcccaacaccccacaatccctggctccta	gaattcttactcggactcaccgactcttctttttcctcagtgctgggaaa ccggagttataccgtaagaggctgcgccacggcttcctggtgccaaggct cccacgtggcagactccttcccgacccacctcaacgtctctgtctcctgc tgccacggcagcggctgtaacagccccacagggggcgcccccaggccagg ccctgctcaactcagcctcattgcctctctgctcctgaccctcggactat ggggcgtcctcctctggacctgactcctgagccggcagccctggctggac ccagggtcttttgactccctcccccctgctccatctttgaggatgtgtgt gccctcgtgttgtcttctttggacctcagtttttccatgaaccagaagag aattggaacaagggctgcgggcagcaggggcctcttagttgagataatat tgttgctgttattattattattatcattgttattgctctaatttattata taaatatatatataaaagatttttgtaccagtgaacaaggttgggtctcc ccactgtcacatttagcttgggaagatgagagcagcagggaattgttttt ttgtttgtttgtttgtttgattgattgattgatttttgctttgagacagg atctcaccatgtagccctagctgccctggaacttactttatagaccaggc tagcctaaaactcacagagacccacctgcctctacctcctcagtgctttg attaaaggtgtgtaccaccatgcctggctaggtctcttactgaaccccag agcccactggtttgactatgcaggttgagaggatgctgcagatcgtcctg tctcccaagcacgataaccacagaggtactaagactgtctggtttttttg ttttgttttgtttgtttgttttgttttttttaaatgggtacaggggatct gaactcaggttctcctatttctggagccagtactgtatccacaaagctgt cttcccagctccccagtctatattcattgctgatggctttccacgggggt gggggaaagggg
quality values	Open. Hide. 58 36 35 41 62 62 31 19 52 49 49 47 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 59 62 62 59 56 50 59 51 45 29 46 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 59 59 62 54 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 59 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 56 50 59 51 59 62 62 62 59 62 59 62 59 51 62 56 62 62 62 59 59 59 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 59 49 59 49 54 46 51 62 59 59 56 56 34 50 43 43 43 51 49 59 49 59 40 51 49 49 46 59 59 51 59 51 50 40 46 56 56 51 56 35 56 59 59 59 59 59 59 32 34 56 34 36 43 41 34 34 43 51 46 46 45 43 34 43 34 34 50 49 51 56 34 46 50 51 30 51 46 56 62 59 56 59 50 46 50 46 34 56 48 51 59 40 56 56 59 59 38 34 48 43 49 43 48 40 59 59 59 59 59 59 59 24 24 27 28 40 41 56 62 56 59 18 12 13 23 28 19 34 59 49 49 34 48 50 46 48 18 13 12 34 13 24 49 49 49 24 39 30 51 37 56 43 46 51 51 48 50 50 50 50 46 46 46 38 59 59 49 51 50 48 46 59 49 49 30 43 43 46 38 48 54 59 56 59 59 43 49 50 46 50 51 24 18 23 23 16 27 27 43 49 48 48 35 37 51 59 23 40 28 50 34 43 18 25 18 33 49 59 59 56 34 34 34 40 43 41 34 46 56 59 59 29 34 36 35 44 49 43 37 46 46 51 51 43 38 43 49 24 34 16 16 13 13 43 34 34 32 41 43 40 50 49 46 56 62 43 43 45 27 34 36 39 34 34 39 43 17 23 34 51 23 43 39 50 38 34 30 32 34 46 34 49 43 30 11 18 12 17 24 11 56 17 16 20 18 12 18 46 50 27 28 30 19 25 23 19 20 11 19 19 16 15 23 11 30 30 39 16 30 30 46 44 39 59 43 59 46 19 19 25 31 36 10 12 10 16 15 10 24 31 18 30 34 39 9 17 18 13 12 30 38 43 43 39 20 30 24 21 43 44 39 45 41 41 41 18 11 24 8 10 8 8 13 17 21 21 22 14 22 51 56 62 27 14 19 17 10 20 11 39 16 51 13 26 17 13 10 13 16 32 24 56 25 25 14 14 11 16 10 51 37 32 32 38 10 16 38 24 35 16 32 31 23 15 14 11 20 21 19 42 24 24 30 13 9 22 10 24 33 15 10 22 11 24 24 39 39 14 22 27 26 15 22 26 15 18 27 24 51 39 30 26 25 42 21 18 29 12 33 23 34 26 23 29 42 32 29 22 36 43 46 38 30 39 39 20 29 26 21 24 13 9 31 23 27 32 42 42 17 21 18 21 15 17 13 20 27 27 23 23 23 23 42 18 32 27 22 10 10 14 20 29 19 32 20 21 23 8 13 9 41 18 50 27 52 19 15 20 22 18 20 30 27 18 10 10 10 39 15 21 27 14 8 38 33 23 28 20 14 14 12 7 9 10 20 25 17 18 12 10 11 14 20 14 6 4 41 12 18 33 17 27 35 33 25 27 19 17 35 18 50 35 21 50 23 19 14 7 12 8 15 15 9 10 14 10 23 15 14 10 17 19 20 12 26 26 14 13 22 20 25 21 25	Open. Hide. 62 49 42 47 62 62 62 59 62 59 62 62 62 62 59 59 62 59 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 59 62 62 62 62 62 62 62 62 49 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 54 58 48 58 58 58 58 58 54 54 54 54 54 50 52 58 58 58 54 49 54 49 58 58 54 58 58 58 58 58 58 58 58 58 54 52 54 54 58 58 54 52 54 54 54 54 58 58 52 58 58 58 58 58 58 58 58 35 58 32 58 58 31 58 50 58 54 53 58 58 48 58 58 49 51 41 58 58 53 58 58 58 58 58 58 49 46 58 58 58 50 58 58 58 52 54 58 58 51 54 58 54 58 25 58 49 53 46 58 58 54 48 58 58 46 32 58 58 58 58 41 37 58 41 58 37 58 40 49 44 48 37 58 37 50 58 58 51 50 46 50 33 50 41 46 53 42 53 58 49 41 52 37 51 51 50 29 31 22 49 54 44 58 35 40 51 50 43 40 50 54 34 40 52 50 50 47 40 40 50 50 51 50 50 42 34 50 54 41 32 54 54 49 40 51 35 37 38 49 39 54 32 49 31 26 39 37 50 54 41 39 33 51 42 39 37 34 53 39 38 34 52 39 32 37 28 37 42 37 52 54 37 34 52 31 23 17 54 24 11 15 26 53 45 54 38 26 28 51 43 38 24 21 42 53 37 51 33 47 51 30 27 32 24 34 9 27 53 40 36 52 35 35 32 42 31 31 32 51 40 32 26 32 33 12 26 47 25 18 27 20 15 39 40 53 31 28 30 31 33 36 31 31 31 34 25 32 21 22 27 42 20 45 10 37 22 14 36 39 38 36 32 35 24 37 31 34 31 21 23 31 21 30 30 30 36 30 42 33 25 37 31 30 16 22 17 42 29 33 22 18 16 21 32 31 22 16 6 19 21 30 32 36 26 29 14 25 13 30 39 9 37 28 31 46 27 46 48 48 41 39 31 31 22 39 46 33 22 9 33 44 18 46 46 46 31 44 46 46 31 29 29 38 42 28 25 24 41 29 44 36 41 41 17 24 43 18 10 31 41 22 16 32 25 7 9 28 41 14 11 12 14 21 13 31 21 9 21 24 10 29 14 42 12 7 4 6 26 16 21 27 43 22 19 23 33 25 21 6 15 7 29 17 22 32 23 15 9 5 18 20 24 22 15 21 10 39 25 12 15 10 8 8 15 21 29 22 36 20 21 27 24 7 15 29 30 11 16 6 5 5 5 9 8 7 10 7 7 19 26 24 27 25 27 16 8 5 10 6 28 10 21 12 15 21 20 11 18 28 40 40 23 6 7 34 34 34 20 8 26 5 5 28 20 21

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_25437242_25438064
seq2: B6Ng01-255M06.b_47_891 (reverse)

seq1  TAGGAGCCAGG--ATGT-GGGTGCTGGGAA--CCAAACCCAGGTCCTCTG  45
      |||||||||||   ||| ||||| ||||||  | |||||||||||||  |
seq2  TAGGAGCCAGGGATTGTGGGGTGTTGGGAAACCAAAACCCAGGTCCTGAG  50

seq1  -CAGGAGCA-GCTAC-GGCTCTT--AAGTGAAGAGCTATCTCTCT-GGCC  89
       |||||||| | ||| |||||||  | |||||||||||||||| | ||||
seq2  CCAGGAGCAGGTTACGGGCTCTTTAAGGTGAAGAGCTATCTCTTTAGGCC  100

seq1  CTGC-AGC-ATTTA-TTTCTATTTTT--CCATACAGTTTTAAATTTTATT  134
      |||| ||| ||||| |||||||||||  ||||||||||||||| ||||||
seq2  CTGCAAGCAATTTATTTTCTATTTTTTCCCATACAGTTTTAAAATTTATT  150

seq1  TTATTTTA-TTTTATTTTAGAATT-AGGTG-TTTGC-ATGCATGTG-ATG  179
      |||||||| ||||||||||||||| ||||| ||||| ||||||| | |||
seq2  TTATTTTATTTTTATTTTAGAATTAAGGTGTTTTGCAATGCATGGGAATG  200

seq1  AATACCTCTGAAGGT-GGAGACATTGAATTCCACCGAAAACGGAGTTAAG  228
      |||||||| |||||| ||||||||||||||||||||||||||||||||||
seq2  AATACCTCCGAAGGTGGGAGACATTGAATTCCACCGAAAACGGAGTTAAG  250

seq1  AGTGATCGTGAGGCACGTGGTGATCGTGCTGGGAACTGAGCTCATGCCCT  278
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGATCGTGAGGCACGTGGTGATCGTGCTGGGAACTGAGCTCATGCCCT  300

seq1  CTTCAAGAGCTTTTATTTGTGGGCTTTTATCCCCTGAGCTGTCTCTCTAG  328
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAAGAGCTTTTATTTGTGGGCTTTTATCCCCTGAGCTGTCTCTCTAG  350

seq1  CTCTCTTGATTTTCTTTCCCTTTTTTTTAATTTAAAGTTTTTTTTTTAAT  378
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTTGATTTTCTTTCCCTTTTTTTTAATTTAAAGTTTTTTTTTTAAT  400

seq1  TAAAATTGATTTGCACATCTATCTCTCTAGCCCAGTTAGGTTTTGTTTGT  428
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAATTGATTTGCACATCTATCTCTCTAGCCCAGTTAGGTTTTGTTTGT  450

seq1  TTTCGTTTTGTTTTTAAATCTATTTATTTTATGTATGTGAGTACACTGTA  478
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCGTTTTGTTTTTAAATCTATTTATTTTATGTATGTGAGTACACTGTA  500

seq1  GCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCGCATTACAGATGGT  528
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTCTTCAGACACACCAGAAGAGGGCATCAGATCGCATTACAGATGGT  550

seq1  TGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCTGGACTTCCGAAAGT  578
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCTGGACTTCCGAAAGT  600

seq1  GTAGCCAGTGCTCTTAACTGCTAAGTCATCTCTCCAGCCCCCCCCCTTTA  628
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGCCAGTGCTCTTAACTGCTAAGTCATCTCTCCAGCCCCCCCCCTTTA  650

seq1  ATTTTTTAATCAGCTCCACTCTTTATCTTCCCTCTTCTTCCCTTGACAAC  678
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTTAATCAGCTCCACTCTTTATCTTCCCTCTTCTTCCCTTGACAAC  700

seq1  ATGGGCTTTCTCTTTCTCTTCCCTCCCCTTTTTCCTCCTCCTACCCCCAT  728
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGCTTTCTCTTTCTCTTCCCTCCCCTTTTTCCTCCTCCTACCCCCAT  750

seq1  GCTCCATCCATCTTTCCAGACAAGGTCCTGGTATATAACTACATAACTCA  778
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCATCCATCTTTCCAGACAAGGTCCTGGTATATAACTACATAACTCA  800

seq1  ACCTGGCTTAGAACATGCAATGTAGCCTAGGCTACCCTGGAATTC  823
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGGCTTAGAACATGCAATGTAGCCTAGGCTACCCTGGAATTC  845

seq1: chr7_25260218_25261280
seq2: B6Ng01-255M06.g_70_1131

seq1  GAATTCTTACTCGGACTCACCGACTCTTCTTTTTCCTCAGTGCTGGGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTACTCGGACTCACCGACTCTTCTTTTTCCTCAGTGCTGGGAAA  50

seq1  CCGGAGTTATACCGTAAGAGGCTGCGCCACGGCTTCCTGGTGCCAAGGCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGAGTTATACCGTAAGAGGCTGCGCCACGGCTTCCTGGTGCCAAGGCT  100

seq1  CCCACGTGGCAGACTCCTTCCCGACCCACCTCAACGTCTCTGTCTCCTGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACGTGGCAGACTCCTTCCCGACCCACCTCAACGTCTCTGTCTCCTGC  150

seq1  TGCCACGGCAGCGGCTGTAACAGCCCCACAGGGGGCGCCCCCAGGCCAGG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCACGGCAGCGGCTGTAACAGCCCCACAGGGGGCGCCCCCAGGCCAGG  200

seq1  CCCTGCTCAACTCAGCCTCATTGCCTCTCTGCTCCTGACCCTCGGACTAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGCTCAACTCAGCCTCATTGCCTCTCTGCTCCTGACCCTCGGACTAT  250

seq1  GGGGCGTCCTCCTCTGGACCTGACTCCTGAGCCGGCAGCCCTGGCTGGAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGCGTCCTCCTCTGGACCTGACTCCTGAGCCGGCAGCCCTGGCTGGAC  300

seq1  CCAGGGTCTTTTGACTCCCTCCCCCCTGCTCCATCTTTGAGGATGTGTGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGGGTCTTTTGACTCCCTCCCCCCTGCTCCATCTTTGAGGATGTGTGT  350

seq1  GCCCTCGTGTTGTCTTCTTTGGACCTCAGTTTTTCCATGAACCAGAAGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTCGTGTTGTCTTCTTTGGACCTCAGTTTTTCCATGAACCAGAAGAG  400

seq1  AATTGGAACAAGGGCTGCGGGCAGCAGGGGCCTCTTAGTTGAGATAATAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGGAACAAGGGCTGCGGGCAGCAGGGGCCTCTTAGTTGAGATAATAT  450

seq1  TGTTGCTGTTATTATTATTATTATCATTGTTATTGCTCTAATTTATTATA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGCTGTTATTATTATTATTATCATTGTTATTGCTCTAATTTATTATA  500

seq1  TAAATATATATATAAAAGATTTTTGTACCAGTGAACAAGGTTGGGTCTCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATATATATATAAAAGATTTTTGTACCAGTGAACAAGGTTGGGTCTCC  550

seq1  CCACTGTCACATTTAGCTTGGGAAGATGAGAGCAGCAGGGAATTGTTTTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTGTCACATTTAGCTTGGGAAGATGAGAGCAGCAGGGAATTGTTTTT  600

seq1  TTGTTTGTTTGTTTGTTTGATTGATTGATTGATTTTTGCTTTGAGACAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTTGTTTGTTTGTTTGATTGATTGATTGATTTTTGCTTTGAGACAGG  650

seq1  ATCTCACCATGTAGCCCTAGCTGCCCTGGAACTTACTTTATAGACCAGGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTCACCATGTAGCCCTAGCTGCCCTGGAACTTACTTTATAGACCAGGC  700

seq1  TAGCCTAAAACTCACAGAGACCCACCTGCCTCTACCTCCTCAGTGCTTTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCCTAAAACTCACAGAGACCCACCTGCCTCTACCTCCTCAGTGCTTTG  750

seq1  ATTAAAGGTGTGTACCACCATGCCTGGCTAGGTCTCTTACTGAACCCCAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAAGGTGTGTACCACCATGCCTGGCTAGGTCTCTTACTGAACCCCAG  800

seq1  AGCCCACTGGTTTGACTATGCAGGTTGAGAGGATGCTGCAGATCGTCCTG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCACTGGTTTGACTATGCAGGTTGAGAGGATGCTGCAGATCGTCCTG  850

seq1  TCTCCCAAGCACGATAACCACAGAGGTACTAAGACTGTCTGGTTTTTTTG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCAAGCACGATAACCACAGAGGTACTAAGACTGTCTGGTTTTTTTG  900

seq1  TTTTGTTTTGTTTTGTTTTGTTTTGTTTTTTTTAAATGGGTACAGGGGAT  950
      |||||||||||||   ||||||||||||||||||||||||||||||||||
seq2  TTTTGTTTTGTTT--GTTTGTTTTGTTTTTTTTAAATGGGTACAGGGGAT  948

seq1  CTGAACTCAGGTTCTCCTATTTCTGGAGCCAAGTACTGTATCCACAAAGC  1000
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  CTGAACTCAGGTTCTCCTATTTCTGGAGCC-AGTACTGTATCCACAAAGC  997

seq1  TGTCTTCCCAGCCCCCCAGTCTATA-TCATTGCTGAT-GCCTTCCACGGG  1048
      |||||||||||| |||||||||||| ||||||||||| || |||||||||
seq2  TGTCTTCCCAGCTCCCCAGTCTATATTCATTGCTGATGGCTTTCCACGGG  1047

seq1  GGTGGGGGAAGGGGG  1063
      |||||||||| ||||
seq2  GGTGGGGGAAAGGGG  1062

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information