MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-257C22
Chromosome	7 (Build37)
Map Location	33,619,248 - 33,620,388
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC668351, EG384593, LOC100043351, LOC100043352, LOC100043353, EG384594, LOC100043838, EG668361, LOC668362, EG624584, LOC100043355, LOC546951, EG626740, EG668371, EG668377, LOC100043842, LOC634929, EG668379, EG668381, LOC668386, LOC626373, EG384589, EG668393, EG330689, LOC100043362, LOC100043365, EG384591, LOC668398, EG384596, LOC100043370, LOC434161, EG270499, LOC100043845, LOC100043373, LOC668410, EG624439
Downstream gene	LOC100043376, LOC100043379, LOC100043383, EG668411, LOC100043850, LOC100043386, LOC668416, EG668526, LOC100043388, LOC270234, EG668419, EG668422, EG546954, LOC100043856, LOC100043857, EG545947, EG434676, EG668431, Abpd, EG545948, LOC435963, LOC435962, EG626970, LOC100043859, LOC627004, LOC100043398, LOC100043401, Scgb2b1, LOC668440, Abpz, LOC100043860
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC668351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG384593 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384593 MGI:3647423
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043351 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043351
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043353 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG384594 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384594 MGI:3647426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043838 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043838
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG668361 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668361 MGI:3648386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins pseudo : _no_value

name	LOC668362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG624584 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624584 MGI:3643785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	LOC100043355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC546951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG626740 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626740 MGI:3646832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein

name	EG668371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668371 MGI:3645182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	EG668377 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668377 MGI:3645179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100043842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC634929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG668379 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668379 MGI:3645177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	EG668381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668381 MGI:3645736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins

name	LOC668386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	LOC626373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG384589 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384589 MGI:3644231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins

name	EG668393 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668393 MGI:3646192
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	EG330689 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330689 MGI:3649164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043362 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043365 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG384591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384591 MGI:3647424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	LOC668398 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG384596 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384596 MGI:3644821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434161 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434161
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG270499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270499 MGI:3647682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043845 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins pseudo : _no_value

name	LOC668410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG624439 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624439 MGI:3644904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins

name	LOC100043376 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043379 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043379
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043383 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG668411 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668411 MGI:3647266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins

name	LOC100043850 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043386 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins pseudo : _no_value

name	LOC668416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG668526 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668526 MGI:3647697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 2 Proteins

name	LOC100043388 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC270234 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:270234
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG668419 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668419 MGI:3643719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein

name	EG668422 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668422 MGI:3646870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	EG546954 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546954 MGI:3647537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100043856 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC100043857 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	EG545947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545947 MGI:3648809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins

name	EG434676 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434676 MGI:3646447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins

name	EG668431 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668431 MGI:3643941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	Abpd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:494519 MGI:3514009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545948 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545948 MGI:3648810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins

name	LOC435963 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 24 Proteins pseudo : _no_value

name	LOC435962 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:435962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG626970 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626970 MGI:3648283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043859 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC627004 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627004
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC100043398 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043401 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Scgb2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353109 MGI:2655747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	LOC668440 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668440
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Abpz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233090 MGI:2655741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043860 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC100043352 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256517 GeneID:100043352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001480006.1

name	LOC100043353 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256519 GeneID:100043353
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : similar to pol protein transcript_id : XM_001480011.1

name	EG384594 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086278 GeneID:384594 MGI:3647426
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG384594 transcript_id : XM_357734.1

name	EG624584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380174 GeneID:624584 MGI:3643785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 1 Protein product : predicted gene, EG624584, transcript variant 1 transcript_id : XM_892661.2

name	EG624584 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256697 GeneID:624584 MGI:3643785
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 1 Protein product : predicted gene, EG624584, transcript variant 2 transcript_id : XM_900241.3

name	LOC100043355 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256522 GeneID:100043355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein eta transcript_id : XM_001480020.1

name	EG626740 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380140 GeneID:626740 MGI:3646832
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : predicted gene, EG626740 transcript_id : XM_891349.2

name	LOC100043842 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256698 GeneID:100043842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to lacrimal androgen-binding protein delta transcript_id : XM_001481120.1

name	LOC634929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256524 GeneID:634929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001480028.1

name	EG668379 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256700 GeneID:668379 MGI:3645177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins product : predicted gene, EG668379 transcript_id : XM_001001176.2

name	EG668381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256701 GeneID:668381 MGI:3645736
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : predicted gene, EG668381 transcript_id : XM_001001188.2

name	EG384589 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380147 GeneID:384589 MGI:3644231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : predicted gene, EG384589 transcript_id : XM_357730.5

name	EG330689 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51744732 GeneID:330689 MGI:3649164
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG330689 transcript_id : XM_286083.2

name	EG384591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256526 GeneID:384591 MGI:3647424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : predicted gene, EG384591 transcript_id : XM_357732.6

name	EG384596 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086282 GeneID:384596 MGI:3644821
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG384596 transcript_id : XM_357735.1

name	LOC434161 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256532 GeneID:434161
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001480058.1

name	EG270499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25032836 GeneID:270499 MGI:3647682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG270499 transcript_id : XM_195264.1

name	EG624439 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380180 GeneID:624439 MGI:3644904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : predicted gene, EG624439, transcript variant 2 transcript_id : XM_900233.2

name	EG624439 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256702 GeneID:624439 MGI:3644904
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 1 Protein product : predicted gene, EG624439, transcript variant 3 transcript_id : XM_001004117.2

name	LOC100043376 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256535 GeneID:100043376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein eta transcript_id : XM_001480067.1

name	LOC100043383 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256537 GeneID:100043383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001480076.1

name	EG668411 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380151 GeneID:668411 MGI:3647266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins product : predicted gene, EG668411 transcript_id : XM_001001333.1

name	EG668526 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380187 GeneID:668526 MGI:3647697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : predicted gene, EG668526, transcript variant 1 transcript_id : XM_001004120.1

name	EG668526 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256704 GeneID:668526 MGI:3647697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 1 Protein product : predicted gene, EG668526, transcript variant 2 transcript_id : XM_001004121.2

name	LOC100043388 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256543 GeneID:100043388
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to lacrimal androgen-binding protein eta transcript_id : XM_001480080.1

name	EG668419 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380154 GeneID:668419 MGI:3643719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 1 Protein product : predicted gene, EG668419 transcript_id : XM_001001369.1

name	EG546954 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63556810 GeneID:546954 MGI:3647537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG546954 transcript_id : XM_621774.1

name	LOC100043856 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256706 GeneID:100043856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to lacrimal androgen-binding protein delta transcript_id : XM_001481134.1

name	LOC100043857 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256708 GeneID:100043857
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001481135.1

name	EG545947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380157 GeneID:545947 MGI:3648809
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : predicted gene, EG545947 transcript_id : XM_620464.3

name	EG434676 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380158 GeneID:434676 MGI:3646447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : predicted gene, EG434676 transcript_id : XM_486539.4

name	Abpd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57977314 GeneID:494519 MGI:3514009
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : androgen binding protein delta transcript_id : NM_001009952.1

name	EG545948 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380160 GeneID:545948 MGI:3648810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 2 Proteins product : predicted gene, EG545948 transcript_id : XM_620465.3

name	LOC435962 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256710 GeneID:435962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to hCG16001 transcript_id : XM_001481136.1

name	EG626970 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82905164 GeneID:626970 MGI:3648283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG626970 transcript_id : XM_891592.1

name	LOC100043859 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256712 GeneID:100043859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001481137.1

name	LOC627004 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256546 GeneID:627004
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : similar to Rpl23a protein transcript_id : XM_001480090.1

name	Scgb2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256714 GeneID:353109 MGI:2655747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : secretoglobin, family 2B, member 1 transcript_id : XM_001481338.1

name	Abpz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342756 GeneID:233090 MGI:2655741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : androgen binding protein zeta transcript_id : NM_177446.2

name	LOC100043860 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256716 GeneID:100043860
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to novel androgen binding protein (Abp) family member transcript_id : XM_001481139.1

name	LOC100043352 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256518 GeneID:100043352
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001480056.1

name	LOC100043353 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256520 GeneID:100043353
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001480061.1

name	EG384594 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086279 GeneID:384594 MGI:3647426
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_357734.1

name	EG624584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904930 GeneID:624584 MGI:3643785
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 1 protein_id : XP_897754.1

name	EG624584 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904932 GeneID:624584 MGI:3643785
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 2 protein_id : XP_905334.1

name	LOC100043355 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256523 GeneID:100043355
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein eta protein_id : XP_001480070.1

name	EG626740 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905136 GeneID:626740 MGI:3646832
definition	codon_start : 1 product : similar to allergen dI chain C2C protein_id : XP_896442.1

name	LOC100043842 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256699 GeneID:100043842
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta protein_id : XP_001481170.1

name	LOC634929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256525 GeneID:634929
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001480078.1

name	EG668379 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380144 GeneID:668379 MGI:3645177
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta protein_id : XP_001001176.1

name	EG668381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380146 GeneID:668381 MGI:3645736
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001001188.1

name	EG384589 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63556710 GeneID:384589 MGI:3644231
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_357730.3

name	EG330689 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51744733 GeneID:330689 MGI:3649164
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_286083.2

name	EG384591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256527 GeneID:384591 MGI:3647424
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase protein_id : XP_357732.6

name	EG384596 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086283 GeneID:384596 MGI:3644821
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_357735.1

name	LOC434161 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256533 GeneID:434161
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001480108.1

name	EG270499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25032837 GeneID:270499 MGI:3647682
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_195264.1

name	EG624439 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256703 GeneID:624439 MGI:3644904
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 3 protein_id : XP_001004117.2

name	EG624439 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904920 GeneID:624439 MGI:3644904
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 2 protein_id : XP_905326.1

name	LOC100043376 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256536 GeneID:100043376
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein eta protein_id : XP_001480117.1

name	LOC100043383 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256538 GeneID:100043383
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001480126.1

name	EG668411 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380152 GeneID:668411 MGI:3647266
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_001001333.1

name	EG668526 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256705 GeneID:668526 MGI:3647697
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 2 protein_id : XP_001004121.2

name	EG668526 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380188 GeneID:668526 MGI:3647697
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta isoform 1 protein_id : XP_001004120.1

name	LOC100043388 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256544 GeneID:100043388
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein eta protein_id : XP_001480130.1

name	EG668419 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380155 GeneID:668419 MGI:3643719
definition	codon_start : 1 product : similar to allergen dI chain C2C protein_id : XP_001001369.1

name	EG546954 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63556811 GeneID:546954 MGI:3647537
definition	codon_start : 1 product : similar to ribosomal protein L23a protein_id : XP_621774.1

name	LOC100043856 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256707 GeneID:100043856
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta protein_id : XP_001481184.1

name	LOC100043857 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256709 GeneID:100043857
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001481185.1

name	EG545947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63556725 GeneID:545947 MGI:3648809
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta protein_id : XP_620464.1

name	EG434676 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63556729 GeneID:434676 MGI:3646447
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_486539.2

name	Abpd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57977315 CCDS:CCDS21131.1 GeneID:494519 MGI:3514009
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : androgen-binding protein delta; secretoglobin, family 2B, member 2; allergen dI chain C2C product : androgen binding protein delta protein_id : NP_001009952.1

name	EG545948 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63556732 GeneID:545948 MGI:3648810
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_620465.1

name	LOC435962 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256711 GeneID:435962
definition	codon_start : 1 product : similar to hCG16001 protein_id : XP_001481186.1

name	EG626970 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905165 GeneID:626970 MGI:3648283
definition	codon_start : 1 product : similar to lacrimal androgen-binding protein delta protein_id : XP_896685.1

name	LOC100043859 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256713 GeneID:100043859
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001481187.1

name	LOC627004 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256547 GeneID:627004
definition	codon_start : 1 product : similar to Rpl23a protein protein_id : XP_001480140.1

name	Scgb2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256715 GeneID:353109 MGI:2655747
definition	codon_start : 1 note : overriding stop codons product : similar to lacrimal androgen-binding protein delta protein_id : XP_001481388.1 transl_except : (pos:complement(34411468..34411470),aa:OTHER)

name	Abpz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30315676 CCDS:CCDS21132.1 GeneID:233090 MGI:2655741
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lacrimal androgen-binding protein zeta; allergen dI chain C2B; secretoglobin, family 2B, member 3 product : androgen binding protein zeta protein_id : NP_803229.1

name	LOC100043860 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256717 GeneID:100043860
definition	codon_start : 1 product : similar to novel androgen binding protein (Abp) family member protein_id : XP_001481189.1

name	LOC668351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668351
definition	number : 1 pseudo : _no_value

name	LOC668351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668351
definition	number : 2 pseudo : _no_value

name	EG384593 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384593
definition	number : 1 pseudo : _no_value

name	LOC100043351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043351
definition	number : 3 pseudo : _no_value

name	LOC100043351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043351
definition	number : 2 pseudo : _no_value

name	LOC100043351 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043351
definition	number : 1 pseudo : _no_value

name	LOC100043838 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043838
definition	number : 3 pseudo : _no_value

name	LOC100043838 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043838
definition	number : 2 pseudo : _no_value

name	LOC100043838 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043838
definition	number : 1 pseudo : _no_value

name	LOC668362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668362
definition	number : 1 pseudo : _no_value

name	LOC546951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:546951
definition	number : 1 pseudo : _no_value

name	EG668371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668371
definition	number : 1 pseudo : _no_value

name	EG668371 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668371
definition	number : 2 pseudo : _no_value

name	EG668377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668377
definition	number : 1 pseudo : _no_value

name	LOC668386 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668386
definition	number : 1 pseudo : _no_value

name	LOC626373 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626373
definition	number : 1 pseudo : _no_value

name	EG668393 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668393
definition	number : 1 pseudo : _no_value

name	LOC100043362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043362
definition	number : 3 pseudo : _no_value

name	LOC100043362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043362
definition	number : 2 pseudo : _no_value

name	LOC100043362 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043362
definition	number : 1 pseudo : _no_value

name	LOC100043365 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043365
definition	number : 1 pseudo : _no_value

name	LOC100043365 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043365
definition	number : 2 pseudo : _no_value

name	LOC100043365 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043365
definition	number : 3 pseudo : _no_value

name	LOC668398 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668398
definition	number : 1 pseudo : _no_value

name	LOC100043370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043370
definition	number : 3 pseudo : _no_value

name	LOC100043370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043370
definition	number : 2 pseudo : _no_value

name	LOC100043370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043370
definition	number : 1 pseudo : _no_value

name	LOC100043845 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043845
definition	number : 3 pseudo : _no_value

name	LOC100043845 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043845
definition	number : 2 pseudo : _no_value

name	LOC100043845 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043845
definition	number : 1 pseudo : _no_value

name	LOC668410 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668410
definition	number : 1 pseudo : _no_value

name	LOC100043379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043379
definition	number : 3 pseudo : _no_value

name	LOC100043379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043379
definition	number : 2 pseudo : _no_value

name	LOC100043379 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043379
definition	number : 1 pseudo : _no_value

name	LOC100043850 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043850
definition	number : 3 pseudo : _no_value

name	LOC100043850 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043850
definition	number : 2 pseudo : _no_value

name	LOC100043850 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043850
definition	number : 1 pseudo : _no_value

name	LOC668416 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668416
definition	number : 1 pseudo : _no_value

name	LOC270234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:270234
definition	number : 1 pseudo : _no_value

name	EG668422 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668422
definition	number : 1 pseudo : _no_value

name	EG668422 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668422
definition	number : 2 pseudo : _no_value

name	EG668431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668431
definition	number : 1 pseudo : _no_value

name	LOC100043398 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043398
definition	number : 3 pseudo : _no_value

name	LOC100043398 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043398
definition	number : 2 pseudo : _no_value

name	LOC100043398 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043398
definition	number : 1 pseudo : _no_value

name	LOC100043401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043401
definition	number : 1 pseudo : _no_value

name	LOC100043401 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043401
definition	number : 2 pseudo : _no_value

name	LOC668440 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668440
definition	number : 1 pseudo : _no_value

name	EG668361 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256521 GeneID:668361 MGI:3648386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 20 Proteins product : predicted gene, EG668361 pseudo : _no_value transcript_id : XR_002168.2

name	LOC100043373 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256534 GeneID:100043373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034518.1

name	LOC100043386 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256540 GeneID:100043386
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 25 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034523.1

name	LOC435963 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256545 GeneID:435963
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034528.1

clone name	MSMg01-294P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-381B22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-383D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410K24
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-207A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159G23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-257C22.b	B6Ng01-257C22.g
ACC	GA062946	GA062947
length	1,215	1,146
definition	B6Ng01-257C22.b	B6Ng01-257C22.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattccatgtcctgtttgattgtgttttcctgtaattctttaaggactt ctaactctttagcagtgttctcctgtatttctttaagtgagttattaatg cccttcttaaagtcttctatcaggatcagaagatatgattttgattcgag ttttgcttttcaggtgtgttggggtatccaggactgcccgagattggggt tctgggttctgatgatggtgagtggtcttggtttccgttagtaagatgct tacatttgcctttcatcatctagtaatctctggcattattggttacagtt gtctctggttggagcttgttccaactgtgattctgttagcctctgtcagc agtcctgggagcccatttctctcctgagtctcaggggtcagagtactctc tgctggcaaactctatttttgcagggaaggtgcacagaggtctggcgttc agacctgccttcaggctgaaggtgaatgcctgaaacagggactttttcag aagatgtgttgccaaagctgtctgccagctgacttgcccagactgttctc caagggaccgggaacacaagatggctccctcacctgttccagcagtcaga gacctaccaagaggatacctctcctctcgctaagaaggtgccaggatatc tggagcccgaaattgtggtctgtaccagaaactgtgtctcttgggcctgt ccaaaagttgtttcactctgcagtctgcactctcacctgtgcagactagt ctctgagggagcccgggcaaaagatggctccctcacctattcaggcagtc agtgccctccttgtcagacaattctcctctggctgagaaggttactggat gtcttgagcctgaaacgggatctgtcccagaagctgtgtcacttctgcag actgctcactcaccctccacattctgtgaggtgacctgggcagactggtc tccaagggacccaggatccagatggctccctcctttgttcagcagtcaga gacctccttggcagacagctctctctgacaggcagtgcccagatatctgg agcccagatgggtctttcccagaagctgtgtgccttctgctgtcccagaa gctgtgttgcatctgcagtcatacctctctcccctgagcagaagtggatc tcgaggaacctaacacaagattgggacttggaagtctcatgccaatagag aattctttctacatc	gaattccaactcctggggtccagtacttagcatttgaatacacaacagca agagactaactccaactggtagcaggtggtagaggcagcagtggtatgct ctcttgagcagtcctcttactagcatggcaccctgaggcctacctgtgct gcagttcctccacagcatggacaggaagctgagcctttttggcaatctgc catgacgagtctccaggccctagtgtagtctccaaagactgtacaaattc ctagaccacttctggcaatttggttctaattatcctgtcctctggatcca ttgtattcttcttcagagtcttcctctttctctcttcattccatgaccct acctactctttcctgcatttcccccgtcaaatacttcaactataatagag cagtaagactcttggcagatttcatagctcatcctgctgacccttcagcc ttcacatgtctgcctcaggcttttctctgctgtcttcaggctcctccatt ggtgtttgttcagcccacacttcttaaagaaggacaaaagactgtcaaaa gaaccctttaatgaagcctaaaatggcaatgccaggggtgacaatttctc tctatctgagtgaatgggcttaagcagtccacttccaaggtgggtggagc agggggcctactacagtcttgcctcttagcacccttccaacagtcccctg atgtccctgtgcagtgggagatgctctaatacaggcccaggtagaggggg ttgaagggtcatctggaattctgtggtagcaaagatcagcggaacacact ggcacagatggtctgatgctgagccttctggagctttgggattccaactt tgattggactctaatttttacaggatagctgtggaatattgaaaatgacc ataaagcaggcttttttgatcagtagtcagaaatagctagagcagcaatg caatagtctggccagtgaccaattagaagccagatagctcagaactgaaa tatccctgcttagctatgagataatgagcacagccacttgaagtgagaac ataatgagccacactaatgatgttattaacaggtcttcctggtgtaaatt tggttagcccataaaactccttgtgtagaccaacctggactctagc
quality values	Open. Hide. 58 41 34 39 62 62 41 21 62 62 62 62 62 62 62 62 62 62 62 54 44 62 47 59 59 62 62 62 62 62 59 62 62 43 46 56 62 62 62 62 62 59 62 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 54 49 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 54 52 58 58 58 42 54 58 58 58 58 58 45 47 49 49 54 58 58 58 58 54 58 58 54 39 54 54 58 58 54 38 58 58 58 58 58 42 52 54 58 54 58 54 54 54 58 58 54 58 54 54 54 54 54 52 45 52 54 58 58 45 54 52 52 51 58 51 48 58 51 50 51 58 41 45 38 48 54 50 58 51 51 51 46 51 35 58 42 36 51 49 50 51 53 51 50 49 51 50 58 53 53 58 51 46 53 42 58 38 17 41 42 46 40 49 46 51 58 25 28 40 47 50 58 58 58 58 50 44 43 44 49 58 49 42 49 51 58 52 58 48 50 51 51 51 50 37 33 35 31 42 58 53 50 44 58 58 51 58 51 50 54 39 58 49 43 22 39 42 43 44 54 44 33 41 22 51 49 51 42 58 49 51 53 54 54 41 39 37 54 52 49 50 50 53 35 34 49 51 54 53 39 38 54 42 53 45 53 37 46 41 41 35 40 46 49 35 38 29 42 37 23 37 37 47 40 45 43 34 11 36 33 30 23 52 42 35 38 51 44 35 37 54 54 47 32 41 26 54 54 32 35 25 44 33 44 28 32 32 32 30 31 40 52 29 31 28 51 31 40 39 28 37 34 37 34 40 36 27 25 27 25 36 33 31 31 26 29 34 23 42 19 31 27 26 51 39 37 26 45 33 29 31 31 38 31 39 29 41 9 33 31 13 41 14 33 23 27 31 35 22 30 28 31 31 32 31 30 36 31 19 40 32 32 29 41 46 28 31 31 46 31 30 31 24 27 31 31 21 40 38 24 32 36 27 21 31 31 31 31 35 31 31 31 31 41 36 31 32 31 30 25 33 43 28 32 32 31 36 29 31 31 32 35 31 34 29 25 31 18 22 19 27 25 30 31 31 29 36 26 32 38 36 33 17 25 34 19 22 31 29 41 22 16 31 32 38 21 25 21 25 7 22 37 15 25 17 18 19 48 18 6 11 29 31 22 9 17 19 25 14 15 11 14 32 22 33 32 23 32 16 36 19 15 12 19 33 43 12 14 9 32 24 7 5 6 23 13 15 32 22 19 33 10 22 19 14 26 11 17 19 13 15 25 8 17 22 26 8 18 21 24 28 16 20 20 8 15 19 16 11 8 14 21 5 3 4 3 3 9 14 21 12 13 14 16 15 10 14 16 21 23 19 13 6 15 12 9 11 6 14 13 27 47 23 7 10 18 22 7 14 33 6 6 7 28 29 20 23 12 12 7 8 4 11 6 6 25 20 7 9 8 20 4 7 7 14 19 16 10 9 16 20 7 12 4 2 2 4 4 5 8 5 1 4 4 4 5 5 13 12 11 23 5 6 6 7 4 10 5 3 4 4 5 18 9 16 10 7 11 5 10 8 5 6 23 9 5 4 3 1 3 8 7 11 4 3 2 7 2 3 7 3 1 3 2 2 3 5 10 9 5 23 4 10 10 4 4 5 6 7 6 8 4 16 9 1 3 1 3 5 5 3 2 8 6 3 3 4 10 5 7 6 8 9 6 7 3 9 25 16 8 7 15 8 4 3 3	Open. Hide. 62 47 42 47 62 62 59 24 62 62 62 59 56 38 38 33 49 43 59 59 59 49 62 59 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 54 54 46 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 54 62 62 62 62 62 62 62 58 58 58 58 54 42 58 58 52 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 52 58 54 54 52 52 54 54 54 58 58 58 58 58 58 52 54 58 54 58 58 58 58 58 58 58 54 58 54 58 58 58 54 54 58 58 58 58 54 58 54 54 58 58 58 58 58 53 58 51 58 53 54 49 58 51 58 58 58 41 51 58 58 51 40 58 58 58 54 58 51 51 48 47 58 46 53 53 49 53 52 47 58 54 52 41 50 50 52 58 29 58 58 54 50 58 58 51 39 51 47 29 49 58 58 51 40 58 51 52 51 41 46 49 50 41 39 53 52 50 54 50 49 49 52 51 39 40 33 41 35 40 43 50 51 51 42 40 40 49 51 50 39 39 40 43 41 32 43 43 41 40 50 49 37 42 44 41 38 32 41 49 53 42 24 51 54 54 39 22 33 29 50 41 39 41 41 42 41 50 31 49 32 21 35 30 54 32 26 53 53 53 42 39 41 40 54 54 54 51 24 27 31 33 37 24 36 46 32 39 33 37 52 38 38 33 24 33 25 33 28 40 44 21 39 53 31 34 23 42 31 52 45 28 33 42 39 35 29 52 23 38 53 39 40 31 20 9 25 32 53 32 36 32 36 45 32 52 32 40 53 31 39 45 42 35 35 31 31 31 32 51 26 31 41 41 21 28 26 25 36 31 23 26 12 46 11 42 45 20 8 12 33 25 37 33 31 31 29 46 15 20 26 20 43 22 24 9 21 31 38 19 6 46 26 48 46 46 24 24 20 22 31 26 30 17 32 33 38 38 43 34 27 23 30 38 35 36 21 39 31 31 46 46 11 14 32 26 18 10 21 18 32 46 33 31 14 10 24 11 20 15 47 46 48 48 30 18 31 42 21 14 18 16 33 28 31 34 28 24 22 48 11 18 31 14 28 32 14 18 32 16 18 32 27 37 20 17 11 21 9 6 9 38 24 22 23 29 31 21 38 9 7 14 15 9 7 9 20 23 12 14 25 33 34 25 19 14 6 4 10 21 8 21 15 18 24 31 32 21 19 5 14 28 15 25 31 33 39 19 27 27 32 14 34 9 21 8 13 9 21 27 17 27 28 21 27 17 32 12 27 6 15 6 16 14 23 11 16 15 6 4 3 5 10 24 28 12 29 10 19 8 6 6 5 14 6 11 12 18 7 11 4 15 7 16 12 7 21 14 6 7 7 13 14 13 15 14 27 21 12 7 13 17 6 7 16 6 11 17 4 11 5 2 3 5 15 6 13 12 19 6 4 13 18 14 23 6 23 30 12 3 9 6 9 15 15 6 23 13 5 11 6 11 17 20 5 6 4 8 14 11 9 8 10 14 8 5 12 10 23 4 4 2 4 6 5 4 7 3 2 2 3 4 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_33619248_33620388
seq2: B6Ng01-257C22.g_67_1212

seq1  GAATTCCAACTCCTGGGGTCCAGTACTTAGCATTTGAATACACAACAGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAACTCCTGGGGTCCAGTACTTAGCATTTGAATACACAACAGCA  50

seq1  AGAGACTAACTCCAACTGGTAGCAGGTGGTAGAGGCAGCAGTGGTATGCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGACTAACTCCAACTGGTAGCAGGTGGTAGAGGCAGCAGTGGTATGCT  100

seq1  CTCTTGAGCAGTCCTCTTACTAGCATGGCACCCTGAGGCCTACCTGTGCT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGAGCAGTCCTCTTACTAGCATGGCACCCTGAGGCCTACCTGTGCT  150

seq1  GCAGTTCCTCCACAGCATGGACAGGAAGCTGAGCCTTTTTGGCAATCTGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGTTCCTCCACAGCATGGACAGGAAGCTGAGCCTTTTTGGCAATCTGC  200

seq1  CATGACGAGTCTCCAGGCCCTAGTGTAGTCTCCAAAGACTGTACAAATTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGACGAGTCTCCAGGCCCTAGTGTAGTCTCCAAAGACTGTACAAATTC  250

seq1  CTAGACCACTTCTGGCAATTTGGTTCTAATTATCCTGTCCTCTGGATCCA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGACCACTTCTGGCAATTTGGTTCTAATTATCCTGTCCTCTGGATCCA  300

seq1  TTGTATTCTTCTTCAGAGTCTTCCTCTTTCTCTCTTCATTCCATGACCCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTATTCTTCTTCAGAGTCTTCCTCTTTCTCTCTTCATTCCATGACCCT  350

seq1  ACCTACTCTTTCCTGCATTTCCCCCGTCAAATACTTCAACTATAATAGAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTACTCTTTCCTGCATTTCCCCCGTCAAATACTTCAACTATAATAGAG  400

seq1  CAGTAAGACTCTTGGCAGATTTCATAGCTCATCCTGCTGACCCTTCAGCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAAGACTCTTGGCAGATTTCATAGCTCATCCTGCTGACCCTTCAGCC  450

seq1  TTCACATGTCTGCCTCAGGCTTTTCTCTGCTGTCTTCAGGCTCCTCCATT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCACATGTCTGCCTCAGGCTTTTCTCTGCTGTCTTCAGGCTCCTCCATT  500

seq1  GGTGTTTGTTCAGCCCACACTTCTTAAAGAAGGACAAAAGACTGTCAAAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTTTGTTCAGCCCACACTTCTTAAAGAAGGACAAAAGACTGTCAAAA  550

seq1  GAACCCTTTAATGAAGCCTAAAATGGCAATGCCAGGGGTGACAATTTCTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCCTTTAATGAAGCCTAAAATGGCAATGCCAGGGGTGACAATTTCTC  600

seq1  TCTATCTGAGTGAATGGGCTTAAGCAGTCCACTTCCAAGGTGGGTGGAGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTATCTGAGTGAATGGGCTTAAGCAGTCCACTTCCAAGGTGGGTGGAGC  650

seq1  AGGGGGCCTACTACAGTCTTGCCTCTTAGCACCCTTCCAACAGTCCCCTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGGCCTACTACAGTCTTGCCTCTTAGCACCCTTCCAACAGTCCCCTG  700

seq1  ATGTCCCTGTGCAGTGGGAGATGCTCTAATACAGGCCCAGGTAGAGGGGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCCCTGTGCAGTGGGAGATGCTCTAATACAGGCCCAGGTAGAGGGGG  750

seq1  TTGAAGGGTCATCTGGAATTCTGTGGTAGCAAAGATCAGCGGAACACACT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAGGGTCATCTGGAATTCTGTGGTAGCAAAGATCAGCGGAACACACT  800

seq1  GGCACAGATGGTCTGATGCTGAGCCTTCTGGAGC-TTGGGATTCCAACTT  849
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  GGCACAGATGGTCTGATGCTGAGCCTTCTGGAGCTTTGGGATTCCAACTT  850

seq1  TGATTGGACTCTAATTTTTACAGGATAGCTGTGGAATATTGAAAATGACC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGGACTCTAATTTTTACAGGATAGCTGTGGAATATTGAAAATGACC  900

seq1  ATAAAGCAGGC-TTTTTGATCAGTAGTCAG-AATAGCTAGAGCAGCAATG  947
      ||||||||||| |||||||||||||||||| |||||||||||||||||||
seq2  ATAAAGCAGGCTTTTTTGATCAGTAGTCAGAAATAGCTAGAGCAGCAATG  950

seq1  C-ATAGTCTGG-CAGTGACCAATTAGAAGGCCAGATAGCTCAGAACTGAA  995
      | ||||||||| |||||||||||||||| |||||||||||||||||||||
seq2  CAATAGTCTGGCCAGTGACCAATTAGAA-GCCAGATAGCTCAGAACTGAA  999

seq1  ATATCCTTGCTTAGCTATGAGATAATGAGCACAAGGCACTTGAAGTGAGA  1045
      |||||| ||||||||||||||||||||||||| || ||||||||||||||
seq2  ATATCCCTGCTTAGCTATGAGATAATGAGCAC-AGCCACTTGAAGTGAGA  1048

seq1  ACATAATGAG-CACACTAATGATGTTTATTAACAGGGTCTTCCT-GTGTA  1093
      |||||||||| ||||||||||||| ||||||||| ||||||||| |||||
seq2  ACATAATGAGCCACACTAATGATG-TTATTAACA-GGTCTTCCTGGTGTA  1096

seq1  ATTTTGGGTAGCC--TAGAACTCTTTGTGTAGACCAGCCTGACCTCTAGC  1141
      | ||||| |||||  || ||||| |||||||||||| ||||  |||||||
seq2  AATTTGGTTAGCCCATAAAACTCCTTGTGTAGACCAACCTGGACTCTAGC  1146

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information