MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-257I08
Chromosome	7 (Build37)
Map Location	134,418,291 - 134,518,092
singlet/doublet	doublet
Overlap gene	Itgal, Zfp768, LOC100043097, LOC100043589, 6430604K15Rik
Upstream gene	Sbk1, LOC100043495, Lat, 2210013K02Rik, Nfatc2ip, Cd19, Rabep2, Atp2a1, Sh2b1, Tufm, Atxn2l, Eif3s8, Cln3, Apob48r, Il27, Nupr1, Ccdc101, Sult1a1, LOC629029, Giyd2, Bola2, Coro1a, Snrp1c-ps1, LOC100043044, Mapk3, Gdpd3, Ypel3, Tbx6, Ppp4c, Aldoa, 1500016O10Rik, 4930451I11Rik, Doc2a, Ccdc95, Hirip3, 1110032O16Rik, Kctd13, A830007L07Rik, Sez6l2, D830044I16Rik, Cdipt, Mvp, 2900092E17Rik, Maz, Kif22, 1810010M01Rik, AI467606, Qprt, Spn, Cd2bp2, Tbc1d10b, Mylpf, Sept1, LOC100043580, Zfp553, Zfp771, 2410015N17Rik, Sephs2
Downstream gene	9130019O22Rik, E430018J23Rik, LOC100043590, Zfp764, Zfp688, Zfp689, Prr14, Fbs1, 1700008J07Rik, LOC100043597, D030022P06Rik, Phkg2, Gm166, Rnf40, 1700120K04Rik, Zfp629, Bcl7c, Ctf1, Ctf2, Fbxl19, Tmem142c, Setd1a, Hsd3b7, Stx1b2, Stx4a, Zfp668, Zfp646, BC039632, Vkorc1, Bckdk, Myst1, Prss8, Prss36, Fus, Pycard, Trim72, LOC436010, EG668675, Itgam, Itgax, Itgad, Cox6a2, LOC100043133, Armc5, Tgfb1i1, Slc5a2, BC017158, EG628781, Rgs10
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sbk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104175 MGI:2135937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1098 ESTs, 10 Proteins

name	Lat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16797 MGI:1342293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210013K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73658 MGI:1920908
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfatc2ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18020 MGI:1329015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12478 MGI:88319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rabep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70314 MGI:1917564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11937 MGI:105058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sh2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20399 MGI:1201407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tufm (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233870 MGI:1923686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atxn2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233871 MGI:2446242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56347 MGI:1926966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cln3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12752 MGI:107537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apob48r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171504 MGI:2176230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246779 MGI:2384409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nupr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56312 MGI:1891834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75565 MGI:1922815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sult1a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20887 MGI:102896
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC629029 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629029
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Giyd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75764 MGI:1915220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bola2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66162 MGI:1913412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Coro1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12721 MGI:1345961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrp1c-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20631 MGI:109488
definition	gene_synonym : mC-[y]15 note : U1 small nuclear ribonucleoprotein 1C, pseudogene 1 pseudo : _no_value

name	LOC100043044 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mapk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26417 MGI:1346859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68616 MGI:1915866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ypel3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66090 MGI:1913340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tbx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21389 MGI:102539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56420 MGI:1891763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldoa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11674 MGI:87994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500016O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68952 MGI:1916202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 87 ESTs, 7 Proteins

name	4930451I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78118 MGI:1925368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Doc2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13446 MGI:109446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc95 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233875 MGI:2141881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hirip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233876 MGI:2142364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110032O16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68742 MGI:1915992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kctd13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233877 MGI:1923739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830007L07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233879 MGI:2685014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sez6l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233878 MGI:2385295
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830044I16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381922 MGI:2443610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Cdipt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52858 MGI:105491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mvp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78388 MGI:1925638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900092E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67278 MGI:1914528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17188 MGI:1338823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110033 MGI:109233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810010M01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69036 MGI:1916286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI467606 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101602 MGI:2141979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qprt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67375 MGI:1914625
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20737 MGI:98384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cd2bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70233 MGI:1917483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d10b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68449 MGI:1915699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mylpf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17907 MGI:97273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sept1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54204 MGI:1858916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs

name	Zfp553 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233887 MGI:2384725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp771 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244216 MGI:2442050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410015N17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66422 MGI:1913672
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sephs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20768 MGI:108388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgal (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16408 MGI:96606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp768 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233890 MGI:2384582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043097 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100043589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	6430604K15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269997 MGI:2443581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9130019O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78921 MGI:1926171
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E430018J23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101604 MGI:2141981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043590 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 145 ESTs, 9 Proteins

name	Zfp764 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233893 MGI:2443580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp688 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69234 MGI:1916484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp689 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71131 MGI:1918381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prr14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233895 MGI:2384565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14123 MGI:104648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins

name	1700008J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629159 MGI:1916610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 42 ESTs

name	LOC100043597 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 4 Proteins

name	D030022P06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546001 MGI:2444036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs

name	Phkg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68961 MGI:1916211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233899 MGI:2685012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233900 MGI:2142048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700120K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68232 MGI:1915482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs

name	Zfp629 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320683 MGI:2444524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl7c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12055 MGI:1332237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13019 MGI:105115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244218 MGI:2684607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233902 MGI:3039600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem142c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269999 MGI:3039586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233904 MGI:2446244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd3b7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101502 MGI:2141879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stx1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56216 MGI:1930705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stx4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20909 MGI:893577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244219 MGI:2442943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp646 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233905 MGI:3665412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC039632 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330657 MGI:2652890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vkorc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27973 MGI:106442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bckdk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12041 MGI:1276121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67773 MGI:1915023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76560 MGI:1923810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77613 MGI:1924863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fus (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233908 MGI:1353633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pycard (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66824 MGI:1931465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434246 MGI:3612190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins pseudo : _no_value

name	EG668675 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668675 MGI:3648098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 ESTs, 4 Proteins

name	Itgam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16409 MGI:96607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Itgax (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16411 MGI:96609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381924 MGI:3578624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox6a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12862 MGI:104649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	Armc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233912 MGI:2384586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfb1i1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21804 MGI:102784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246787 MGI:2181411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC017158 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233913 MGI:2384572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628781 MGI:3644024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 347 ESTs, 4 Proteins

name	Rgs10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67865 MGI:1915115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sbk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130171 GeneID:104175 MGI:2135937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH3-binding kinase 1 transcript_id : NM_145587.2

name	LOC100043495 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257781 GeneID:100043495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 1098 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001480108.1

name	Lat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475924 GeneID:16797 MGI:1342293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : linker for activation of T cells transcript_id : NM_010689.2

name	2210013K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963794 GeneID:73658 MGI:1920908
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210013K02 gene transcript_id : NM_023712.1

name	Nfatc2ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802978 GeneID:18020 MGI:1329015
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein transcript_id : NM_010900.2

name	Cd19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753337 GeneID:12478 MGI:88319
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD19 antigen transcript_id : NM_009844.1

name	Rabep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:140970572 GeneID:70314 MGI:1917564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rabaptin, RAB GTPase binding effector protein 2 transcript_id : NM_030566.2

name	Atp2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:36031131 GeneID:11937 MGI:105058
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 transcript_id : NM_007504.2

name	Sh2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347323 GeneID:20399 MGI:1201407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2B adaptor protein 1 transcript_id : NM_011363.2

name	Sh2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347241 GeneID:20399 MGI:1201407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SH2B adaptor protein 1 transcript_id : NM_001081459.1

name	Tufm (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350937 GeneID:233870 MGI:1923686
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tu translation elongation factor, mitochondrial transcript_id : NM_172745.2

name	Atxn2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942088 GeneID:233871 MGI:2446242
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ataxin 2-like transcript_id : NM_183020.1

name	Eif3s8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203754 GeneID:56347 MGI:1926966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 8 transcript_id : NM_146200.1

name	Cln3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560608 GeneID:12752 MGI:107537
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) transcript_id : NM_009907.2

name	Apob48r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19923862 GeneID:171504 MGI:2176230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein B48 receptor transcript_id : NM_138310.1

name	Il27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704109 GeneID:246779 MGI:2384409
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 27 transcript_id : NM_145636.1

name	Nupr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790144 GeneID:56312 MGI:1891834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear protein 1 transcript_id : NM_019738.1

name	Ccdc101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981319 GeneID:75565 MGI:1922815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 101 transcript_id : NM_029339.2

name	Sult1a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526821 GeneID:20887 MGI:102896
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 1A, phenol-preferring, member 1 transcript_id : NM_133670.1

name	Giyd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386645 GeneID:75764 MGI:1915220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GIY-YIG domain containing 2 transcript_id : NM_029420.3

name	Bola2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802303 GeneID:66162 MGI:1913412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bolA-like 2 (E. coli) transcript_id : NM_175103.3

name	Coro1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982807 GeneID:12721 MGI:1345961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coronin, actin binding protein 1A transcript_id : NM_009898.2

name	Mapk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:93102422 GeneID:26417 MGI:1346859
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase 3 transcript_id : NM_011952.2

name	Gdpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431345 GeneID:68616 MGI:1915866
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerophosphodiester phosphodiesterase domain containing 3 transcript_id : NM_024228.2

name	Ypel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053874 GeneID:66090 MGI:1913340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 3 (Drosophila) transcript_id : NM_026875.2

name	Ypel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053931 GeneID:66090 MGI:1913340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : yippee-like 3 (Drosophila) transcript_id : NM_025347.2

name	Tbx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48928034 GeneID:21389 MGI:102539
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 6 transcript_id : NM_011538.2

name	Ppp4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130591 GeneID:56420 MGI:1891763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 4, catalytic subunit transcript_id : NM_019674.3

name	Aldoa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709447 GeneID:11674 MGI:87994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldolase 1, A isoform transcript_id : NM_007438.3

name	1500016O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257783 GeneID:68952 MGI:1916202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 4 Proteins product : RIKEN cDNA 1500016O10 gene transcript_id : XM_001480258.1

name	4930451I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158653 GeneID:78118 MGI:1925368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930451I11 gene transcript_id : NM_183131.2

name	Doc2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859539 GeneID:13446 MGI:109446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : double C2, alpha transcript_id : NM_010069.1

name	Ccdc95 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956375 GeneID:233875 MGI:2141881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 95 transcript_id : NM_153580.1

name	Hirip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328383 GeneID:233876 MGI:2142364
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIRA interacting protein 3 transcript_id : NM_172746.2

name	1110032O16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288856 GeneID:68742 MGI:1915992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110032O16 gene transcript_id : NM_028389.1

name	1110032O16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134288879 GeneID:68742 MGI:1915992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110032O16 gene transcript_id : NM_026827.1

name	Kctd13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802609 GeneID:233877 MGI:1923739
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 13 transcript_id : NM_172747.2

name	A830007L07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900478 GeneID:233879 MGI:2685014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830007L07 gene transcript_id : NM_001039645.1

name	Sez6l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801977 GeneID:233878 MGI:2385295
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seizure related 6 homolog like 2 transcript_id : NM_144926.3

name	Cdipt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372136 GeneID:52858 MGI:105491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) transcript_id : NM_026638.2

name	Cdipt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357251 GeneID:52858 MGI:105491
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) transcript_id : NM_138754.2

name	Mvp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384051 GeneID:78388 MGI:1925638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : major vault protein transcript_id : NM_080638.2

name	2900092E17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313593 GeneID:67278 MGI:1914528
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900092E17 gene transcript_id : NM_030240.1

name	Maz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114155152 GeneID:17188 MGI:1338823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYC-associated zinc finger protein (purine-binding transcription factor) transcript_id : NM_010772.1

name	Kif22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704181 GeneID:110033 MGI:109233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 22 transcript_id : NM_145588.1

name	1810010M01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130286 GeneID:69036 MGI:1916286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810010M01 gene transcript_id : NM_026918.2

name	AI467606 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362663 GeneID:101602 MGI:2141979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI467606 transcript_id : NM_178901.3

name	Qprt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526851 GeneID:67375 MGI:1914625
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : quinolinate phosphoribosyltransferase transcript_id : NM_133686.1

name	Spn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83716012 GeneID:20737 MGI:98384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialophorin transcript_id : NM_001037810.1

name	Spn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83716007 GeneID:20737 MGI:98384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialophorin transcript_id : NM_009259.4

name	Cd2bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368066 GeneID:70233 MGI:1917483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD2 antigen (cytoplasmic tail) binding protein 2 transcript_id : NM_027353.3

name	Tbc1d10b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803098 GeneID:68449 MGI:1915699
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 10b transcript_id : NM_144522.3

name	Mylpf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802062 GeneID:17907 MGI:97273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin light chain, phosphorylatable, fast skeletal muscle transcript_id : NM_016754.4

name	Sept1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8567343 GeneID:54204 MGI:1858916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : septin 1 transcript_id : NM_017461.1

name	LOC100043580 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257786 GeneID:100043580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs product : hypothetical protein LOC100043580 transcript_id : XM_001480358.1

name	Zfp553 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122756 GeneID:233887 MGI:2384725
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 553 transcript_id : NM_146201.1

name	Zfp771 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801945 GeneID:244216 MGI:2442050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 771 transcript_id : NM_177362.3

name	2410015N17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963572 GeneID:66422 MGI:1913672
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410015N17 gene transcript_id : NM_023203.1

name	Sephs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142976633 GeneID:20768 MGI:108388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : selenophosphate synthetase 2 transcript_id : NM_009266.3

name	Itgal (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486679 GeneID:16408 MGI:96606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha L transcript_id : NM_008400.2

name	Zfp768 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122750 GeneID:233890 MGI:2384582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 768 transcript_id : NM_146202.1

name	LOC100043589 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257788 GeneID:100043589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043589 transcript_id : XM_001480373.1

name	6430604K15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361941 GeneID:269997 MGI:2443581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430604K15 gene transcript_id : NM_175560.3

name	9130019O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801774 GeneID:78921 MGI:1926171
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130019O22 gene transcript_id : NM_030226.2

name	E430018J23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574105 GeneID:101604 MGI:2141981
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E430018J23 gene transcript_id : NM_198011.1

name	LOC100043590 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257790 GeneID:100043590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 145 ESTs, 8 Proteins product : similar to SMT3B protein, transcript variant 1 transcript_id : XM_001480376.1

name	LOC100043590 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257792 GeneID:100043590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to SMT3B protein, transcript variant 2 transcript_id : XM_001480378.1

name	Zfp764 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368979 GeneID:233893 MGI:2443580
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 764 transcript_id : NM_146203.3

name	Zfp688 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802604 GeneID:69234 MGI:1916484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 688 transcript_id : NM_026999.2

name	Zfp689 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340961 GeneID:71131 MGI:1918381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 689 transcript_id : NM_175163.2

name	Prr14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328356 GeneID:233895 MGI:2384565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich 14 transcript_id : NM_145589.2

name	Fbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257715 GeneID:14123 MGI:104648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : fibrosin 1, transcript variant 1 transcript_id : XM_284344.7

name	1700008J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257798 GeneID:629159 MGI:1916610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 42 ESTs product : RIKEN cDNA 1700008J07 gene transcript_id : XM_001002915.2

name	LOC100043597 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257794 GeneID:100043597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 4 Proteins product : similar to Snf2-related CBP activator protein transcript_id : XM_001480403.1

name	D030022P06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257796 GeneID:546001 MGI:2444036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs product : RIKEN cDNA D030022P06 gene transcript_id : XM_001480404.1

name	Phkg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356245 GeneID:68961 MGI:1916211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase, gamma 2 (testis) transcript_id : NM_026888.2

name	Gm166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377175 GeneID:233899 MGI:2685012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 166, (NCBI) transcript_id : NM_001033040.2

name	Rnf40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986594 GeneID:233900 MGI:2142048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 40 transcript_id : NM_172281.1

name	Zfp629 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130365 GeneID:320683 MGI:2444524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 629 transcript_id : NM_177226.5

name	Bcl7c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328165 GeneID:12055 MGI:1332237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 7C transcript_id : NM_009746.2

name	Ctf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681074 GeneID:13019 MGI:105115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiotrophin 1 transcript_id : NM_007795.1

name	Ctf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38524597 GeneID:244218 MGI:2684607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiotrophin 2 transcript_id : NM_198858.1

name	Fbxl19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254239 GeneID:233902 MGI:3039600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 19 transcript_id : NM_172748.2

name	Tmem142c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802906 GeneID:269999 MGI:3039586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 142C transcript_id : NM_198424.3

name	Setd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508421 GeneID:233904 MGI:2446244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain containing 1A transcript_id : NM_178029.3

name	Hsd3b7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817044 GeneID:101502 MGI:2141879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 transcript_id : NM_133943.2

name	Hsd3b7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817047 GeneID:101502 MGI:2141879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 transcript_id : NM_001040684.1

name	Stx1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032003 GeneID:56216 MGI:1930705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : syntaxin 1B2 transcript_id : NM_024414.2

name	Stx4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892174 GeneID:20909 MGI:893577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 4A (placental) transcript_id : NM_009294.3

name	Zfp668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802081 GeneID:244219 MGI:2442943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 668 transcript_id : NM_146259.3

name	Zfp646 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491886 GeneID:233905 MGI:3665412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 646 transcript_id : NM_172749.3

name	BC039632 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486910 GeneID:330657 MGI:2652890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC039632 transcript_id : NM_001081268.1

name	Vkorc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45827741 GeneID:27973 MGI:106442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin K epoxide reductase complex, subunit 1 transcript_id : NM_178600.2

name	Bckdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853585 GeneID:12041 MGI:1276121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : branched chain ketoacid dehydrogenase kinase transcript_id : NM_009739.3

name	Myst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312789 GeneID:67773 MGI:1915023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYST histone acetyltransferase 1 transcript_id : NM_026370.1

name	Prss8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19111159 GeneID:76560 MGI:1923810
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 8 (prostasin) transcript_id : NM_133351.1

name	Prss36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487022 GeneID:77613 MGI:1924863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 36 transcript_id : NM_001081374.1

name	Fus (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734868 GeneID:233908 MGI:1353633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fusion, derived from t(12;16) malignant liposarcoma (human) transcript_id : NM_139149.2

name	Pycard (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581581 GeneID:66824 MGI:1931465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PYD and CARD domain containing transcript_id : NM_023258.3

name	Trim72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370482 GeneID:434246 MGI:3612190
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 72 transcript_id : NM_001079932.2

name	EG668675 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257801 GeneID:668675 MGI:3648098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 ESTs, 4 Proteins product : predicted gene, EG668675 transcript_id : XM_001480559.1

name	Itgam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:132626288 GeneID:16409 MGI:96607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha M transcript_id : NM_001082960.1

name	Itgam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:132626294 GeneID:16409 MGI:96607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha M transcript_id : NM_008401.2

name	Itgax (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130485 GeneID:16411 MGI:96609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha X transcript_id : NM_021334.2

name	Itgad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274167 GeneID:381924 MGI:3578624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha D transcript_id : NM_001029872.1

name	Cox6a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816955 GeneID:12862 MGI:104649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VI a, polypeptide 2 transcript_id : NM_009943.2

name	LOC100043133 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257717 GeneID:100043133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001479568.1

name	Armc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48928021 GeneID:233912 MGI:2384586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 5 transcript_id : NM_146205.2

name	Tgfb1i1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254611 GeneID:21804 MGI:102784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor beta 1 induced transcript 1 transcript_id : NM_009365.2

name	Slc5a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892427 GeneID:246787 MGI:2181411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium/glucose cotransporter), member 2 transcript_id : NM_133254.3

name	BC017158 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704183 GeneID:233913 MGI:2384572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC017158 transcript_id : NM_145590.1

name	EG628781 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381054 GeneID:628781 MGI:3644024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 346 ESTs, 4 Proteins product : predicted gene, EG628781, transcript variant 1 transcript_id : XM_902363.2

name	Rgs10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388581 GeneID:67865 MGI:1915115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signalling 10 transcript_id : NM_026418.2

name	Sbk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704180 CCDS:CCDS21824.1 GeneID:104175 MGI:2135937
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : CG4945-like product : SH3-binding kinase 1 protein_id : NP_663562.1

name	LOC100043495 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257782 GeneID:100043495
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480158.1

name	Lat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754510 CCDS:CCDS21825.1 GeneID:16797 MGI:1342293
definition	GO_component : GO:0001772 - immunological synapse [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0005057 - receptor signaling protein activity [Evidence TAS]; GO:0005070 - SH3/SH2 adaptor activity [Evidence ISS] GO_process : GO:0019722 - calcium-mediated signaling [Evidence ISS]; GO:0006968 - cellular defense response [Evidence TAS]; GO:0006955 - immune response [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0043303 - mast cell degranulation [Evidence IEA]; GO:0007265 - Ras protein signal transduction [Evidence ISS]; GO:0050863 - regulation of T cell activation [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence TAS] codon_start : 1 note : linker protein product : linker for activation of T cells protein_id : NP_034819.1

name	2210013K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963795 CCDS:CCDS21826.1 GeneID:73658 MGI:1920908
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : spinster-like protein product : spinster protein_id : NP_076201.1

name	Nfatc2ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468909 CCDS:CCDS21827.1 GeneID:18020 MGI:1329015
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 exception : mismatches in translation note : nuclear factor of activated T-cells, cytoplasmic 2 interacting protein product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein protein_id : NP_035030.1

name	Cd19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753338 CCDS:CCDS21828.1 GeneID:12478 MGI:88319
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD19 antigen protein_id : NP_033974.1

name	Rabep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:140970573 CCDS:CCDS21829.1 GeneID:70314 MGI:1917564
definition	GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fos-related antigen product : rabaptin, RAB GTPase binding effector protein 2 protein_id : NP_085043.2

name	Atp2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:36031132 GeneID:11937 MGI:105058
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005793 - ER-Golgi intermediate compartment [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS]; GO:0016529 - sarcoplasmic reticulum [Evidence ISS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0005388 - calcium-transporting ATPase activity [Evidence ISS]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006200 - ATP catabolism [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence ISS]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0045988 - negative regulation of striated muscle contraction [Evidence ISS]; GO:0015992 - proton transport [Evidence IEA]; GO:0006937 - regulation of muscle contraction [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATPase, Ca++ transporting, fast twitch 1 protein_id : NP_031530.2

name	Sh2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347242 GeneID:20399 MGI:1201407
definition	GO_component : GO:0001726 - ruffle [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006928 - cell motility [Evidence IDA]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; SH2-B PH domain containing signaling mediator 1 product : SH2-B PH domain containing signaling mediator 1 isoform 1 protein_id : NP_001074928.1

name	Sh2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347324 GeneID:20399 MGI:1201407
definition	GO_component : GO:0001726 - ruffle [Evidence TAS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006928 - cell motility [Evidence IDA]; GO:0030032 - lamellipodium biogenesis [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; SH2-B PH domain containing signaling mediator 1 product : SH2-B PH domain containing signaling mediator 1 isoform 2 protein_id : NP_035493.2

name	Tufm (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370092 CCDS:CCDS21830.1 GeneID:233870 MGI:1923686
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : Tu translation elongation factor, mitochondrial protein_id : NP_766333.1

name	Atxn2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942089 CCDS:CCDS21831.1 GeneID:233871 MGI:2446242
definition	GO_component : GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ataxin 2 related protein product : ataxin 2-like protein_id : NP_898841.1

name	Eif3s8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203755 CCDS:CCDS21832.1 GeneID:56347 MGI:1926966
definition	GO_component : GO:0005852 - eukaryotic translation initiation factor 3 complex [Evidence ISS] [Evidence IEA] GO_function : GO:0043022 - ribosome binding [Evidence ISS]; GO:0003743 - translation initiation factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006413 - translational initiation [Evidence ISS] [Evidence IEA] codon_start : 1 note : NIPI-like protein; eukaryotic translation initiation factor 3, subunit 8 (110 kDa) product : eukaryotic translation initiation factor 3, subunit 8 protein_id : NP_666312.1

name	Cln3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560609 CCDS:CCDS21833.1 GeneID:12752 MGI:107537
definition	GO_component : GO:0005769 - early endosome [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA]; GO:0005764 - lysosome [Evidence IDA] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IMP]; GO:0006865 - amino acid transport [Evidence IMP]; GO:0008306 - associative learning [Evidence IMP]; GO:0035235 - ionotropic glutamate receptor signaling pathway [Evidence IMP]; GO:0007040 - lysosome organization and biogenesis [Evidence IMP]; GO:0016044 - membrane organization and biogenesis [Evidence IMP]; GO:0045861 - negative regulation of proteolysis [Evidence IMP]; GO:0042133 - neurotransmitter metabolism [Evidence IMP]; GO:0016485 - protein processing [Evidence IMP]; GO:0001508 - regulation of action potential [Evidence IMP]; GO:0050885 - regulation of balance [Evidence IMP] codon_start : 1 exception : mismatches in translation note : battenin product : ceroid-lipofuscinosis, neuronal 3 protein_id : NP_034037.2

name	Apob48r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923863 CCDS:CCDS21834.1 GeneID:171504 MGI:2176230
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0030226 - apolipoprotein receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : apolipoprotein B48 receptor protein_id : NP_612183.1

name	Il27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704110 CCDS:CCDS21835.1 GeneID:246779 MGI:2384409
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0045523 - interleukin-27 receptor binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005102 - receptor binding [Evidence IDA] GO_process : GO:0042129 - regulation of T cell proliferation [Evidence IDA] codon_start : 1 note : interleukin 30; IL-27 p28 subunit product : interleukin 27 protein_id : NP_663611.1

name	Nupr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790145 GeneID:56312 MGI:1891834
definition	codon_start : 1 product : p8 protein protein_id : NP_062712.1

name	Ccdc101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981320 CCDS:CCDS21837.1 GeneID:75565 MGI:1922815
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 101 protein_id : NP_083615.2

name	Sult1a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526822 GeneID:20887 MGI:102896
definition	GO_function : GO:0004062 - aryl sulfotransferase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IDA]; GO:0008146 - sulfotransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0017067 - tyrosine-ester sulfotransferase activity [Evidence IEA] GO_process : GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 note : sulfotransferase, phenol preferring 1; arylsulfotransferase ST1A4 product : sulfotransferase family 1A, phenol-preferring, member 1 protein_id : NP_598431.1

name	Giyd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62543493 CCDS:CCDS21838.1 GeneID:75764 MGI:1915220
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA] codon_start : 1 product : GIY-YIG domain containing 2 protein_id : NP_083696.2

name	Bola2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29171318 GeneID:66162 MGI:1913412
definition	GO_function : GO:0030528 - transcription regulator activity [Evidence IEA] codon_start : 1 product : BolA-2 protein protein_id : NP_780312.1

name	Coro1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753492 CCDS:CCDS21840.1 GeneID:12721 MGI:1345961
definition	GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 note : coronin-like actin binding protein; coronin 1a product : coronin, actin binding protein 1A protein_id : NP_034028.1

name	Mapk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21489933 CCDS:CCDS21841.1 GeneID:26417 MGI:1346859
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004707 - MAP kinase activity [Evidence IPI] [Evidence IMP] [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0001784 - phosphotyrosine binding [Evidence IMP]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IDA]; GO:0016310 - phosphorylation [Evidence TAS]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0006974 - response to DNA damage stimulus [Evidence IDA]; GO:0019233 - sensory perception of pain [Evidence IMP]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : protein kinase, mitogen activated kinase 3; p44 MAP kinase product : mitogen activated protein kinase 3 protein_id : NP_036082.1

name	Gdpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431346 GeneID:68616 MGI:1915866
definition	codon_start : 1 product : glycerophosphodiester phosphodiesterase domain containing 3 protein_id : NP_077190.2

name	Ypel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313616 CCDS:CCDS21842.1 GeneID:66090 MGI:1913340
definition	codon_start : 1 note : small ubiquitinated apoptotic protein product : yippee-like 3 protein_id : NP_079623.1

name	Ypel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053875 CCDS:CCDS21842.1 GeneID:66090 MGI:1913340
definition	codon_start : 1 note : small ubiquitinated apoptotic protein product : yippee-like 3 protein_id : NP_081151.2

name	Tbx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48928035 CCDS:CCDS21843.1 GeneID:21389 MGI:102539
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001708 - cell fate specification [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001707 - mesoderm formation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : rib-vertebrae product : T-box 6 protein_id : NP_035668.2

name	Ppp4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790175 CCDS:CCDS21844.1 GeneID:56420 MGI:1891763
definition	GO_component : GO:0005813 - centrosome [Evidence NAS]; GO:0005634 - nucleus [Evidence NAS] [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence NAS] [Evidence IEA]; GO:0004704 - NF-kappaB-inducing kinase activity [Evidence NAS]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence TAS] [Evidence NAS] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence NAS] codon_start : 1 note : protein phosphatase X product : protein phosphatase 4, catalytic subunit protein_id : NP_062648.1

name	Aldoa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671539 CCDS:CCDS21845.1 GeneID:11674 MGI:87994
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004332 - fructose-bisphosphate aldolase activity [Evidence IDA]; GO:0016829 - lyase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : aldolase 1, A isoform protein_id : NP_031464.1

name	1500016O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257784 GeneID:68952 MGI:1916202
definition	codon_start : 1 product : hypothetical protein LOC68952 protein_id : XP_001480308.1

name	4930451I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114158654 GeneID:78118 MGI:1925368
definition	codon_start : 1 product : hypothetical protein LOC78118 protein_id : NP_898954.2

name	Doc2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859540 CCDS:CCDS21847.1 GeneID:13446 MGI:109446
definition	GO_component : GO:0045202 - synapse [Evidence IEA]; GO:0019717 - synaptosome [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IEA] codon_start : 1 product : double C2, alpha protein_id : NP_034199.1

name	Ccdc95 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956376 CCDS:CCDS21848.1 GeneID:233875 MGI:2141881
definition	codon_start : 1 product : coiled-coil domain containing 95 protein_id : NP_705808.1

name	Hirip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370102 CCDS:CCDS21849.1 GeneID:233876 MGI:2142364
definition	codon_start : 1 product : HIRA interacting protein 3 protein_id : NP_766334.1

name	1110032O16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288880 GeneID:68742 MGI:1915992
definition	codon_start : 1 product : hypothetical protein LOC68742 protein_id : NP_081103.1

name	1110032O16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134288857 GeneID:68742 MGI:1915992
definition	codon_start : 1 product : hypothetical protein LOC68742 protein_id : NP_082665.1

name	Kctd13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370096 CCDS:CCDS21851.1 GeneID:233877 MGI:1923739
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence IPI] codon_start : 1 note : tumor necrosis factor alpha-inducible protein PDIP1; polymerase delta-interacting protein 1 product : potassium channel tetramerisation domain containing 13 protein_id : NP_766335.1

name	A830007L07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88900479 GeneID:233879 MGI:2685014
definition	GO_component : GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IEA] GO_function : GO:0004597 - peptide-aspartate beta-dioxygenase activity [Evidence IEA] GO_process : GO:0018193 - peptidyl-amino acid modification [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233879 protein_id : NP_001034734.1

name	Sez6l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450331 GeneID:233878 MGI:2385295
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : type I transmembrane receptor (seizure-related protein) product : seizure related 6 homolog (mouse)-like 2 protein_id : NP_659175.1

name	Cdipt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076897 CCDS:CCDS21853.1 GeneID:52858 MGI:105491
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003881 - CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] codon_start : 1 product : CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) protein_id : NP_080914.1

name	Cdipt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362277 CCDS:CCDS21853.1 GeneID:52858 MGI:105491
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003881 - CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] codon_start : 1 product : CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase) protein_id : NP_620093.1

name	Mvp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18079351 GeneID:78388 MGI:1925638
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 exception : mismatches in translation product : major vault protein protein_id : NP_542369.1

name	2900092E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313594 CCDS:CCDS21854.1 GeneID:67278 MGI:1914528
definition	codon_start : 1 product : hypothetical protein LOC67278 protein_id : NP_084516.1

name	Maz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114155153 GeneID:17188 MGI:1338823
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : MYC-associated zinc finger protein protein_id : NP_034902.1

name	Kif22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704182 CCDS:CCDS21855.1 GeneID:110033 MGI:109233
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA]; GO:0005819 - spindle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : kinesin family member 22A product : kinesin family member 22 protein_id : NP_663563.1

name	1810010M01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943876 CCDS:CCDS21856.1 GeneID:69036 MGI:1916286
definition	GO_function : GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : zymogen granule membrane protein 16 protein_id : NP_081194.1

name	AI467606 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725748 CCDS:CCDS21857.1 GeneID:101602 MGI:2141979
definition	codon_start : 1 product : hypothetical protein LOC101602 protein_id : NP_849232.1

name	Qprt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526852 GeneID:67375 MGI:1914625
definition	GO_function : GO:0004514 - nicotinate-nucleotide diphosphorylase (carboxylating) activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0009435 - NAD biosynthesis [Evidence IEA]; GO:0019363 - pyridine nucleotide biosynthesis [Evidence IEA] codon_start : 1 note : nicotinate-nucleotide pyrophosphorylase product : quinolinate phosphoribosyltransferase protein_id : NP_598447.1

name	Spn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83716013 CCDS:CCDS21858.1 GeneID:20737 MGI:98384
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005615 - extracellular space [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0001931 - uropod [Evidence IDA] GO_function : GO:0008367 - bacterial binding [Evidence IMP] [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0042742 - defense response to bacterium [Evidence ISS] [Evidence IMP]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence IDA]; GO:0007162 - negative regulation of cell adhesion [Evidence IMP] [Evidence IDA]; GO:0050868 - negative regulation of T cell activation [Evidence IMP]; GO:0042130 - negative regulation of T cell proliferation [Evidence IMP]; GO:0001808 - negative regulation of type IV hypersensitivity [Evidence IMP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0042102 - positive regulation of T cell proliferation [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence ISS] [Evidence IMP]; GO:0050688 - regulation of antiviral response [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0001562 - response to protozoan [Evidence IDA]; GO:0031295 - T cell costimulation [Evidence IDA] codon_start : 1 note : 3E8 antigen; leukosialin product : sialophorin protein_id : NP_001032899.1

name	Spn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678107 CCDS:CCDS21858.1 GeneID:20737 MGI:98384
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005615 - extracellular space [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0001931 - uropod [Evidence IDA] GO_function : GO:0008367 - bacterial binding [Evidence IMP] [Evidence ISS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0042742 - defense response to bacterium [Evidence ISS] [Evidence IMP]; GO:0008624 - induction of apoptosis by extracellular signals [Evidence IDA]; GO:0007162 - negative regulation of cell adhesion [Evidence IMP] [Evidence IDA]; GO:0050868 - negative regulation of T cell activation [Evidence IMP]; GO:0042130 - negative regulation of T cell proliferation [Evidence IMP]; GO:0001808 - negative regulation of type IV hypersensitivity [Evidence IMP]; GO:0045060 - negative thymic T cell selection [Evidence IMP]; GO:0042102 - positive regulation of T cell proliferation [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence ISS] [Evidence IMP]; GO:0050688 - regulation of antiviral response [Evidence IMP]; GO:0050776 - regulation of immune response [Evidence IMP]; GO:0001562 - response to protozoan [Evidence IDA]; GO:0031295 - T cell costimulation [Evidence IDA] codon_start : 1 note : 3E8 antigen; leukosialin product : sialophorin protein_id : NP_033285.1

name	Cd2bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17505208 CCDS:CCDS21859.1 GeneID:70233 MGI:1917483
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CD2 antigen (cytoplasmic tail) binding protein 2 protein_id : NP_081629.1

name	Tbc1d10b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559968 GeneID:68449 MGI:1915699
definition	codon_start : 1 product : TBC1 domain family, member 10b protein_id : NP_653105.2

name	Mylpf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949078 GeneID:17907 MGI:97273
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : myosin light chain 2 product : myosin light chain, phosphorylatable, fast skeletal muscle protein_id : NP_058034.1

name	Sept1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567344 GeneID:54204 MGI:1858916
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : differentiation 6 (deoxyguanosine triphosphate triphosphohydrolase) product : septin 1 protein_id : NP_059489.1

name	LOC100043580 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257787 GeneID:100043580
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480408.1

name	Zfp553 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122757 CCDS:CCDS21860.1 GeneID:233887 MGI:2384725
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 553 protein_id : NP_666313.1

name	Zfp771 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893511 CCDS:CCDS21861.1 GeneID:244216 MGI:2442050
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : mesenchymal stem cell protein DSC43 protein_id : NP_796336.1

name	2410015N17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963573 CCDS:CCDS21862.1 GeneID:66422 MGI:1913672
definition	codon_start : 1 product : hypothetical protein LOC66422 protein_id : NP_075692.1

name	Sephs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011843 CCDS:CCDS21863.1 GeneID:20768 MGI:108388
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004756 - selenide, water dikinase activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : clone 1000; the SelD gene product product : selenophosphate synthetase 2 protein_id : NP_033292.2 transl_except : (pos:complement(134417245..134417247),aa:Sec)

name	Itgal (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486680 GeneID:16408 MGI:96606
definition	GO_component : GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : integrin alpha L (Cd11a); lymphocyte function associated antigen 1, alpha polypeptide; CD11A (p180) product : integrin alpha L protein_id : NP_032426.2

name	Zfp768 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122751 CCDS:CCDS21864.1 GeneID:233890 MGI:2384582
definition	GO_component : GO:0005665 - DNA-directed RNA polymerase II, core complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006366 - transcription from RNA polymerase II promoter [Evidence IEA] codon_start : 1 product : zinc finger protein 768 protein_id : NP_666314.1

name	LOC100043589 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257789 GeneID:100043589
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480423.1

name	6430604K15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425352 GeneID:269997 MGI:2443581
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC269997 protein_id : NP_780769.1

name	9130019O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037535 GeneID:78921 MGI:1926171
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC78921 protein_id : NP_084502.1

name	E430018J23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574106 GeneID:101604 MGI:2141981
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC101604 protein_id : NP_932128.1

name	LOC100043590 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257791 GeneID:100043590
definition	codon_start : 1 product : similar to SMT3B protein isoform 1 protein_id : XP_001480426.1

name	LOC100043590 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257793 GeneID:100043590
definition	codon_start : 1 product : similar to SMT3B protein isoform 2 protein_id : XP_001480428.1

name	Zfp764 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981907 CCDS:CCDS21865.1 GeneID:233893 MGI:2443580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 764 protein_id : NP_666315.2

name	Zfp688 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165358 CCDS:CCDS21866.1 GeneID:69234 MGI:1916484
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 688 protein_id : NP_081275.1

name	Zfp689 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424764 CCDS:CCDS21867.1 GeneID:71131 MGI:1918381
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein HIT-39 protein_id : NP_780372.1

name	Prr14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328357 CCDS:CCDS21868.1 GeneID:233895 MGI:2384565
definition	codon_start : 1 product : proline rich 14 protein_id : NP_663564.2

name	Fbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257716 GeneID:14123 MGI:104648
definition	codon_start : 1 product : fibrosin 1 isoform 1 protein_id : XP_284344.7

name	1700008J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381045 GeneID:629159 MGI:1916610
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002915.1

name	LOC100043597 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257795 GeneID:100043597
definition	codon_start : 1 product : similar to Snf2-related CBP activator protein protein_id : XP_001480453.1

name	D030022P06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257797 GeneID:546001 MGI:2444036
definition	codon_start : 1 product : Snf2-related CBP activator protein protein_id : XP_001480454.1

name	Phkg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518544 CCDS:CCDS21869.1 GeneID:68961 MGI:1916211
definition	GO_component : GO:0005964 - phosphorylase kinase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005978 - glycogen biosynthesis [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphorylase kinase, gamma 2 (testis) protein_id : NP_081164.1

name	Gm166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986579 CCDS:CCDS21870.1 GeneID:233899 MGI:2685012
definition	codon_start : 1 product : hypothetical protein LOC233899 protein_id : NP_001028212.1

name	Rnf40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986595 CCDS:CCDS21871.1 GeneID:233900 MGI:2142048
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ring finger protein 40 protein_id : NP_758485.1

name	Zfp629 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893273 CCDS:CCDS21873.1 GeneID:320683 MGI:2444524
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 629 protein_id : NP_796200.1

name	Bcl7c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753176 CCDS:CCDS21874.1 GeneID:12055 MGI:1332237
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : B-cell CLL/lymphoma 7C protein_id : NP_033876.1

name	Ctf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681075 CCDS:CCDS21875.1 GeneID:13019 MGI:105115
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0048666 - neuron development [Evidence IGI] codon_start : 1 note : cardiotrophin-1 product : cardiotrophin 1 protein_id : NP_031821.1

name	Ctf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38524598 CCDS:CCDS21876.1 GeneID:244218 MGI:2684607
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005127 - ciliary neurotrophic factor receptor binding [Evidence IPI]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005146 - leukemia inhibitory factor receptor binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0040007 - growth [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI] codon_start : 1 note : neuropoietin product : cardiotrophin 2 protein_id : NP_942155.1

name	Fbxl19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254240 CCDS:CCDS21877.1 GeneID:233902 MGI:3039600
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 19 protein_id : NP_766336.2

name	Tmem142c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259222 CCDS:CCDS21878.1 GeneID:269999 MGI:3039586
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : calcium release-activated calcium channel 3 product : hypothetical protein LOC269999 protein_id : NP_940816.1

name	Setd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508422 GeneID:233904 MGI:2446244
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : non-selective cation channel 1 product : SET domain containing 1A protein_id : NP_821172.2

name	Hsd3b7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817045 GeneID:101502 MGI:2141879
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003854 - 3-beta-hydroxy-delta5-steroid dehydrogenase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004769 - steroid delta-isomerase activity [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 isoform a protein_id : NP_598704.2

name	Hsd3b7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817048 GeneID:101502 MGI:2141879
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003854 - 3-beta-hydroxy-delta5-steroid dehydrogenase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004769 - steroid delta-isomerase activity [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 isoform b protein_id : NP_001035774.1

name	Stx1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13259378 GeneID:56216 MGI:1930705
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : syntaxin1B; syntaxin 1 b product : syntaxin 1B2 protein_id : NP_077725.1

name	Stx4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678177 CCDS:CCDS21880.1 GeneID:20909 MGI:893577
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0016079 - synaptic vesicle exocytosis [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : syntaxin 4A (placental) protein_id : NP_033320.1

name	Zfp668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122853 CCDS:CCDS21881.1 GeneID:244219 MGI:2442943
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 668 protein_id : NP_666371.1

name	Zfp646 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358380 CCDS:CCDS21882.1 GeneID:233905 MGI:3665412
definition	codon_start : 1 product : zinc finger protein 646 protein_id : NP_766337.2

name	BC039632 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486911 GeneID:330657 MGI:2652890
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC330657 protein_id : NP_001074737.1

name	Vkorc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519915 CCDS:CCDS21883.1 GeneID:27973 MGI:106442
definition	EC_number : 1.1.4.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0047057 - vitamin-K-epoxide reductase (warfarin-sensitive) activity [Evidence ISS] [Evidence IDA] GO_process : GO:0050820 - positive regulation of coagulation [Evidence IMP]; GO:0042371 - vitamin K biosynthesis [Evidence ISS]; GO:0042373 - vitamin K metabolism [Evidence IDA] codon_start : 1 note : vitamin K1 epoxide reductase (warfarin-sensitive); phylloquinone epoxide reductase product : vitamin K epoxide reductase complex, subunit 1 protein_id : NP_848715.1

name	Bckdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753164 CCDS:CCDS21884.1 GeneID:12041 MGI:1276121
definition	GO_component : GO:0005947 - alpha-ketoglutarate dehydrogenase complex (sensu Eukaryota) [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0009083 - branched chain family amino acid catabolism [Evidence ISS]; GO:0016310 - phosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : branched chain keto acid dehydrogenase kinase; BCKD-kinase product : branched chain ketoacid dehydrogenase kinase protein_id : NP_033869.1

name	Myst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312790 CCDS:CCDS21885.1 GeneID:67773 MGI:1915023
definition	GO_component : GO:0000776 - kinetochore [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : histone acetyltransferase Myst1 product : MYST histone acetyltransferase 1 protein_id : NP_080646.1

name	Prss8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111160 GeneID:76560 MGI:1923810
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : channel activating protease 1 product : prostasin protein_id : NP_579929.1

name	Prss36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487023 GeneID:77613 MGI:1924863
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IC] codon_start : 1 note : polyserase-2; polyserase-2 protein product : protease, serine, 36 protein_id : NP_001074843.1

name	Fus (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20982845 CCDS:CCDS21886.1 GeneID:233908 MGI:1353633
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : hnRNP P2; RNA-binding protein FUS; translocated in liposarcoma; pigpen protein product : pigpen protein_id : NP_631888.1

name	Pycard (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560222 CCDS:CCDS21888.1 GeneID:66824 MGI:1931465
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005829 - cytosol [Evidence IDA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016505 - apoptotic protease activator activity [Evidence ISS]; GO:0030693 - caspase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0032090 - Pyrin domain binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0043280 - positive regulation of caspase activity [Evidence ISS]; GO:0050718 - positive regulation of interleukin-1 beta secretion [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0043281 - regulation of caspase activity [Evidence IMP] codon_start : 1 exception : mismatches in translation product : PYD and CARD domain containing protein_id : NP_075747.2

name	Trim72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247302 GeneID:434246 MGI:3612190
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : mitsugumin 53 product : tripartite motif-containing 72 protein_id : NP_001073401.1

name	EG668675 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257802 GeneID:668675 MGI:3648098
definition	codon_start : 1 product : similar to Armadillo repeat containing, X-linked 3 protein_id : XP_001480609.1

name	Itgam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:132626289 GeneID:16409 MGI:96607
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0001846 - opsonin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IMP]; GO:0045123 - cellular extravasation [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant 1; CD11B (p170); complement component receptor 3 alpha-a; macrophage antigen alpha; complement receptor type 3; cell surface glycoprotein MAC-1 alpha subunit; leukocyte adhesion receptor MO1; Mac-1 alpha product : integrin alpha M isoform 1 precursor protein_id : NP_001076429.1

name	Itgam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:132626295 CCDS:CCDS21889.1 GeneID:16409 MGI:96607
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0001846 - opsonin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IMP]; GO:0045123 - cellular extravasation [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 2 precursor is encoded by transcript variant 2; CD11B (p170); complement component receptor 3 alpha-a; macrophage antigen alpha; complement receptor type 3; cell surface glycoprotein MAC-1 alpha subunit; leukocyte adhesion receptor MO1; Mac-1 alpha product : integrin alpha M isoform 2 precursor protein_id : NP_032427.2

name	Itgax (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946646 GeneID:16411 MGI:96609
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : CD11C (p150) alpha polypeptide; complement receptor 4; integrin alpha X (Cd11c); integrin aX product : integrin alpha X protein_id : NP_067309.1

name	Itgad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274168 CCDS:CCDS21890.1 GeneID:381924 MGI:3578624
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : integrin, alpha D protein_id : NP_001025043.1

name	Cox6a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816956 CCDS:CCDS21891.1 GeneID:12862 MGI:104649
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : subunit VIaH (heart-type) product : cytochrome c oxidase, subunit VI a, polypeptide 2 protein_id : NP_034073.2

name	LOC100043133 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257718 GeneID:100043133
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479618.1

name	Armc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48928022 CCDS:CCDS21892.1 GeneID:233912 MGI:2384586
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : armadillo repeat containing 5 protein_id : NP_666317.2

name	Tgfb1i1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678313 CCDS:CCDS21893.1 GeneID:21804 MGI:102784
definition	GO_component : GO:0005925 - focal adhesion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IGI]; GO:0030855 - epithelial cell differentiation [Evidence IGI]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0045599 - negative regulation of fat cell differentiation [Evidence IGI] codon_start : 1 product : transforming growth factor beta 1 induced transcript 1 protein_id : NP_033391.1

name	Slc5a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875434 CCDS:CCDS21894.1 GeneID:246787 MGI:2181411
definition	GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : low affinity sodium-dependent glucose cotransporter product : solute carrier family 5 (sodium/glucose cotransporter), member 2 protein_id : NP_573517.1

name	BC017158 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704184 CCDS:CCDS21895.1 GeneID:233913 MGI:2384572
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC233913 protein_id : NP_663565.1

name	EG628781 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907613 GeneID:628781 MGI:3644024
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_907456.1

name	Rgs10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385914 CCDS:CCDS21896.1 GeneID:67865 MGI:1915115
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 product : regulator of G-protein signalling 10 protein_id : NP_080694.1

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 6 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 5 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 4 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 3 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 2 pseudo : _no_value

name	LOC629029 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629029
definition	number : 1 pseudo : _no_value

name	LOC100043044 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043044
definition	number : 1 pseudo : _no_value

name	LOC100043097 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043097
definition	number : 1 pseudo : _no_value

name	LOC100043097 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043097
definition	number : 2 pseudo : _no_value

name	LOC100043097 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043097
definition	number : 3 pseudo : _no_value

name	D830044I16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257785 GeneID:381922 MGI:2443610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : RIKEN cDNA D830044I16 gene transcript_id : XR_035456.1

name	1700120K04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257799 GeneID:68232 MGI:1915482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs product : RIKEN cDNA 1700120K04 gene transcript_id : XR_035459.1

name	LOC436010 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257800 GeneID:436010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins product : similar to Yip1 domain family, member 5 pseudo : _no_value transcript_id : XR_034748.1

clone name	MSMg01-394G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-347J14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-438L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-268N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-293J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-271N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541B13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-404P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-378B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-257I08.b	B6Ng01-257I08.g
ACC	GA063199	GA063200
length	1,128	1,102
definition	B6Ng01-257I08.b	B6Ng01-257I08.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(134,418,291 - 134,419,416)	(134,516,976 - 134,518,092)
sequence	gaattcagatccaggcaggggggtttgccaatgtctactgaaattataaa tgctaaactcatagtagtggctttatgcctgtaattccaccatttgagag actgagactgttaattccaggccagcctgtactacatagtactacatagt gagttccaggccagcctgttctacagcttgcaaccctaaaccaaataaat gaataggtttttccactgtgtgatcccagtacttggaaaactgtggtaag aagacaatgatgtccattctagcctgggctccacagtgagatcttgtctc aaaaagcctaaaataggtgctggagaggtaggtaggtggttaagagcgcc tgctgttcttgcaaaggacctgggttcagttcctggaacttacatggtgg ctatcatccgtaattccagtttccaggggacctgatgtccctcttctggc ttctgagagcaccaggaacacacagttccctgtcaaacatatagccaaaa cactcctacacatacaaaataaaagtaaatgaatctttgtattattgctg tctttgatggtgcgtgtggctttccggggatgactgtgtagcttggctct ccccaacctttacatggattcgtggaatctaagtgaagttgtcaagattt tcacaactggatggtgtggcaaatgactttagccccagcacttgggagac aaaggcaggaggatctccgtggagccctcttctggtctcctcacacacat gtcatagagacagggtttctctgtggagccctggctgtcttggaactcac tctgtagaccaggatggtcttaaactcacagaggtctccctgcctctgcc tcccaactgctgggattaaaggggtgggccaccactgcctggcttaaaat aaaacatttattttaaaggaagattatggggactgggaaagatggctcag tggtttaagagcactgactgttctctagaggtcctgagtcaatttcccag caaccacatggtggctcacaaccatctgtaatgggatctgaacaccttct ttctggtgtgtctgagacgctacagtggactcatattagttactattacc aatctttaaaaaaaaaaaatatggaaaa	gaattcaagccacggtcctaagggcagacaagcgtcacgggtgccatttg tgtgggaagagttttgcccggcggtccacgttggaggcacacatgtacac tcacacaggtgaaaagccgtttcagtgcccagactgcaacaaacgatttg gccggtattcttccctgagcactcaccgagccatacaccgaggggaacgg ccgcaccaatgtcctgactgtgggaagggttttacccagcggtgcacttt ggtggcacacatgtactctcacacaggtgaaaagccgtttcagtgcccag actgcaacaaatgcttcggcaggtattcctccctgagcatgcaccgagcc atacaccgaggggaacggccacaccagtgtcctgactgtgggaagggttt tacccagcggtgcgcattggtggagcacatgtactctcacacaggcgaaa agtcattcaattgccctgattgctgcaagtcctttggtcggccatcttcc ctgagcaggcaccgggccatacacctcgaggagcggcctcatcgctgctc tcactgtggcaagacttttacacagcgctcttcactcaccagccatctcc gtgtccacactggggagaagccttactgttgtgctgattgtggacgctgc ttcagccagcgctctaggctccatgagcaccagcgagtggtacacagcgg tgtgacccccttttcttgcactcactgtggcagtgcctttgcggattcca aatatcttcggcgccacatgcgcatccatacaggtgagaagccttattca tgccctgactggtcgctgcttttcgccagggcaccgaaattccagcccat aggaggacccacactggcgagcgtccttacccctgccctcaatgtggcag gcagtttcgcacaaagtcagctatgacaagctaccagtgggtccttagac caggattaaaggccatatgacaaaagccagtcagttatctattattcctg gacctagacagagaccggatccacctgtgggcttctagcataccagagta tcaaaggtgcgggtgatgtctaaagcccaacataggagggtgatatgtac at
quality values	Open. Hide. 58 33 35 39 58 39 23 31 54 42 62 39 23 62 62 47 54 62 62 47 49 62 62 62 62 62 54 62 44 44 62 56 59 45 38 28 32 29 50 59 59 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 56 54 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 59 62 62 62 59 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 49 54 49 49 62 62 62 62 62 62 62 42 42 56 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 42 62 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 45 43 58 54 40 58 58 58 58 58 58 54 58 58 58 58 45 58 58 58 58 58 58 58 54 49 58 58 58 58 58 54 54 54 52 58 58 58 42 47 58 58 54 54 58 58 58 54 52 58 54 52 58 47 58 58 58 58 54 58 58 58 51 51 46 58 54 51 52 58 58 54 51 50 50 52 58 58 58 58 58 58 50 58 58 46 58 48 58 42 41 43 33 46 50 58 54 37 51 58 51 40 46 54 41 48 49 34 46 52 47 46 51 51 50 50 51 51 24 36 26 50 58 58 40 51 52 39 29 51 51 22 54 35 32 52 53 41 48 52 42 54 52 51 21 49 58 50 53 52 49 49 52 39 49 44 35 52 39 50 58 53 49 41 58 53 47 41 40 40 50 44 44 39 50 51 35 38 32 42 54 54 45 45 54 50 44 54 51 47 49 49 45 49 38 31 42 49 41 25 54 40 49 38 24 40 45 52 37 41 35 49 54 10 49 35 32 53 33 29 40 53 37 52 52 52 39 21 14 17 53 37 41 30 40 32 39 44 30 33 46 37 42 51 40 32 42 33 31 33 29 32 31 8 53 31 31 40 32 49 46 21 34 32 35 34 32 45 33 18 18 34 36 53 52 29 33 45 30 39 30 24 21 46 30 12 11 51 31 46 32 32 51 41 32 21 31 37 27 22 31 28 26 31 21 31 31 45 18 32 16 9 9 14 21 23 33 37 46 31 36 33 42 42 33 26 23 34 46 33 27 23 37 43 8 9 41 12 6 20 21 25 6 25 6 7 16 31 23 46 41 30 8 12 25 26 48 12 31 46 28 26 27 22 15 36 21 36 32 17 11 16 31 32 11 33 19 34 20 13 41 11 31 30 24 14 15 28 33 32 28 33 6 8 22 11 13 8 17 29 14 35 22 27 19 12 31 36 11 22 14 10 23 21 42 8 6 36 32 24 24 31 14 11 19 7 12 31 19 31 19 25 19 18 14 7 19 22 24 19 17 26 11 11 7 5 6 8 23 7 6 25 18 32 36 26 7 22 18 19 12 11 6 11 7 15 33 6 9 9 6 17 11 9 5 16 14 10 12 5 4 6 11 8 5 16 6 7 3 3 6 27 6 16 5 17 16 22 13 4 8 17 28 15 7 9 7 9 13 8 8 14 6 6 5 7 5 5 24 6 6 14 18 11 10 9 15 5 10 23 27 17 6 17 17 5 17 23 22 15 4 6 5 18 6 11 26 23 19	Open. Hide. 49 44 59 59 62 59 43 59 62 62 59 44 59 56 49 28 50 50 43 50 50 56 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 59 62 49 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 59 62 59 59 62 62 62 62 62 62 56 54 54 59 59 62 62 59 62 62 62 62 62 62 62 62 62 54 54 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 54 58 58 58 58 58 58 49 58 52 58 58 45 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 52 54 58 58 54 54 54 52 58 58 58 54 48 58 58 58 58 54 54 54 58 58 58 58 58 58 58 58 58 58 47 52 58 58 58 52 58 46 47 54 58 48 52 58 54 54 58 58 54 51 58 49 51 49 37 54 49 58 44 58 58 58 58 58 42 58 58 40 45 58 51 51 50 47 49 58 52 51 58 52 51 53 58 54 51 40 50 58 35 58 49 58 32 51 51 58 54 54 58 49 50 37 39 58 58 32 51 54 53 53 54 46 49 50 33 58 50 54 39 53 34 52 51 58 28 51 39 44 44 37 50 54 50 47 33 41 51 36 25 39 50 42 52 50 49 50 51 47 39 51 51 51 39 39 54 35 54 49 53 54 49 23 35 47 46 53 39 27 42 47 32 40 49 46 54 50 49 51 38 53 39 51 51 52 46 44 54 49 40 54 53 37 37 28 32 27 34 40 54 51 39 43 53 52 41 44 38 17 35 28 45 53 40 29 52 32 39 52 52 40 53 32 32 32 42 26 45 31 38 26 32 52 29 45 53 28 46 53 31 31 51 34 34 37 20 14 32 31 41 41 31 53 53 31 32 32 29 36 41 51 32 43 25 37 43 43 34 28 51 51 9 19 33 36 38 29 31 51 44 30 26 26 44 27 33 41 22 10 31 31 42 20 30 46 46 31 29 36 27 8 41 32 14 31 31 24 47 33 28 25 26 31 24 46 23 30 29 31 22 37 31 30 32 34 18 39 27 31 41 36 33 21 35 31 47 46 37 11 8 39 21 41 30 27 25 18 29 15 44 20 24 13 38 48 27 28 22 14 12 24 19 44 30 27 27 34 35 35 34 32 25 32 27 31 23 22 22 32 30 14 15 22 25 31 13 12 32 48 28 18 24 23 15 33 30 13 31 16 20 34 13 14 22 10 25 13 37 12 23 9 14 19 32 16 9 4 4 15 6 8 4 23 34 9 9 17 19 21 27 28 24 13 27 27 24 24 24 13 21 13 5 9 4 14 11 27 11 11 21 11 13 26 19 20 7 9 7 21 21 21 17 6 14 27 11 9 19 19 26 16 15 6 30 11 15 13 22 32 21 20 13 9 28 20 21 10 13 10 23 14 22 24 6 4 9 4 6 5 11 3 3 20 25 8 8 7 11 15 9 28 16 3 5 11 5 22 5 7 22 11 28 8 17 5 5 13 13 7 20 9 8 6 5 7 19 9 28 21 6 3 5 4 6 5 7 8 5 6 4 16

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_134418291_134419416
seq2: B6Ng01-257I08.b_45_1172

seq1  GAATTCAGATCCAGGCAGGGGGGTTTGCCAATGTCTACTGAAATTATAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGATCCAGGCAGGGGGGTTTGCCAATGTCTACTGAAATTATAAA  50

seq1  TGCTAAACTCATAGTAGTGGCTTTATGCCTGTAATTCCACCATTTGAGAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTAAACTCATAGTAGTGGCTTTATGCCTGTAATTCCACCATTTGAGAG  100

seq1  ACTGAGACTGTTAATTCCAGGCCAGCCTGTACTACATAGTACTACATAGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGACTGTTAATTCCAGGCCAGCCTGTACTACATAGTACTACATAGT  150

seq1  GAGTTCCAGGCCAGCCTGTTCTACAGCTTGCAACCCTAAACCAAATAAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTCCAGGCCAGCCTGTTCTACAGCTTGCAACCCTAAACCAAATAAAT  200

seq1  GAATAGGTTTTTCCACTGTGTGATCCCAGTACTTGGAAAACTGTGGTAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATAGGTTTTTCCACTGTGTGATCCCAGTACTTGGAAAACTGTGGTAAG  250

seq1  AAGACAATGATGTCCATTCTAGCCTGGGCTCCACAGTGAGATCTTGTCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAATGATGTCCATTCTAGCCTGGGCTCCACAGTGAGATCTTGTCTC  300

seq1  AAAAAGCCTAAAATAGGTGCTGGAGAGGTAGGTAGGTGGTTAAGAGCGCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGCCTAAAATAGGTGCTGGAGAGGTAGGTAGGTGGTTAAGAGCGCC  350

seq1  TGCTGTTCTTGCAAAGGACCTGGGTTCAGTTCCTGGAACTTACATGGTGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGTTCTTGCAAAGGACCTGGGTTCAGTTCCTGGAACTTACATGGTGG  400

seq1  CTATCATCCGTAATTCCAGTTTCCAGGGGACCTGATGTCCCTCTTCTGGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCATCCGTAATTCCAGTTTCCAGGGGACCTGATGTCCCTCTTCTGGC  450

seq1  TTCTGAGAGCACCAGGAACACACAGTTCCCTGTCAAACATATAGCCAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGAGAGCACCAGGAACACACAGTTCCCTGTCAAACATATAGCCAAAA  500

seq1  CACTCCTACACATACAAAATAAAAGTAAATGAATCTTTGTATTATTGCTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCCTACACATACAAAATAAAAGTAAATGAATCTTTGTATTATTGCTG  550

seq1  TCTTTGATGGTGCGTGTGGCTTTCCGGGGATGACTGTGTAGCTTGGCTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGATGGTGCGTGTGGCTTTCCGGGGATGACTGTGTAGCTTGGCTCT  600

seq1  CCCCAACCTTTACATGGATTCGTGGAATCTAAGTGAAGTTGTCAAGATTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAACCTTTACATGGATTCGTGGAATCTAAGTGAAGTTGTCAAGATTT  650

seq1  TCACAACTGGATGGTGTGGCAAATGACTTTAGCCCCAGCACTTGGGAGAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAACTGGATGGTGTGGCAAATGACTTTAGCCCCAGCACTTGGGAGAC  700

seq1  AAAGGCAGGAGGATCTCCGTGGAGCCCTCTTCTGGTCTCCTCACACACAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCAGGAGGATCTCCGTGGAGCCCTCTTCTGGTCTCCTCACACACAT  750

seq1  GTCATAGAGACAGGGTTTCTCTGTGGAGCCCTGGCTGTCTTGGAACTCAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCATAGAGACAGGGTTTCTCTGTGGAGCCCTGGCTGTCTTGGAACTCAC  800

seq1  TCTGTAGACCAGGATGGTCTTAAACTCACAGAGGTCTCCCTGCCTCTGCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTAGACCAGGATGGTCTTAAACTCACAGAGGTCTCCCTGCCTCTGCC  850

seq1  TCCCAACTGCTGGGATTAAAGGGGTGGGCCACCACTGCCTGGCTTAAAAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAACTGCTGGGATTAAAGGGGTGGGCCACCACTGCCTGGCTTAAAAT  900

seq1  AAAACATTTATTTAAAAGGAAGAATATGGGGACT-GGAAAGATGGCTCAG  949
      ||||||||||||| ||||||||| |||||||||| |||||||||||||||
seq2  AAAACATTTATTTTAAAGGAAGATTATGGGGACTGGGAAAGATGGCTCAG  950

seq1  TGG-TTAAGAGCACTGACTGTTCTTCTAGAGGTCCTGAGTTCAATTCCCA  998
      ||| ||||||||||||||||||| ||||||||||||||||  | ||||||
seq2  TGGTTTAAGAGCACTGACTGTTC-TCTAGAGGTCCTGAGTCAATTTCCCA  999

seq1  GCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTG-ACACCCTC  1047
      ||||||||||||||||||||||||||||||||||||||||| ||||| ||
seq2  GCAACCACATGGTGGCTCACAACCATCTGTAATGGGATCTGAACACCTTC  1049

seq1  -TTCTGGTGTGTCTGAAGACAGCTACAGTGGACTCATATAAG-TACAATA  1095
       |||||||||||||| |||| |||||||||||||||||| || ||| || 
seq2  TTTCTGGTGTGTCTG-AGAC-GCTACAGTGGACTCATATTAGTTACTATT  1097

seq1  AACAAATCTTAAAAAAAAAAAAAAAGGAAAA  1126
      | |||   |||||||||||||| | ||||||
seq2  ACCAATCTTTAAAAAAAAAAAATATGGAAAA  1128

seq1: chr7_134516976_134518092
seq2: B6Ng01-257I08.g_68_1169 (reverse)

seq1  ATGTACATATTTCACCCT-CTATGTTGGCGCCTTTAAGACCATCACCCGC  49
      |||||||||  ||||||| ||||||||| ||  || ||| ||||||||||
seq2  ATGTACATA--TCACCCTCCTATGTTGG-GC--TTTAGA-CATCACCCGC  44

seq1  ACTTTTGGAATAACTCTGGGTAATGCTAGAAGCCCACAGGTGGATCCGGG  99
      || ||||  || |||||||   ||||||||||||||||||||||||||| 
seq2  ACCTTTG--AT-ACTCTGG--TATGCTAGAAGCCCACAGGTGGATCCGG-  88

seq1  TCCTCT-TGTCTAGGGTCCAGGGAT-ATAGATAACTGACTGGCTTTTTTG  147
         ||| |||||| |||||||| || ||||||||||||||||||||| | 
seq2  ---TCTCTGTCTA-GGTCCAGGAATAATAGATAACTGACTGGCTTTTGT-  133

seq1  TCCTTATGGCCTTTAATCCTGGTCTAAGGACCCACTGGTAGCTTGTCATA  197
        | ||||||||||||||||||||||||||||||||||||||||||||||
seq2  --CATATGGCCTTTAATCCTGGTCTAAGGACCCACTGGTAGCTTGTCATA  181

seq1  GCTGACTTTGTGCGAAACTGCCTGCCACATTGAGGGCAGGGGTAAGGACG  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGACTTTGTGCGAAACTGCCTGCCACATTGAGGGCAGGGGTAAGGACG  231

seq1  CTCGCCAGTGTGGGTCCTCCTATGGGCTGGAATTTCGGTGCCCTGGCG-A  296
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  CTCGCCAGTGTGGGTCCTCCTATGGGCTGGAATTTCGGTGCCCTGGCGAA  281

seq1  AAGCAGCGACCAGTCAGGGCATGAATAAGGCTTCTCACCTGTATGGATGC  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGCGACCAGTCAGGGCATGAATAAGGCTTCTCACCTGTATGGATGC  331

seq1  GCATGTGGCGCCGAAGATATTTGGAATCCGCAAAGGCACTGCCACAGTGA  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGTGGCGCCGAAGATATTTGGAATCCGCAAAGGCACTGCCACAGTGA  381

seq1  GTGCAAGAAAAGGGGGTCACACCGCTGTGTACCACTCGCTGGTGCTCATG  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCAAGAAAAGGGGGTCACACCGCTGTGTACCACTCGCTGGTGCTCATG  431

seq1  GAGCCTAGAGCGCTGGCTGAAGCAGCGTCCACAATCAGCACAACAGTAAG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCTAGAGCGCTGGCTGAAGCAGCGTCCACAATCAGCACAACAGTAAG  481

seq1  GCTTCTCCCCAGTGTGGACACGGAGATGGCTGGTGAGTGAAGAGCGCTGT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTCTCCCCAGTGTGGACACGGAGATGGCTGGTGAGTGAAGAGCGCTGT  531

seq1  GTAAAAGTCTTGCCACAGTGAGAGCAGCGATGAGGCCGCTCCTCGAGGTG  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAAGTCTTGCCACAGTGAGAGCAGCGATGAGGCCGCTCCTCGAGGTG  581

seq1  TATGGCCCGGTGCCTGCTCAGGGAAGATGGCCGACCAAAGGACTTGCAGC  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGGCCCGGTGCCTGCTCAGGGAAGATGGCCGACCAAAGGACTTGCAGC  631

seq1  AATCAGGGCAATTGAATGACTTTTCGCCTGTGTGAGAGTACATGTGCTCC  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCAGGGCAATTGAATGACTTTTCGCCTGTGTGAGAGTACATGTGCTCC  681

seq1  ACCAATGCGCACCGCTGGGTAAAACCCTTCCCACAGTCAGGACACTGGTG  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAATGCGCACCGCTGGGTAAAACCCTTCCCACAGTCAGGACACTGGTG  731

seq1  TGGCCGTTCCCCTCGGTGTATGGCTCGGTGCATGCTCAGGGAGGAATACC  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCCGTTCCCCTCGGTGTATGGCTCGGTGCATGCTCAGGGAGGAATACC  781

seq1  TGCCGAAGCATTTGTTGCAGTCTGGGCACTGAAACGGCTTTTCACCTGTG  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCGAAGCATTTGTTGCAGTCTGGGCACTGAAACGGCTTTTCACCTGTG  831

seq1  TGAGAGTACATGTGTGCCACCAAAGTGCACCGCTGGGTAAAACCCTTCCC  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGTACATGTGTGCCACCAAAGTGCACCGCTGGGTAAAACCCTTCCC  881

seq1  ACAGTCAGGACATTGGTGCGGCCGTTCCCCTCGGTGTATGGCTCGGTGAG  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTCAGGACATTGGTGCGGCCGTTCCCCTCGGTGTATGGCTCGGTGAG  931

seq1  TGCTCAGGGAAGAATACCGGCCAAATCGTTTGTTGCAGTCTGGGCACTGA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCAGGGAAGAATACCGGCCAAATCGTTTGTTGCAGTCTGGGCACTGA  981

seq1  AACGGCTTTTCACCTGTGTGAGTGTACATGTGTGCCTCCAACGTGGACCG  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACGGCTTTTCACCTGTGTGAGTGTACATGTGTGCCTCCAACGTGGACCG  1031

seq1  CCGGGCAAAACTCTTCCCACACAAATGGCACCCGTGACGCTTGTCTGCCC  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGGCAAAACTCTTCCCACACAAATGGCACCCGTGACGCTTGTCTGCCC  1081

seq1  TTAGGACCGTGGCTTGAATTC  1117
      |||||||||||||||||||||
seq2  TTAGGACCGTGGCTTGAATTC  1102

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information