MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-258M12
Chromosome	7 (Build37)
Map Location	138,759,274 - 139,016,581
singlet/doublet	doublet
Overlap gene	LOC100043679
Upstream gene	Tacc2, LOC619876, Btbd16, EG434249, Plekha1, Htra1, Dmbt1, 4933402N03Rik, 5430419D17Rik, LOC546006, LOC100043173, Cuzd1, 1700007K09Rik, 1700063I17Rik, 2310057M21Rik, Pstk, Ikzf5, Acadsb, Hmx3, Hmx2, Bub3, LOC677073
Downstream gene	Gpr26, Cpxm2, 4631426J05Rik, LOC100043682, LOC100043683, Oat, Nkx1-2, 2310007H09Rik, A930008G19Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tacc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57752 MGI:1928899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC619876 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619876
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Btbd16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330660 MGI:3045247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434249 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434249 MGI:3645136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Plekha1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101476 MGI:2442213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56213 MGI:1929076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmbt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12945 MGI:106210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933402N03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233918 MGI:1914681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430419D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71395 MGI:1918645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546006 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043173 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 1 Protein

name	Cuzd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16433 MGI:1202881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700007K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69318 MGI:1916568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700063I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68223 MGI:1915473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310057M21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68277 MGI:1915527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pstk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214580 MGI:2685945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikzf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67143 MGI:1914393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acadsb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66885 MGI:1914135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15373 MGI:107160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15372 MGI:107159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bub3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12237 MGI:1343463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC677073 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1504 ESTs, 13 Proteins

name	LOC100043679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gpr26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233919 MGI:2441758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpxm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55987 MGI:1926006
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4631426J05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77590 MGI:1924840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043682 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC100043683 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 9 Proteins pseudo : _no_value

name	Oat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18242 MGI:97394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkx1-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20231 MGI:104806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310007H09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76429 MGI:1923679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A930008G19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77938 MGI:1925188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Tacc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109148526 GeneID:57752 MGI:1928899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming, acidic coiled-coil containing protein 2 transcript_id : NM_206856.3

name	Tacc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59624975 GeneID:57752 MGI:1928899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming, acidic coiled-coil containing protein 2 transcript_id : NM_001004468.2

name	Tacc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109148527 GeneID:57752 MGI:1928899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming, acidic coiled-coil containing protein 2 transcript_id : NM_021314.4

name	Btbd16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486657 GeneID:330660 MGI:3045247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 16 transcript_id : NM_001081038.1

name	EG434249 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381064 GeneID:434249 MGI:3645136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : predicted gene, EG434249 transcript_id : XM_489208.3

name	Plekha1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129896 GeneID:101476 MGI:2442213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 transcript_id : NM_133942.2

name	Htra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363255 GeneID:56213 MGI:1929076
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 1 transcript_id : NM_019564.2

name	Dmbt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239966 GeneID:12945 MGI:106210
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deleted in malignant brain tumors 1 transcript_id : NM_007769.2

name	4933402N03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383049 GeneID:233918 MGI:1914681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933402N03 gene transcript_id : NM_173409.3

name	5430419D17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116089315 GeneID:71395 MGI:1918645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430419D17 gene transcript_id : NM_175166.3

name	LOC546006 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257726 GeneID:546006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to deleted in malignant brain tumors 1 transcript_id : XM_620573.4

name	LOC100043173 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257728 GeneID:100043173
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 1 Protein product : similar to hCG2040007 transcript_id : XM_001479673.1

name	Cuzd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778950 GeneID:16433 MGI:1202881
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CUB and zona pellucida-like domains 1 transcript_id : NM_008411.3

name	1700007K09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124378003 GeneID:69318 MGI:1916568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700007K09 gene transcript_id : NM_027037.2

name	1700063I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351908 GeneID:68223 MGI:1915473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700063I17 gene transcript_id : NM_183272.2

name	2310057M21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374062 GeneID:68277 MGI:1915527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310057M21 gene transcript_id : NM_026655.3

name	Pstk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88014627 GeneID:214580 MGI:2685945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoseryl-tRNA kinase transcript_id : NM_001039534.1

name	Ikzf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254391 GeneID:67143 MGI:1914393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IKAROS family zinc finger 5 transcript_id : NM_175115.4

name	Acadsb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803089 GeneID:66885 MGI:1914135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase, short/branched chain transcript_id : NM_025826.2

name	Hmx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38229310 GeneID:15373 MGI:107160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H6 homeo box 3 transcript_id : NM_008257.2

name	Hmx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625930 GeneID:15372 MGI:107159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H6 homeo box 2 transcript_id : NM_145998.2

name	Bub3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802159 GeneID:12237 MGI:1343463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : budding uninhibited by benzimidazoles 3 homolog (S. cerevisiae) transcript_id : NM_009774.3

name	LOC677073 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257809 GeneID:677073
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1504 ESTs, 13 Proteins product : similar to ribosomal protein L7a transcript_id : XM_001480725.1

name	Gpr26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802803 GeneID:233919 MGI:2441758
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 26 transcript_id : NM_173410.2

name	Cpxm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348888 GeneID:55987 MGI:1926006
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxypeptidase X 2 (M14 family) transcript_id : NM_018867.4

name	4631426J05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801162 GeneID:77590 MGI:1924840
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4631426J05 gene transcript_id : NM_029935.3

name	LOC100043682 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257811 GeneID:100043682
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100043682 transcript_id : XM_001480735.1

name	Oat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032004 GeneID:18242 MGI:97394
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine aminotransferase transcript_id : NM_016978.2

name	Nkx1-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982826 GeneID:20231 MGI:104806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NK1 transcription factor related, locus 2 (Drosophila) transcript_id : NM_009123.2

name	2310007H09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778743 GeneID:76429 MGI:1923679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310007H09 gene transcript_id : NM_029609.1

name	A930008G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059501 GeneID:77938 MGI:1925188
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930008G19 gene transcript_id : NM_212473.1

name	A930008G19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059505 GeneID:77938 MGI:1925188
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A930008G19 gene transcript_id : NM_175268.4

name	Tacc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52486843 CCDS:CCDS21903.1 GeneID:57752 MGI:1928899
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 note : isoform c is encoded by transcript variant 3 product : transforming, acidic coiled-coil containing protein 2 isoform c protein_id : NP_001004468.1

name	Tacc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52486915 CCDS:CCDS21904.1 GeneID:57752 MGI:1928899
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : transforming, acidic coiled-coil containing protein 2 isoform a protein_id : NP_996738.2

name	Tacc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52486864 CCDS:CCDS21905.1 GeneID:57752 MGI:1928899
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : transforming, acidic coiled-coil containing protein 2 isoform b protein_id : NP_067289.2

name	Btbd16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486658 GeneID:330660 MGI:3045247
definition	codon_start : 1 product : BTB (POZ) domain containing 16 protein_id : NP_001074507.1

name	EG434249 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82915067 GeneID:434249 MGI:3645136
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489208.2

name	Plekha1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527162 CCDS:CCDS21907.1 GeneID:101476 MGI:2442213
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA] codon_start : 1 product : pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 protein_id : NP_598703.1

name	Htra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625027 CCDS:CCDS21908.1 GeneID:56213 MGI:1929076
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0019838 - growth factor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005520 - insulin-like growth factor binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0030514 - negative regulation of BMP signaling pathway [Evidence IDA]; GO:0030512 - negative regulation of transforming growth factor beta receptor signaling pathway [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 exception : mismatches in translation note : insulin-like growth factor binding protein 5 protease product : protease, serine, 11 (Igf binding) protein_id : NP_062510.1

name	Dmbt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239967 CCDS:CCDS21909.1 GeneID:12945 MGI:106210
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0001824 - blastocyst development [Evidence IMP]; GO:0001833 - inner cell mass cell proliferation [Evidence IDA]; GO:0030858 - positive regulation of epithelial cell differentiation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : crp-ductin; vomeroglandin product : deleted in malignant brain tumors 1 protein_id : NP_031795.2

name	4933402N03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117935040 GeneID:233918 MGI:1914681
definition	codon_start : 1 product : hypothetical protein LOC233918 protein_id : NP_775585.1

name	5430419D17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116089316 CCDS:CCDS21911.1 GeneID:71395 MGI:1918645
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71395 protein_id : NP_780375.2

name	LOC546006 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257727 GeneID:546006
definition	codon_start : 1 product : similar to deleted in malignant brain tumors 1 protein_id : XP_620573.4

name	LOC100043173 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257729 GeneID:100043173
definition	codon_start : 1 product : similar to hCG2040007 protein_id : XP_001479723.1

name	Cuzd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778951 GeneID:16433 MGI:1202881
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0042588 - zymogen granule [Evidence IDA]; GO:0042589 - zymogen granule membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0008283 - cell proliferation [Evidence ISS]; GO:0007565 - pregnancy [Evidence NAS]; GO:0006931 - substrate-bound cell migration, cell attachment to substrate [Evidence ISS]; GO:0032023 - trypsinogen activation [Evidence IMP] codon_start : 1 note : integral membrane-associated protein 1 product : CUB and zona pellucida-like domains 1 protein_id : NP_032437.3

name	1700007K09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037157 CCDS:CCDS21912.1 GeneID:69318 MGI:1916568
definition	codon_start : 1 product : hypothetical protein LOC69318 protein_id : NP_081313.1

name	1700063I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304065 GeneID:68223 MGI:1915473
definition	codon_start : 1 product : hypothetical protein LOC68223 protein_id : NP_899095.1

name	2310057M21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311825 GeneID:68277 MGI:1915527
definition	GO_function : GO:0042802 - identical protein binding [Evidence IPI] codon_start : 1 product : hypothetical protein LOC68277 protein_id : NP_080931.1

name	Pstk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88014628 CCDS:CCDS21914.1 GeneID:214580 MGI:2685945
definition	GO_function : GO:0016301 - kinase activity [Evidence IDA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0000049 - tRNA binding [Evidence IDA] GO_process : GO:0001514 - selenocysteine incorporation [Evidence IDA] codon_start : 1 product : phosphoseryl-tRNA kinase protein_id : NP_001034623.1

name	Ikzf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982165 CCDS:CCDS21915.1 GeneID:67143 MGI:1914393
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein, subfamily 1A, 5 protein_id : NP_780324.2

name	Acadsb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17647119 CCDS:CCDS21916.1 GeneID:66885 MGI:1914135
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0016937 - short-branched-chain-acyl-CoA dehydrogenase activity [Evidence ISS] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : acyl-Coenzyme A dehydrogenase, short/branched chain protein_id : NP_080102.1

name	Hmx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38229311 CCDS:CCDS21917.1 GeneID:15373 MGI:107160
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0042472 - inner ear morphogenesis [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : H6 homeo box 3 protein_id : NP_032283.2

name	Hmx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608207 CCDS:CCDS21918.1 GeneID:15372 MGI:107159
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007420 - brain development [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0042472 - inner ear morphogenesis [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : NK-related homeobox product : H6 homeo box 2 protein_id : NP_666110.1

name	Bub3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560618 GeneID:12237 MGI:1343463
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007059 - chromosome segregation [Evidence IMP]; GO:0000070 - mitotic sister chromatid segregation [Evidence IMP] codon_start : 1 product : budding uninhibited by benzimidazoles 3 homolog protein_id : NP_033904.2

name	LOC677073 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257810 GeneID:677073
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480775.1

name	Gpr26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734158 CCDS:CCDS21920.1 GeneID:233919 MGI:2441758
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 26 protein_id : NP_775586.1

name	Cpxm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18466804 CCDS:CCDS21921.1 GeneID:55987 MGI:1926006
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0004182 - carboxypeptidase A activity [Evidence IEA]; GO:0004180 - carboxypeptidase activity [Evidence IDA]; GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : carboxypeptidase X2; metallocarboxypeptidase 2 product : carboxypeptidase X 2 (M14 family) protein_id : NP_061355.2

name	4631426J05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560040 CCDS:CCDS21922.1 GeneID:77590 MGI:1924840
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050656 - 3'-phosphoadenosine 5'-phosphosulfate binding [Evidence ISS]; GO:0050659 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0019319 - hexose biosynthesis [Evidence ISS] codon_start : 1 note : GalNAc4S-6ST; GalNAc 4-sulfate 6-O-sulfotransferase product : N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase protein_id : NP_084211.2

name	LOC100043682 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257812 GeneID:100043682
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480785.1

name	Oat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393866 CCDS:CCDS21923.1 GeneID:18242 MGI:97394
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004587 - ornithine-oxo-acid transaminase activity [Evidence IEA]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : ornithine aminotransferase protein_id : NP_058674.1

name	Nkx1-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677853 CCDS:CCDS21924.1 GeneID:20231 MGI:104806
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : spinal cord axial homeobox gene 1 product : NK1 transcription factor related, locus 2 protein_id : NP_033149.1

name	2310007H09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778744 CCDS:CCDS21925.1 GeneID:76429 MGI:1923679
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76429 protein_id : NP_083885.1

name	A930008G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542068 CCDS:CCDS21926.1 GeneID:77938 MGI:1925188
definition	codon_start : 1 product : hypothetical protein LOC77938 protein_id : NP_780477.2

name	A930008G19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059502 CCDS:CCDS21926.1 GeneID:77938 MGI:1925188
definition	codon_start : 1 product : hypothetical protein LOC77938 protein_id : NP_997638.1

name	LOC619876 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619876
definition	number : 1 pseudo : _no_value

name	LOC100043679 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043679
definition	number : 1 pseudo : _no_value

name	LOC100043683 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257813 GeneID:100043683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 9 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_034823.1

clone name	MSMg01-346G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-423E22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-395L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-494J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236G04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-139E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-094E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-258M12.b	B6Ng01-258M12.g
ACC	GA064130	GA064131
length	1,099	1,117
definition	B6Ng01-258M12.b	B6Ng01-258M12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(139,015,488 - 139,016,581)	(138,759,274 - 138,760,400)
sequence	gaattcttcctttcctaaggcttaccatgtctcttttgtgcagctcgaaa tcctttaggaccagtgttaggagaaatcaatagcaatcaatctttctttc tttattcttcaatgatgctcttccatagcccaggctgctcttgagctccc aactccctatgtagctgaaggtgaccttgaactcctgatactcatgcttc cattctttgggtgctgggtttacaggtgtgtgccaccatacttcagaaac accagaactgtttcttggggcttgggggaggtgttggattcataaatcct cacaaagtcatgtgacatatactgatgtgtttttcctaagtctatcccat tcacagccccagatccgtaaagcctcaaccaactagacctgctctcccgc catgagcaaatcaagataggaggctctgggtggatgagtgaagacatttt ggcttcttaaaagaaacctccagcctacgctgggattttgaagctctgag caggagctgtgaagggcaagttctgagcactgagctaagtatttttcacg ttgccagtgggacaaaaatgcctgatactagacttaaactatttatctca gctcgtgttttcagaaatgccagtccatgatcacttggccacatggccca tagcttctgttcaggtagaacatcatagcaggatgttcaagagaacaggg tgcagagagagaatatgcctccttcaaaggcatacctcaatgactacttc ctccaactgtaacccacctctgggcttttactgcctctcaataatgccgc catcaaatcacgaatttgtcaagggatgactccattgatgttaacatcct cgtgatccaacagcaccaccggcccggtgttcaagctctcaacgctgtag ggaatgcttcctttccaagtcacaaccataacaaggtgtgattcatgtaa atctgcctaagctcctggtaaacaagctggtgaagggagacaggcagtgt tggagatgggcagttcatgattgttagatggaacaaatgactcttgtggc aaggctgggaaatccacagagtctggggtacagttcgaggctggtctgc	gaattcttttcatttttttctttcccctctttccagtcatatttcctgcc tccataacacatgcgcgtgcactcacacacacacacacacacacacacac acacacacacacacacacgtgtgtgtgtggtactgtgcttggcctgaatt catgtttctgaattcatgttttcacttcttttatctgtttatttgaatcc tcttttggtttattgatcttttgatcttttttcctccctccctccctctc tccctcccttcttcctctctctctctctctctctctctctttctctttct ttcttttgagagtgtctcaccatgtattcctggatggcctagaactctct atgtggaccagactgacctctaattcactcagaatcacctacctctgctt ctttagcacagggattaaaggtgtgcagtgccacacatggctcatcggcc actttaaaaactagactttggaacttttttgtgtgtgatgctttatccat ttaggcatctttggatccagctgttgtggcactgcaagcttttggagcaa catctgttttcatatttcctagtttctgcacagcactgtgcatatctcag atgttgttctagattggcaaagacacgtaaaagctctgaggtttatagct tctttctttctctttgctcaaataatttcaggtcttggattaaagacaga agaccataatttgcatacatctacctatttaatgagcacatagctggtgg cagatgttataagaagggcagtgggtacaacttgacaagactggagtctt tctccagggcactaatcggggattcacacaagcactaccactactgatga gaggagagggacaggcttaaacagagccacatgggaatgaggtgcagaga ggcaaggaactgaatgaagtgtggtgcacttactttcttcgtgtcctgag ggtccagctcagagctgagccaagggagatatgtggatctggtgggatta gtgatctccaggagagcaggtcacttctgtctctgcacacatgtacccag agctgggcaggcactcagtgagaaagccagcgattcttatgaccgaatac taatcttagagaagaat
quality values	Open. Hide. 62 25 27 31 62 62 62 62 34 62 62 62 62 62 56 56 56 56 62 49 62 62 62 62 59 44 43 62 62 62 62 43 51 46 32 32 32 28 27 38 43 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 54 56 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 54 54 62 62 54 39 58 54 46 46 46 47 42 54 58 58 58 58 58 54 58 58 58 54 58 58 45 35 58 54 58 58 58 45 32 54 58 58 52 52 44 58 52 54 58 58 58 54 54 54 54 58 52 58 54 58 54 52 58 54 58 58 54 58 58 49 52 54 58 58 58 54 39 58 58 58 54 51 58 58 58 58 54 32 24 11 28 19 24 58 58 49 51 46 42 58 54 50 47 51 58 42 50 53 42 49 49 49 49 45 42 36 49 52 51 58 58 58 58 58 42 47 53 58 48 49 58 44 58 49 58 52 52 53 39 29 58 52 49 24 58 49 52 52 51 58 40 54 50 43 58 50 41 58 50 50 43 41 54 52 32 36 37 58 27 54 25 37 49 29 49 58 35 58 52 43 16 58 25 47 53 51 31 49 28 36 39 38 41 47 45 53 45 54 40 54 40 37 54 37 26 54 28 29 53 32 54 41 52 34 35 14 38 51 50 35 47 32 53 47 51 45 53 47 37 30 6 13 33 39 37 39 34 51 38 54 47 42 52 52 42 33 28 34 54 54 27 35 54 54 47 24 30 39 52 40 47 53 32 33 37 32 32 32 53 21 32 40 41 33 18 34 47 23 45 39 35 53 37 40 41 35 35 28 45 53 41 46 46 33 39 39 33 23 53 52 30 31 25 38 28 18 30 42 51 19 51 26 43 34 29 45 30 31 20 31 30 31 35 29 51 33 42 24 26 34 31 28 25 12 10 13 9 16 35 42 26 28 33 23 33 31 26 38 21 42 19 28 32 9 21 46 6 12 12 31 27 31 31 31 23 28 16 26 30 28 31 29 21 30 22 25 44 21 21 31 23 32 30 27 36 31 20 11 47 39 15 20 9 19 26 31 25 10 17 29 15 29 25 19 32 26 21 20 20 14 27 25 13 27 18 24 31 22 27 32 24 18 31 22 26 44 29 30 31 31 24 26 34 32 22 38 21 34 33 23 21 11 18 28 5 14 36 20 6 6 31 14 28 31 30 29 15 18 30 20 6 19 9 12 5 12 14 32 21 25 23 19 9 8 25 10 13 9 26 21 13 12 19 33 39 20 10 31 11 26 20 23 17 26 21 32 26 11 16 5 9 39 13 15 15 16 21 19 20 14 6 40 23 6 11 14 24 24 8 6 16 11 6 7 10 4 3 11 18 15 18 16 11 25 6 16 40 18 8 7 8 7 16 18 6 17 8 28 28 9 22 34 28 21 6 13 8 27 11 21 7 14 10 3 4 23 11 19 9 9 10 20 20 20 9	Open. Hide. 49 44 62 47 62 62 62 62 62 46 44 39 50 38 34 34 56 59 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 59 36 62 54 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 59 59 59 62 62 59 59 59 46 56 56 48 46 62 62 59 62 62 62 59 62 62 59 62 62 62 59 62 62 62 56 62 62 54 56 62 56 62 56 62 62 62 59 62 62 62 54 54 54 54 56 62 54 42 42 54 62 62 62 62 62 62 62 62 59 62 51 59 59 59 59 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 59 49 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 54 43 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 56 62 56 62 62 62 62 62 59 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 59 59 56 62 56 62 49 38 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 56 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 36 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 52 62 62 48 54 62 58 58 58 58 58 58 58 58 54 54 58 53 58 58 58 58 58 52 52 52 58 58 58 54 58 45 58 52 58 42 47 52 42 58 58 58 51 58 54 54 58 52 58 58 58 58 54 52 58 47 58 42 54 54 39 41 58 42 34 52 45 30 58 58 25 35 54 58 58 27 54 52 50 54 42 54 52 52 58 58 41 58 58 58 54 51 58 27 42 27 58 40 53 40 51 50 52 53 42 53 54 58 48 52 42 58 58 51 50 46 58 58 50 40 35 49 39 33 58 41 37 35 50 50 58 51 49 37 39 58 36 50 48 35 54 42 47 31 31 28 58 53 50 51 50 46 46 58 41 27 29 19 46 32 40 29 18 41 58 58 49 37 40 49 30 47 30 51 50 50 27 42 50 40 34 34 58 58 30 58 37 51 52 26 52 39 42 39 53 53 32 47 34 34 53 35 54 23 17 41 32 38 28 42 37 49 30 37 20 54 24 54 14 13 54 49 31 39 30 34 41 54 51 29 32 34 26 38 37 47 27 31 37 37 28 27 35 37 25 26 39 28 14 22 33 37 31 51 25 26 34 38 47 26 26 40 42 23 33 31 33 20 12 18 33 22 53 47 32 15 13 32 32 22 34 24 32 11 18 13 32 25 34 37 33 37 31 20 32 41 31 32 21 33 12 12 30 41 28 33 29 31 31 21 40 11 46 30 25 16 20 22 19 28 31 30 18 30 31 29 16 18 45 13 29 21 20 31 22 36 31 32 33 38 23 31 34 42 22 27 31 38 31 31 10 46 24 42 21 26 31 32 21 25 19 12 25 21 28 31 25 22 26 30 27 28 19 10 10 10 30 46 16 26 29 23 26 32 36 24 28 31 46 26 19 21 6 13 9 13 19 20 31 31 24 27 31 21 44 21 27 25 26 24 21 31 33 10 6 6 26 10 27 27 18 38 8 35 29 21 7 10 28 16 30 7 43 9 11 10 23 11 7 25 21 32 19 27 33 34 20 20 43 21 21 23 9 21 12 27 27 11 12 31 33 7 33 9 12 7 14 5 31 10 31 17 26 19 11 4 9 13 13 25 22 8 16 16 10 9 16 13 16 13 12 5 6 11 13 11 16 19 7 9 20 7 3 5 4 5 3 4 7 5 3 5 5 17 13 16 6 9 5 9 5 11 7 11 7 17 9 7 15 8 14 21 5 4 11 6 5 5 12 12 5 8 7 6 4 15 5 15 4 14 10 5 6 15 15 6 4 9 10 16 8 6 4 6 5 10 12 2 3 6 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_139015488_139016581
seq2: B6Ng01-258M12.b_47_1145 (reverse)

seq1  GCAGA-CAGCCTCCGAACTGTACCCCAGACTCTGT-GATTT-CCAGCC-T  46
      ||||| |||||| |||||||||||||||||||||| ||||| |||||| |
seq2  GCAGACCAGCCT-CGAACTGTACCCCAGACTCTGTGGATTTCCCAGCCTT  49

seq1  GCCAC-AGAGTCATTTTGTTCCATCTTACAATCATGAACTGCCCATCCTC  95
      ||||| ||||||| |||||||||||| ||||||||||||||||||||  |
seq2  GCCACAAGAGTCA-TTTGTTCCATCTAACAATCATGAACTGCCCATCTCC  98

seq1  CACACTGCCTGTCT-CCTTCACCAGCTTGTTTACCAGGAGCTTAGGCAGA  144
       ||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AACACTGCCTGTCTCCCTTCACCAGCTTGTTTACCAGGAGCTTAGGCAGA  148

seq1  TTTACATGAATCACACCTTGTTATGGTTGTGACTTGGAAAGGAAGCATTC  194
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTACATGAATCACACCTTGTTATGGTTGTGACTTGGAAAGGAAGCATTC  198

seq1  CCTACAGCGTTGAGAGCTTGAACACC-GGCCGGTGGTGCTGTTGGATCAC  243
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CCTACAGCGTTGAGAGCTTGAACACCGGGCCGGTGGTGCTGTTGGATCAC  248

seq1  GAGGATGTTAACATCAATGGAGTCATCCCTTGACAAATTCGTGATTTGAT  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGATGTTAACATCAATGGAGTCATCCCTTGACAAATTCGTGATTTGAT  298

seq1  GGCGGCATTATTGAGAGGCAGTAAAAGCCCAGAGGTGGGTTACAGTTGGA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGGCATTATTGAGAGGCAGTAAAAGCCCAGAGGTGGGTTACAGTTGGA  348

seq1  GGAAGTAGTCATTGAGGTATGCCTTTGAAGGAGGCATATTCTCTCTCTGC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGTAGTCATTGAGGTATGCCTTTGAAGGAGGCATATTCTCTCTCTGC  398

seq1  ACCCTGTTCTCTTGAACATCCTGCTATGATGTTCTACCTGAACAGAAGCT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTGTTCTCTTGAACATCCTGCTATGATGTTCTACCTGAACAGAAGCT  448

seq1  ATGGGCCATGTGGCCAAGTGATCATGGACTGGCATTTCTGAAAACACGAG  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGCCATGTGGCCAAGTGATCATGGACTGGCATTTCTGAAAACACGAG  498

seq1  CTGAGATAAATAGTTTAAGTCTAGTATCAGGCATTTTTGTCCCACTGGCA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGATAAATAGTTTAAGTCTAGTATCAGGCATTTTTGTCCCACTGGCA  548

seq1  ACGTGAAAAATACTTAGCTCAGTGCTCAGAACTTGCCCTTCACAGCTCCT  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTGAAAAATACTTAGCTCAGTGCTCAGAACTTGCCCTTCACAGCTCCT  598

seq1  GCTCAGAGCTTCAAAATCCCAGCGTAGGCTGGAGGTTTCTTTTAAGAAGC  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCAGAGCTTCAAAATCCCAGCGTAGGCTGGAGGTTTCTTTTAAGAAGC  648

seq1  CAAAATGTCTTCACTCATCCACCCAGAGCCTCCTATCTTGATTTGCTCAT  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAATGTCTTCACTCATCCACCCAGAGCCTCCTATCTTGATTTGCTCAT  698

seq1  GGCGGGAGAGCAGGTCTAGTTGGTTGAGGCTTTACGGATCTGGGGCTGTG  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCGGGAGAGCAGGTCTAGTTGGTTGAGGCTTTACGGATCTGGGGCTGTG  748

seq1  AATGGGATAGACTTAGGAAAAACACATCAGTATATGTCACATGACTTTGT  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGGATAGACTTAGGAAAAACACATCAGTATATGTCACATGACTTTGT  798

seq1  GAGGATTTATGAATCCAACACCTCCCCCAAGCCCCAAGAAACAGTTCTGG  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGATTTATGAATCCAACACCTCCCCCAAGCCCCAAGAAACAGTTCTGG  848

seq1  TGTTTCTGAAGTATGGTGGCACACACCTGTAAACCCAGCACCCAAAGAAT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTCTGAAGTATGGTGGCACACACCTGTAAACCCAGCACCCAAAGAAT  898

seq1  GGAAGCATGAGTATCAGGAGTTCAAGGTCACCTTCAGCTACATAGGGAGT  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGCATGAGTATCAGGAGTTCAAGGTCACCTTCAGCTACATAGGGAGT  948

seq1  TGGGAGCTCAAGAGCAGCCTGGGCTATGGAAGAGCATCATTGAAGAATAA  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAGCTCAAGAGCAGCCTGGGCTATGGAAGAGCATCATTGAAGAATAA  998

seq1  AGAAAGAAAGATTGATTGCTATTGATTTCTCCTAACACTGGTCCTAAAGG  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAGAAAGATTGATTGCTATTGATTTCTCCTAACACTGGTCCTAAAGG  1048

seq1  ATTTCGAGCTGCACAAAAGAGACATGGTAAGCCTTAGGAAAGGAAGAATT  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCGAGCTGCACAAAAGAGACATGGTAAGCCTTAGGAAAGGAAGAATT  1098

seq1  C  1094
      |
seq2  C  1099

seq1: chr7_138759274_138760400
seq2: B6Ng01-258M12.g_68_1184

seq1  GAATTCTTTTCATTTTTTTCTTTCCCCTCTTTCCAGTCATATTTCCTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTTCATTTTTTTCTTTCCCCTCTTTCCAGTCATATTTCCTGCC  50

seq1  TCCATAACACATGCGCGTGCACTCACACACACACACACACACACACACAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATAACACATGCGCGTGCACTCACACACACACACACACACACACACAC  100

seq1  ACACACACACACACACACGTGTGTGTGTGGTACTGTGCTTGGCCTGAATT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACACACACACACACACGTGTGTGTGTGGTACTGTGCTTGGCCTGAATT  150

seq1  CATGTTTCTGAATTCATGTTTTCACTTCTTTTATCTGTTTATTTGAATCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTTTCTGAATTCATGTTTTCACTTCTTTTATCTGTTTATTTGAATCC  200

seq1  TCTTTTGGTTTATTGATCTTTTGATCTTTTTTCCTCCCTCCCTCCCTCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTTGGTTTATTGATCTTTTGATCTTTTTTCCTCCCTCCCTCCCTCTC  250

seq1  TCCCTCCCTTCTTCCTCTCTCTCTCTCTCTCTCTCTCTCTTTCTCTTTCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTCCCTTCTTCCTCTCTCTCTCTCTCTCTCTCTCTCTTTCTCTTTCT  300

seq1  TTCTTTTGAGAGTGTCTCACCATGTATTCCTGGATGGCCTAGAACTCTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTTTGAGAGTGTCTCACCATGTATTCCTGGATGGCCTAGAACTCTCT  350

seq1  ATGTGGACCAGACTGACCTCTAATTCACTCAGAATCACCTACCTCTGCTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGGACCAGACTGACCTCTAATTCACTCAGAATCACCTACCTCTGCTT  400

seq1  CTTTAGCACAGGGATTAAAGGTGTGCAGTGCCACACATGGCTCATCGGCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGCACAGGGATTAAAGGTGTGCAGTGCCACACATGGCTCATCGGCC  450

seq1  ACTTTAAAAACTAGACTTTGGAACTTTTTTGTGTGTGATGCTTTATCCAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTAAAAACTAGACTTTGGAACTTTTTTGTGTGTGATGCTTTATCCAT  500

seq1  TTAGGCATCTTTGGATCCAGCTGTTGTGGCACTGCAAGCTTTTGGAGCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGCATCTTTGGATCCAGCTGTTGTGGCACTGCAAGCTTTTGGAGCAA  550

seq1  CATCTGTTTTCATATTTCCTAGTTTCTGCACAGCACTGTGCATATCTCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTGTTTTCATATTTCCTAGTTTCTGCACAGCACTGTGCATATCTCAG  600

seq1  ATGTTGTTCTAGATTGGCAAAGACACGTAAAAGCTCTGAGGTTTATAGCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTGTTCTAGATTGGCAAAGACACGTAAAAGCTCTGAGGTTTATAGCT  650

seq1  TCTTTCTTTCTCTTTGCTCAAATAATTTCAGGTCTTGGATTAAAGACAGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTTTCTCTTTGCTCAAATAATTTCAGGTCTTGGATTAAAGACAGA  700

seq1  AGACCATAATTTGCATACATCTACCTATTTAATGAGCACATAGCTGGTGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCATAATTTGCATACATCTACCTATTTAATGAGCACATAGCTGGTGG  750

seq1  CAGATGTTATAAGAAGGGCAGTGGGTACAACTTGACAAGACTGGAGTCTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATGTTATAAGAAGGGCAGTGGGTACAACTTGACAAGACTGGAGTCTT  800

seq1  TCTCCAGGGCACTAATCGGGGATTCACACAAGCACTACCACTACTGATGA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCAGGGCACTAATCGGGGATTCACACAAGCACTACCACTACTGATGA  850

seq1  GAGGAGAGGGACAGGCTTAAACAGAGCCACATGGGAATGAGGTGCAGAGA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGAGAGGGACAGGCTTAAACAGAGCCACATGGGAATGAGGTGCAGAGA  900

seq1  GGCAAGGAACTGAATGAAGTGTGGGTGCACTTACTTTCTTCGTGTCCTGA  950
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  GGCAAGGAACTGAATGAAGTGT-GGTGCACTTACTTTCTTCGTGTCCTGA  949

seq1  GGGTCCAGCTCAGAGCTGAGCCAAGGGGAGAATATGTGGATCTGGTGGGA  1000
      |||||||||||||||||||||||| ||||| |||||||||||||||||||
seq2  GGGTCCAGCTCAGAGCTGAGCCAA-GGGAG-ATATGTGGATCTGGTGGGA  997

seq1  TTAGTGATCTTCCAGGAAGAGCAGGGTTCACTTCTGTCTCTGCACACATG  1050
      ||||||||| |||||| ||||||||  |||||||||||||||||||||||
seq2  TTAGTGATC-TCCAGG-AGAGCAGG--TCACTTCTGTCTCTGCACACATG  1043

seq1  TACCAAGGAAGGGCTGTGCAGGCACACAGTGAG-AAGCCAGCGA-TCTAT  1098
      ||||     || |||| |||||||| ||||||| |||||||||| |||  
seq2  TACC----CAGAGCTGGGCAGGCACTCAGTGAGAAAGCCAGCGATTCTTA  1089

seq1  AGAACGAATACTAGATC-TAGAGAAAGAAT  1127
       || ||||||||| ||| ||||| ||||||
seq2  TGACCGAATACTA-ATCTTAGAG-AAGAAT  1117

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information