MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-261N22
Chromosome	7 (Build37)
Map Location	5,000,737 - 5,001,766
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Lair1, Ttyh1, Leng8, Leng9, Cdc42ep5, LOC384521, EG232801, Ncr1, Gp6, LOC100041851, Atp6v0c-ps1, Rdh13, Eps8l1, Ppp1r12c, Tnnt1, Tnni3, 6030429G01Rik, Syt5, Ptprh, LOC669557, Tmem86b, Saps1, EG628211, 1500019G21Rik, Brsk1, BC022651, Suv420h2, Cox6b2, 4930401F20Rik, Il11, 4930572D21Rik, 2210411K11Rik, Rpl28, Ube2s, D430041B17Rik, Isoc2b, Isoc2a, LOC384524, Zfp628, Nat14, A430110N23Rik, LOC665049, Gm1079, Gm1078, Zfp579, Fiz1, Zfp524, 6430526N21Rik, 4632433K11Rik, Zfp784
Downstream gene	Zfp580, Ccdc106, U2af2, Epn1, Rfpl4, Rasl2-9, EG665126, V1rd5, V1rd3, EG665150, Nlrp2, EG272350, V1rd4, EG665163, V1rd10, EG630071, EG665255, EG636697, EG636705, LOC636731, LOC673215, V1rd2, LOC100041627, LOC100041637, V1rd1, LOC100041647, V1rd11, LOC100041666, V1rd6, EG384525, EG269859
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lair1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52855 MGI:105492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttyh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57776 MGI:1889007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Leng8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232798 MGI:2142195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Leng9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243813 MGI:2444509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc42ep5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58804 MGI:1929745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384521 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG232801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232801 MGI:3647196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ncr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17086 MGI:1336212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243816 MGI:1889810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins

name	LOC100041851 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041851
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs

name	Atp6v0c-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545901 MGI:2151814
definition	gene_synonym : Atp6c; Atp6c-rs1; Atp6c1; Atp6c2; Atp6l-ps1 note : ATPase, H+ transporting, lysosomal V0 subunit C, pseudogene 1 pseudo : _no_value

name	Rdh13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108841 MGI:1918732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eps8l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67425 MGI:1914675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppp1r12c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232807 MGI:1924258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnnt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21955 MGI:1333868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnni3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21954 MGI:98783
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030429G01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436022 MGI:3588207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53420 MGI:1926368
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptprh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545902 MGI:3026877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669557 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669557
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Tmem86b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68255 MGI:1915505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243819 MGI:2442163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628211 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628211 MGI:3648447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 10 Proteins pseudo : _no_value

name	1500019G21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66245 MGI:1913495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brsk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381979 MGI:2685946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC022651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330460 MGI:2679718
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suv420h2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232811 MGI:2385262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox6b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333182 MGI:3044182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	4930401F20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243822 MGI:3045311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16156 MGI:107613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930572D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78052 MGI:1925302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	2210411K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664968 MGI:1922935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19943 MGI:101839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube2s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77891 MGI:1925141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D430041B17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232813 MGI:3605641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isoc2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67441 MGI:1914691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isoc2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664994 MGI:3609243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins

name	LOC384524 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384524
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Zfp628 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232816 MGI:2665174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nat14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269854 MGI:3039561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A430110N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269855 MGI:3606211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665049 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Gm1079 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381836 MGI:2685925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	Gm1078 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381835 MGI:2685924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	Zfp579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68490 MGI:1915740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fiz1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23877 MGI:1344336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp524 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66056 MGI:1916740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430526N21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319748 MGI:2442656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632433K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77043 MGI:1924293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp784 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654801 MGI:3606042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp580 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68992 MGI:1916242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs, 3 Proteins

name	Ccdc106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232821 MGI:2385900
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	U2af2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22185 MGI:98886
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13854 MGI:1333763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfpl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192658 MGI:2149590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rasl2-9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19428 MGI:104605
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665126 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665126 MGI:3643242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1239 ESTs, 28 Proteins pseudo : _no_value

name	V1rd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384522 MGI:3033474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins

name	V1rd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81015 MGI:3033472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665150 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665150 MGI:3646165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins pseudo : _no_value

name	Nlrp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232827 MGI:3041206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG272350 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272350 MGI:3643170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	V1rd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81014 MGI:3033473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665163 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665163 MGI:3649034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	V1rd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404284 MGI:3033479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630071 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630071 MGI:3645676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665255 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665255 MGI:3645468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG636697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636697 MGI:3645244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	EG636705 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636705 MGI:3646079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC636731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 29 Proteins pseudo : _no_value

name	LOC673215 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673215
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	V1rd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81016 MGI:3033471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041627 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins pseudo : _no_value

name	V1rd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81017 MGI:3033470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041647 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041647
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1rd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404285 MGI:3033480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041666 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	V1rd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81013 MGI:3033475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384525 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384525 MGI:3645266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins

name	EG269859 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269859 MGI:3647769
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Lair1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802805 GeneID:52855 MGI:105492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte-associated Ig-like receptor 1 transcript_id : NM_178611.3

name	Ttyh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343810 GeneID:57776 MGI:1889007
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tweety homolog 1 (Drosophila) transcript_id : NM_021324.4

name	Ttyh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803438 GeneID:57776 MGI:1889007
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tweety homolog 1 (Drosophila) transcript_id : NM_001001454.2

name	Leng8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129982 GeneID:232798 MGI:2142195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte receptor cluster (LRC) member 8 transcript_id : NM_172736.3

name	Leng9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388035 GeneID:243813 MGI:2444509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leukocyte receptor cluster (LRC) member 9 transcript_id : NM_175529.3

name	Cdc42ep5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129278 GeneID:58804 MGI:1929745
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC42 effector protein (Rho GTPase binding) 5 transcript_id : NM_021454.3

name	EG232801 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486980 GeneID:232801 MGI:3647196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG232801 transcript_id : NM_001081239.1

name	Ncr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801859 GeneID:17086 MGI:1336212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natural cytotoxicity triggering receptor 1 transcript_id : NM_010746.3

name	Gp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379307 GeneID:243816 MGI:1889810
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : glycoprotein 6 (platelet) transcript_id : XM_145298.6

name	LOC100041851 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256103 GeneID:100041851
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs product : hypothetical protein LOC100041851 transcript_id : XM_001477660.1

name	Rdh13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52345421 GeneID:108841 MGI:1918732
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol dehydrogenase 13 (all-trans and 9-cis) transcript_id : NM_175372.3

name	Eps8l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373594 GeneID:67425 MGI:1914675
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EPS8-like 1 transcript_id : NM_026146.3

name	Ppp1r12c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384961 GeneID:232807 MGI:1924258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1, regulatory (inhibitor) subunit 12C transcript_id : NM_029834.3

name	Tnnt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755840 GeneID:21955 MGI:1333868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin T1, skeletal, slow transcript_id : NM_011618.1

name	Tnni3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373266 GeneID:21954 MGI:98783
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin I, cardiac transcript_id : NM_009406.3

name	6030429G01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802532 GeneID:436022 MGI:3588207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030429G01 gene transcript_id : NM_001033548.2

name	Syt5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560793 GeneID:53420 MGI:1926368
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin V transcript_id : NM_016908.2

name	Ptprh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:145046270 GeneID:545902 MGI:3026877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, receptor type, H transcript_id : NM_207270.2

name	Tmem86b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72535125 GeneID:68255 MGI:1915505
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 86B transcript_id : NM_023440.1

name	Saps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34536814 GeneID:243819 MGI:2442163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SAPS domain family, member 1 transcript_id : NM_172894.2

name	1500019G21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893257 GeneID:66245 MGI:1913495
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500019G21 gene transcript_id : NM_024172.3

name	Brsk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83649714 GeneID:381979 MGI:2685946
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BR serine/threonine kinase 1 transcript_id : NM_001003920.2

name	BC022651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377324 GeneID:330460 MGI:2679718
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC022651 transcript_id : NM_177887.3

name	Suv420h2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122710 GeneID:232811 MGI:2385262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of variegation 4-20 homolog 2 (Drosophila) transcript_id : NM_146177.1

name	Cox6b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34536833 GeneID:333182 MGI:3044182
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase subunit VIb polypeptide 2 transcript_id : NM_183405.1

name	Cox6b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802075 GeneID:333182 MGI:3044182
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase subunit VIb polypeptide 2 transcript_id : NM_183406.2

name	4930401F20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490385 GeneID:243822 MGI:3045311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930401F20 gene transcript_id : NM_172895.2

name	Il11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922698 GeneID:16156 MGI:107613
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 11 transcript_id : NM_008350.2

name	4930572D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379310 GeneID:78052 MGI:1925302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : RIKEN cDNA 4930572D21 gene transcript_id : XM_973679.1

name	2210411K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358926 GeneID:664968 MGI:1922935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210411K11 gene transcript_id : NM_029384.1

name	Rpl28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842372 GeneID:19943 MGI:101839
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L28 transcript_id : NM_009081.2

name	Ube2s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130890 GeneID:77891 MGI:1925141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-conjugating enzyme E2S transcript_id : NM_133777.2

name	D430041B17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801715 GeneID:232813 MGI:3605641
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D430041B17 gene transcript_id : NM_172737.2

name	Isoc2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374837 GeneID:67441 MGI:1914691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isochorismatase domain containing 2b transcript_id : NM_026158.2

name	Isoc2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379322 GeneID:664994 MGI:3609243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 10 Proteins product : isochorismatase domain containing 2a transcript_id : XM_973921.1

name	Zfp628 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25072202 GeneID:232816 MGI:2665174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 628 transcript_id : NM_170759.1

name	Nat14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41529835 GeneID:269854 MGI:3039561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase 14 transcript_id : NM_201355.2

name	A430110N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802678 GeneID:269855 MGI:3606211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430110N23 gene transcript_id : NM_173008.2

name	Gm1079 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379325 GeneID:381836 MGI:2685925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : gene model 1079, (NCBI) transcript_id : XM_355841.5

name	Gm1078 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256089 GeneID:381835 MGI:2685924
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : gene model 1078, (NCBI) transcript_id : XM_355840.6

name	Zfp579 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110832844 GeneID:68490 MGI:1915740
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 579 transcript_id : NM_026741.2

name	Fiz1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981387 GeneID:23877 MGI:1344336
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Flt3 interacting zinc finger protein 1 transcript_id : NM_011813.2

name	Zfp524 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352944 GeneID:66056 MGI:1916740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 524 transcript_id : NM_025324.2

name	6430526N21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353262 GeneID:319748 MGI:2442656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430526N21 gene transcript_id : NM_001033383.2

name	4632433K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379355 GeneID:77043 MGI:1924293
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632433K11 gene transcript_id : NM_029849.2

name	Zfp784 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299614 GeneID:654801 MGI:3606042
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 784 transcript_id : NM_001039532.1

name	Zfp580 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379332 GeneID:68992 MGI:1916242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs, 3 Proteins product : zinc finger protein 580, transcript variant 2 transcript_id : XM_900964.2

name	Ccdc106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122720 GeneID:232821 MGI:2385900
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 106 transcript_id : NM_146178.1

name	U2af2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526823 GeneID:22185 MGI:98886
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 transcript_id : NM_133671.1

name	Epn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129927 GeneID:13854 MGI:1333763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epsin 1 transcript_id : NM_010147.3

name	Rfpl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801974 GeneID:192658 MGI:2149590
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ret finger protein-like 4 transcript_id : NM_138954.2

name	Rasl2-9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145657 GeneID:19428 MGI:104605
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 2, locus 9 transcript_id : NM_009028.2

name	V1rd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82903053 GeneID:384522 MGI:3033474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins product : vomeronasal 1 receptor, D5 transcript_id : XM_357688.2

name	V1rd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507703 GeneID:81015 MGI:3033472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D3 transcript_id : NM_030740.1

name	Nlrp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821676 GeneID:232827 MGI:3041206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 2 transcript_id : NM_177690.3

name	V1rd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110431361 GeneID:81014 MGI:3033473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D4 transcript_id : NM_030739.2

name	V1rd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430545 GeneID:404284 MGI:3033479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D10 transcript_id : NM_207543.1

name	EG630071 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83006585 GeneID:630071 MGI:3645676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG630071 transcript_id : XM_895257.1

name	EG665255 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487152 GeneID:665255 MGI:3645468
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG665255 transcript_id : NM_001081405.1

name	EG636697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256098 GeneID:636697 MGI:3645244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : predicted gene, EG636697 transcript_id : XM_001476622.1

name	V1rd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507705 GeneID:81016 MGI:3033471
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D2 transcript_id : NM_030741.1

name	V1rd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507707 GeneID:81017 MGI:3033470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D1 transcript_id : NM_030742.1

name	V1rd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430540 GeneID:404285 MGI:3033480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D11 transcript_id : NM_207544.1

name	V1rd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507699 GeneID:81013 MGI:3033475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, D6 transcript_id : NM_030738.1

name	EG384525 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256134 GeneID:384525 MGI:3645266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 5 Proteins product : predicted gene, EG384525 transcript_id : XM_357690.4

name	Lair1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519937 CCDS:CCDS20729.1 GeneID:52855 MGI:105492
definition	codon_start : 1 note : leukocyte-associated Ig-like receptor 1a product : leukocyte-associated Ig-like receptor 1 protein_id : NP_848726.1

name	Ttyh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47825408 GeneID:57776 MGI:1889007
definition	codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1 product : tweety 1 isoform 1 protein_id : NP_001001454.1

name	Ttyh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543900 CCDS:CCDS20730.1 GeneID:57776 MGI:1889007
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : tweety 1 isoform 2 protein_id : NP_067299.2

name	Leng8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370082 CCDS:CCDS20731.1 GeneID:232798 MGI:2142195
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 8 protein_id : NP_766324.1

name	Leng9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425300 CCDS:CCDS20732.1 GeneID:243813 MGI:2444509
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : leukocyte receptor cluster (LRC) member 9 protein_id : NP_780738.1

name	Cdc42ep5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946838 CCDS:CCDS20733.1 GeneID:58804 MGI:1929745
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007254 - JNK cascade [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IEA]; GO:0007266 - Rho protein signal transduction [Evidence IDA] codon_start : 1 note : Cdc42 effector protein 5; CRIB-containing BORG3 protein; binder of Rho GTPase 3 product : CDC42 effector protein (Rho GTPase binding) 5 protein_id : NP_067429.1

name	EG232801 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486981 GeneID:232801 MGI:3647196
definition	codon_start : 1 note : leukocyte immunoglobulin-like receptor product : hypothetical protein LOC232801 protein_id : NP_001074708.1

name	Ncr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981638 CCDS:CCDS20734.1 GeneID:17086 MGI:1336212
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : lymphocyte antigen 94; MAR1 (mouse activating receptor 1) product : natural cytotoxicity triggering receptor 1 protein_id : NP_034876.2

name	Gp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63565023 GeneID:243816 MGI:1889810
definition	codon_start : 1 product : glycoprotein 6 (platelet) protein_id : XP_145298.4

name	LOC100041851 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256104 GeneID:100041851
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477710.1

name	Rdh13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425078 CCDS:CCDS20735.1 GeneID:108841 MGI:1918732
definition	codon_start : 1 product : retinol dehydrogenase 13 (all-trans and 9-cis) protein_id : NP_780581.1

name	Eps8l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18874094 CCDS:CCDS20736.1 GeneID:67425 MGI:1914675
definition	GO_component : GO:0001726 - ruffle [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0016601 - Rac protein signal transduction [Evidence ISS] codon_start : 1 product : epidermal growth factor receptor pathway substrate 8-like protein 1 protein_id : NP_080422.1

name	Ppp1r12c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249341 GeneID:232807 MGI:1924258
definition	codon_start : 1 note : myosin-binding subunit 85 product : protein phosphatase 1, regulatory subunit 12C protein_id : NP_084110.2

name	Tnnt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755841 GeneID:21955 MGI:1333868
definition	GO_component : GO:0005861 - troponin complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence IEA] codon_start : 1 note : skeletal muscle slow-twitch TnT product : troponin T1, skeletal, slow protein_id : NP_035748.1

name	Tnni3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678393 GeneID:21954 MGI:98783
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0030017 - sarcomere [Evidence ISS]; GO:0005861 - troponin complex [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence TAS] [Evidence IEA]; GO:0019855 - calcium channel inhibitor activity [Evidence TAS]; GO:0005515 - protein binding [Evidence IDA] [Evidence IPI] GO_process : GO:0016525 - negative regulation of angiogenesis [Evidence TAS]; GO:0008016 - regulation of heart contraction [Evidence TAS]; GO:0006937 - regulation of muscle contraction [Evidence IDA] codon_start : 1 product : troponin I, cardiac protein_id : NP_033432.1

name	6030429G01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702051 CCDS:CCDS20737.1 GeneID:436022 MGI:3588207
definition	codon_start : 1 product : hypothetical protein LOC436022 protein_id : NP_001028720.1

name	Syt5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394392 CCDS:CCDS20738.1 GeneID:53420 MGI:1926368
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0043005 - neuron projection [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : synaptotagmin IX; synaptotagmin 5 product : synaptotagmin V protein_id : NP_058604.1

name	Ptprh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:145046271 GeneID:545902 MGI:3026877
definition	codon_start : 1 product : protein tyrosine phosphatase, receptor type, H protein_id : NP_997153.2

name	Tmem86b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72535126 CCDS:CCDS20739.1 GeneID:68255 MGI:1915505
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68255 protein_id : NP_075929.1

name	Saps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34536815 GeneID:243819 MGI:2442163
definition	codon_start : 1 product : SAPS domain family, member 1 protein_id : NP_766482.2

name	1500019G21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195602 CCDS:CCDS20740.1 GeneID:66245 MGI:1913495
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hsp70-interacting protein protein_id : NP_077134.1

name	Brsk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83649715 CCDS:CCDS20741.1 GeneID:381979 MGI:2685946
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030010 - establishment of cell polarity [Evidence IGI]; GO:0000086 - G2/M transition of mitotic cell cycle [Evidence ISS]; GO:0007095 - mitotic G2 checkpoint [Evidence ISS]; GO:0030182 - neuron differentiation [Evidence IGI]; GO:0018105 - peptidyl-serine phosphorylation [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0009411 - response to UV [Evidence ISS] codon_start : 1 product : serine/threonine kinase SADB protein_id : NP_001003920.2

name	BC022651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244506 CCDS:CCDS20742.1 GeneID:330460 MGI:2679718
definition	codon_start : 1 product : hypothetical protein LOC330460 protein_id : NP_808555.1

name	Suv420h2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122711 CCDS:CCDS20743.1 GeneID:232811 MGI:2385262
definition	GO_component : GO:0000780 - condensed nuclear chromosome, pericentric region [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0042799 - histone lysine N-methyltransferase activity (H4-K20 specific) [Evidence IDA] GO_process : GO:0016571 - histone methylation [Evidence IDA] codon_start : 1 product : suppressor of variegation 4-20 homolog 2 protein_id : NP_666289.1

name	Cox6b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34536834 GeneID:333182 MGI:3044182
definition	GO_component : GO:0030061 - mitochondrial crista [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome c oxidase subunit VIb, testis-specific isoform protein_id : NP_899664.1

name	Cox6b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34536823 GeneID:333182 MGI:3044182
definition	GO_component : GO:0030061 - mitochondrial crista [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome c oxidase subunit VIb, testis-specific isoform protein_id : NP_899665.1

name	4930401F20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490386 GeneID:243822 MGI:3045311
definition	codon_start : 1 product : hypothetical protein LOC243822 protein_id : NP_766483.2

name	Il11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680393 GeneID:16156 MGI:107613
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA]; GO:0005142 - interleukin-11 receptor binding [Evidence IEA] GO_process : GO:0030183 - B cell differentiation [Evidence ISS]; GO:0030219 - megakaryocyte differentiation [Evidence ISS]; GO:0030168 - platelet activation [Evidence ISS] codon_start : 1 product : interleukin 11 protein_id : NP_032376.1

name	4930572D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379311 GeneID:78052 MGI:1925302
definition	codon_start : 1 product : hypothetical protein LOC78052 protein_id : XP_978773.1

name	2210411K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358927 GeneID:664968 MGI:1922935
definition	codon_start : 1 product : hypothetical protein LOC664968 protein_id : NP_083660.1

name	Rpl28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677779 GeneID:19943 MGI:101839
definition	GO_component : GO:0005842 - cytosolic large ribosomal subunit (sensu Eukaryota) [Evidence ISS]; GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence ISS]; GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L28 protein_id : NP_033107.1

name	Ube2s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527004 GeneID:77891 MGI:1925141
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin-conjugating enzyme E2S protein_id : NP_598538.1

name	D430041B17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370076 CCDS:CCDS20747.1 GeneID:232813 MGI:3605641
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC232813 protein_id : NP_766325.1

name	Isoc2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385662 CCDS:CCDS20748.1 GeneID:67441 MGI:1914691
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : isochorismatase domain containing 2 protein_id : NP_080434.1

name	Isoc2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379323 GeneID:664994 MGI:3609243
definition	codon_start : 1 product : similar to Isochorismatase domain-containing protein 2A, mitochondrial protein_id : XP_979015.1

name	Zfp628 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25072203 GeneID:232816 MGI:2665174
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein Zec product : zinc finger protein ZFP protein_id : NP_739565.1

name	Nat14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235736 CCDS:CCDS20749.1 GeneID:269854 MGI:3039561
definition	GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IEA] codon_start : 1 product : N-acetyltransferase 14 protein_id : NP_958743.1

name	A430110N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370514 CCDS:CCDS20750.1 GeneID:269855 MGI:3606211
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC269855 protein_id : NP_766596.1

name	Gm1079 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379326 GeneID:381836 MGI:2685925
definition	codon_start : 1 product : similar to Putative uncharacterized serine/threonine-protein kinase SgK069 (Sugen kinase 69) protein_id : XP_355841.4

name	Gm1078 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256090 GeneID:381835 MGI:2685924
definition	codon_start : 1 product : similar to Putative uncharacterized serine/threonine-protein kinase SgK110 (Sugen kinase 110) protein_id : XP_355840.4

name	Zfp579 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66955864 GeneID:68490 MGI:1915740
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 579 protein_id : NP_081017.1

name	Fiz1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981388 CCDS:CCDS20751.1 GeneID:23877 MGI:1344336
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0019901 - protein kinase binding [Evidence IDA] [Evidence IPI]; GO:0005102 - receptor binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Flt3 interacting zinc finger protein 1 protein_id : NP_035943.2

name	Zfp524 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384694 CCDS:CCDS20752.1 GeneID:66056 MGI:1916740
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 524 protein_id : NP_079600.1

name	6430526N21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677466 CCDS:CCDS20753.1 GeneID:319748 MGI:2442656
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC319748 protein_id : NP_001028555.1

name	4632433K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313332 GeneID:77043 MGI:1924293
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC77043 protein_id : NP_084125.1

name	Zfp784 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299615 CCDS:CCDS20755.1 GeneID:654801 MGI:3606042
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : RIKEN cDNA C730049F21 protein_id : NP_001034621.1

name	Zfp580 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903065 GeneID:68992 MGI:1916242
definition	codon_start : 1 product : zinc finger protein 580 isoform 2 protein_id : XP_906057.1

name	Ccdc106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122721 CCDS:CCDS20757.1 GeneID:232821 MGI:2385900
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 106 protein_id : NP_666290.1

name	U2af2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526824 GeneID:22185 MGI:98886
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 65 kDa; splicing factor U2AF product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 protein_id : NP_598432.1

name	Epn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195711 CCDS:CCDS20758.1 GeneID:13854 MGI:1333763
definition	GO_function : GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : epsin 1 protein_id : NP_034277.1

name	Rfpl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20336740 CCDS:CCDS20759.1 GeneID:192658 MGI:2149590
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ret finger protein-like 4 protein_id : NP_620404.1

name	Rasl2-9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677677 CCDS:CCDS20760.1 GeneID:19428 MGI:104605
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAS-like, family 2, locus 9 protein_id : NP_033054.1

name	V1rd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903054 GeneID:384522 MGI:3033474
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD10 protein_id : XP_357688.2

name	V1rd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507704 CCDS:CCDS20761.1 GeneID:81015 MGI:3033472
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 note : pheromone receptor V3R3 product : vomeronasal 1 receptor, D3 protein_id : NP_109665.1

name	Nlrp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821677 GeneID:232827 MGI:3041206
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : NACHT, leucine rich repeat and PYD containing 2 protein_id : NP_808358.2

name	V1rd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110431362 GeneID:81014 MGI:3033473
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R4 product : vomeronasal 1 receptor, D4 protein_id : NP_109664.2

name	V1rd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430546 CCDS:CCDS20763.1 GeneID:404284 MGI:3033479
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D10 protein_id : NP_997426.1

name	EG630071 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83006586 GeneID:630071 MGI:3645676
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 protein_id : XP_900350.1

name	EG665255 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487153 GeneID:665255 MGI:3645468
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 product : predicted gene, EG665255 protein_id : NP_001074874.1

name	EG636697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256099 GeneID:636697 MGI:3645244
definition	codon_start : 1 product : similar to vomeronasal receptor V1RD8 protein_id : XP_001476672.1

name	V1rd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507706 GeneID:81016 MGI:3033471
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : pheromone receptor V3R2 product : vomeronasal 1 receptor, D2 protein_id : NP_109666.1

name	V1rd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507708 CCDS:CCDS20765.1 GeneID:81017 MGI:3033470
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R1 product : vomeronasal 1 receptor, D1 protein_id : NP_109667.1

name	V1rd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430541 CCDS:CCDS20766.1 GeneID:404285 MGI:3033480
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, D11 protein_id : NP_997427.1

name	V1rd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507700 CCDS:CCDS20767.1 GeneID:81013 MGI:3033475
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : pheromone receptor V3R6 product : vomeronasal 1 receptor, D6 protein_id : NP_109663.1

name	EG384525 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38085727 GeneID:384525 MGI:3645266
definition	codon_start : 1 product : similar to ribosomal protein protein_id : XP_357690.1

name	LOC384521 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384521
definition	number : 1 pseudo : _no_value

name	LOC669557 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669557
definition	number : 1 pseudo : _no_value

name	LOC384524 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384524
definition	number : 1 pseudo : _no_value

name	LOC665049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665049
definition	number : 3 pseudo : _no_value

name	LOC665049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665049
definition	number : 2 pseudo : _no_value

name	LOC665049 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665049
definition	number : 1 pseudo : _no_value

name	EG665163 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665163
definition	number : 1 pseudo : _no_value

name	EG636705 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:636705
definition	number : 1 pseudo : _no_value

name	LOC673215 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673215
definition	number : 1 pseudo : _no_value

name	LOC100041627 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041627
definition	number : 2 pseudo : _no_value

name	LOC100041627 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041627
definition	number : 1 pseudo : _no_value

name	LOC100041637 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041637
definition	number : 1 pseudo : _no_value

name	LOC100041647 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041647
definition	number : 1 pseudo : _no_value

name	LOC100041666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041666
definition	number : 2 pseudo : _no_value

name	LOC100041666 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041666
definition	number : 1 pseudo : _no_value

name	EG269859 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:269859
definition	number : 1 pseudo : _no_value

name	EG628211 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256109 GeneID:628211 MGI:3648447
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 68 ESTs, 10 Proteins product : predicted gene, EG628211 pseudo : _no_value transcript_id : XR_001735.2

name	EG665126 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256094 GeneID:665126 MGI:3643242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1239 ESTs, 28 Proteins product : predicted gene, EG665126 pseudo : _no_value transcript_id : XR_001694.2

name	EG665150 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256095 GeneID:665150 MGI:3646165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins product : predicted gene, EG665150 pseudo : _no_value transcript_id : XR_032817.1

name	EG272350 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256073 GeneID:272350 MGI:3643170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG272350 pseudo : _no_value transcript_id : XR_035152.1

name	LOC636731 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256100 GeneID:636731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 29 Proteins product : similar to vomeronasal receptor V1RD8 pseudo : _no_value transcript_id : XR_032865.1

clone name	MSMg01-383O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211J23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-151C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-398A09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-358J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-543N20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298H11
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-217D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236A17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305H13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-261N22.b	B6Ng01-261N22.g
ACC	GA066433	GA066434
length	862	1,214
definition	B6Ng01-261N22.b	B6Ng01-261N22.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctacatcttgttccaaagacagctaggagaatacttgtttccagg cagctaggacaaggtcttaaagcccacacccacagtgatacacccacttt aacaaggccacacctcctttaacagagaaacatatcaggacatgatatgt ctgactttgagagggagagaggtggtggttgggacaagtgaggacattag aggggttagactgatgtctggtagactttatcatgaccatgtcccagcta ggtggcagggtgtctcctctgtgttgtggggaatcagatccagagctttg gggatgctaagccacccggcagtagcttttttaaaagttattttatgtat attggtgtttctgcctactcggatgtttgtagacatgtatgcctgttaca ggagacagaagatggtgtgggctcccctggaattggatttataaatggtt gttaagctgggtgctgggaatggaacctggggcttttactagagcagcca gtgctcttaactgctgaagcatggctccagctccatccagaagtatcttt tcagggagaggtgggatttactatctgatcaaatttactcattcactaac tgatattttgttttgtgtctctgccctcttctttggcttaggttttgaaa attcattttatttatgtgtgatcgtgtacatgcatgtggcagtcagaagg caactttctagagttggttcttttcttccaccacgtggtcatctgggttt gaactcctttgcccttgtagaggacctgggtttgacttatagcacccaca aggtggttcacaatcactctaactccagttctaaggagaatccgattgct gtctcctgacct	gaattcaatgatttagaaacaaagaaagtgactgaaagaatcaacaaatc caagaggtggttctttgaggaaatcaccaagatagacaagcccttagtcg aagtaagtaaaaggctgaaagacaatatacaaataagaagagtcagaaat gaaaagggagacataacaacggataaggagaaaatccaaataatcatttg gtcttattttaaaagcatgtatttcacaatattggaagaaaatctaagtg aaatggatagtattcctgacgactacacttatcagttgaatgaggatcag gtaaataaacttaaaagtcctataaccactaaagaattagaagcaatcat caaaagtttcaagaaaaataaaagcccagagccagatggctttaggcaga actaaattgtcctttaaagaagagctaataacaatactcctcacattatc ccacaaaattgaaacagaagcaacattgccaaactcattcaacaaggcca gagtcaccctgatatctaaaccacacaaagaccaaaaaagaaatacaatt tcagaccaatttcttgtatgaacacagatgcaaaaatactcaataaaata ctcacaaaacaagtccaagaatgcatcaaagacatcatccaccacgatca agtaggcttcatcttttagatgcagagatggctcaatatatataaattca ccaatgtaatccccatataaacaaactgaaagaaaaatattcacagaata atctcataagatggtgagaatgtctttgacaaaattgaacacccctttat gttaaaagttttagagagttcagaaatacaaggcacgtaccccaaagaat aaaaacaataataaaaacaatatgcagaaagccgataaccaaagcaaatt taatggggagaaaaatcaaagcaataactctaaaatcaggaaaagcaagg ctgcccacttcttttcctttctactcaatacagtacttggaggtcctaac taggagcaaaaagagaacaaaaaggaaatcaatggaataacaaattggga aaaggaagaaggtcaaggtattcacattcattagatgactgataggtata aaatataggcgaccctataacttatatatttagaattcctaacggcaaat ggataaacagcaaggtgactggaataggaaaaggtatctctaaggatata ggtgagggtccttc
quality values	Open. Hide. 58 31 35 38 62 62 62 54 56 33 54 62 62 62 62 62 62 62 37 23 49 62 62 47 56 47 62 62 59 62 62 62 59 35 35 56 62 62 46 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 54 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 51 62 59 49 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 37 59 62 59 59 62 59 59 56 56 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 44 56 44 47 56 51 54 62 56 56 51 56 54 56 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 56 62 51 56 56 62 62 54 31 62 62 37 43 56 62 62 56 62 56 62 56 62 62 49 62 47 39 56 62 62 28 31 62 54 47 56 47 56 40 47 27 56 54 56 62 47 47 62 62 62 62 62 42 56 56 56 37 56 62 39 42 52 52 54 42 54 62 47 42 62 54 54 52 62 62 62 62 62 62 42 52 52 38 62 31 52 47 52 46 42 62 52 54 33 54 42 47 52 45 39 52 54 41 39 46 10 47 33 37 54 54 58 16 41 35 58 48 38 52 41 45 30 58 52 23 34 49 54 45 32 54 54 42 54 47 54 42 40 34 42 39 52 54 58 54 41 52 47 49 58 49 42 52 35 58 49 54 37 33 42 42 39 25 23 30 12 33 24 22 15 32 52 8 25 20 16 27 28 54 46 45 42 32 42 34 48 15 19 43 24 21 15 22 24 12 30 16 45 51 30 34 17 30 18 28 41 46 24 21 17 25 34 18 26 10 19 33 35 32 50 12 12 33 32 27 50 6 10 50 39 50 13 46 49 32 53 58 54 50 51 49 22 29 34 34 13 24 28 17 37 39 38 15 22 34 32 32 31 40 21 28 15 13 17 23 9 22 16 11 30 32 33 30 25 23 8 20 11 28 28 17 13 9 8 10 14 16 10 14 26 26 24 14 8 17 39 31 50 35 39 34 12 28 19 9 14 17 27 17 29 7 18 17 13 17 19 15 15 54 28 13 14 16 17 40 23 32 38 17 32 30 19 44 11 40 24	Open. Hide. 62 44 49 47 62 44 47 62 62 62 47 44 45 28 24 25 38 34 50 59 59 59 62 62 62 62 62 62 62 62 59 59 62 62 54 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 42 49 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 58 58 58 58 58 58 58 54 58 58 54 45 58 58 58 54 49 54 58 58 58 58 54 58 58 58 46 54 58 58 58 58 58 58 58 58 54 54 58 58 58 49 36 41 58 58 58 54 58 58 58 58 58 58 58 58 58 42 54 58 58 58 52 58 58 58 58 58 58 58 58 53 51 54 58 58 54 54 50 58 41 54 58 58 58 58 50 58 58 58 58 58 52 58 58 54 50 58 54 51 58 58 53 53 54 58 58 54 52 51 46 51 51 54 51 51 52 54 54 51 41 43 58 51 58 49 47 58 51 51 58 52 58 49 58 52 49 50 52 58 53 50 58 49 41 37 43 41 41 49 51 58 50 47 36 58 51 51 43 28 51 50 58 51 50 39 53 53 54 58 58 38 41 41 54 49 54 49 31 41 54 40 39 39 49 58 30 54 47 41 52 54 52 52 52 53 53 53 53 54 49 49 49 49 38 51 50 37 51 38 54 42 50 49 52 53 51 54 54 37 53 53 53 39 54 39 47 31 54 40 35 37 51 42 54 47 37 42 54 49 49 35 40 40 33 53 45 37 49 40 33 36 49 42 37 46 52 53 47 42 40 38 42 46 37 53 31 47 47 32 42 32 28 33 33 31 53 30 34 34 49 31 37 28 21 24 49 49 32 32 53 47 34 34 34 31 32 40 33 32 47 51 33 32 32 51 46 23 33 51 46 46 32 42 51 51 37 31 31 51 30 46 30 51 45 35 31 13 46 51 31 35 30 27 21 24 22 46 30 26 32 35 31 26 26 40 29 11 14 42 46 31 41 36 37 21 46 41 46 24 25 13 22 23 16 36 42 31 46 41 41 26 31 22 20 42 28 31 31 29 29 29 44 46 32 43 24 33 30 25 19 30 20 20 22 11 37 12 23 29 16 36 29 31 46 32 18 16 19 29 48 46 36 31 9 5 46 46 48 26 27 32 28 47 26 25 37 22 18 31 17 21 26 29 31 18 10 48 43 17 22 30 9 25 16 38 48 48 33 33 31 12 12 24 27 27 27 21 21 41 22 20 31 20 6 8 14 47 36 24 15 15 7 47 22 20 11 21 21 24 27 19 14 15 25 28 23 10 9 25 19 28 14 15 10 43 6 10 21 18 18 23 15 23 34 32 17 9 9 29 23 32 21 43 47 43 19 8 23 24 11 19 4 7 28 30 28 19 17 13 21 47 21 28 22 10 15 16 16 15 3 5 9 7 6 6 7 28 20 10 25 8 27 15 22 33 38 28 13 7 38 20 13 24 33 7 7 23 8 20 29 7 12 11 15 20 9 9 7 6 3 6 17 9 6 9 9 8 7 9 7 9 15 8 4 8 9 6 6 5 8 4 12 10 9 28 27 7 11 4 3 3 4 4 7 10 21 11 25 16 6 4 5 9 5 1 4 7 12 10 9 16 6 4 11 12 16 13 16 15 4 16 14 5 6 4 4 4 4 7 1 1 1 3 6 4 3 6 4 4 18 10 16 6 7 5 16 16 4 4 4 2 1 3 4 12 25 7 6 5 5 6 6 14 28 27 5 4 12 13 14 7 11 7 16 4 5 2 4 5 5 1 2 6 15 5 14 7 6 4 4 4 4 6 4 3 2 1 2

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_5000737_5001766
seq2: B6Ng01-261N22.b_47_904

seq1  GAATTCTACATCTTGTTCCAAAGACAGCTAGGAGAATACTTGTTTCCAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACATCTTGTTCCAAAGACAGCTAGGAGAATACTTGTTTCCAGG  50

seq1  CAGCTAGGACAAGGTCTTAAAGCCCACACCCACAGTGATACACCCACTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTAGGACAAGGTCTTAAAGCCCACACCCACAGTGATACACCCACTTT  100

seq1  AACAAGGCCACACCTCCTTTAACAGAGAAACATATCAGGACATGATATGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAAGGCCACACCTCCTTTAACAGAGAAACATATCAGGACATGATATGT  150

seq1  CTGACTTTGAGAGGGAGAGAGGTGGTGGTTGGGACAAGTGAGGACATTAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACTTTGAGAGGGAGAGAGGTGGTGGTTGGGACAAGTGAGGACATTAG  200

seq1  AGGGGTTAGACTGATGTCTGGTAGACTTTATCATGACCATGTCCCAGCTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGTTAGACTGATGTCTGGTAGACTTTATCATGACCATGTCCCAGCTA  250

seq1  GGTGGCAGGGTGTCTCCTCTGTGTTGTGGGGAATCAGATCCAGAGCTTTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGCAGGGTGTCTCCTCTGTGTTGTGGGGAATCAGATCCAGAGCTTTG  300

seq1  GGGATGCTAAGCCACCCGGCAGTAGCTTTTTTAAAAGTTATTTTATGTAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGATGCTAAGCCACCCGGCAGTAGCTTTTTTAAAAGTTATTTTATGTAT  350

seq1  ATTGGTGTTTCTGCCTACTCGGATGTTTGTAGACATGTATGCCTGTTACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGGTGTTTCTGCCTACTCGGATGTTTGTAGACATGTATGCCTGTTACA  400

seq1  GGAGACAGAAGATGGTGTGGGCTCCCCTGGAATTGGATTTATAAATGGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGACAGAAGATGGTGTGGGCTCCCCTGGAATTGGATTTATAAATGGTT  450

seq1  GTTAAGCTGGGTGCTGGGAATGGAACCTGGGGCTTTTACTAGAGCAGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAGCTGGGTGCTGGGAATGGAACCTGGGGCTTTTACTAGAGCAGCCA  500

seq1  GTGCTCTTAACTGCTGAAGCATGGCTCCAGCTCCATCCAGAAGTATCTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTCTTAACTGCTGAAGCATGGCTCCAGCTCCATCCAGAAGTATCTTT  550

seq1  TCAGGGAGAGGTGGGATTTACTATCTGATCAAATTTACTCATTCACTAAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGGAGAGGTGGGATTTACTATCTGATCAAATTTACTCATTCACTAAC  600

seq1  TGATATTTTGTTTTGTGTCTCTGCCCTCTTC-TTGGCTTAGGTTTTG-AA  648
      ||||||||||||||||||||||||||||||| ||||||||||||||| ||
seq2  TGATATTTTGTTTTGTGTCTCTGCCCTCTTCTTTGGCTTAGGTTTTGAAA  650

seq1  ATTCA-TTTATTTATGTGTGATCGTGTACATGCATGTGGCAGTCAGAAGG  697
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCATTTTATTTATGTGTGATCGTGTACATGCATGTGGCAGTCAGAAGG  700

seq1  CAACTTTCTAGAGTTGGTTCTTTTCTTCCACCACGTGGTCATCTGGGTTT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTTTCTAGAGTTGGTTCTTTTCTTCCACCACGTGGTCATCTGGGTTT  750

seq1  GAACTCCTTTGCCCTTGTAGAGGACCTGGGTTTGACTTATAGCACCCACA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCCTTTGCCCTTGTAGAGGACCTGGGTTTGACTTATAGCACCCACA  800

seq1  AGGTGGTTCACAAACACTCTAACTCCAGTTCTA--GGGAATCCGATTGCT  845
      ||||||||||||| |||||||||||||||||||  | |||||||||||||
seq2  AGGTGGTTCACAATCACTCTAACTCCAGTTCTAAGGAGAATCCGATTGCT  850

seq1  GTCTTCTGACCTCCAAGGACACCAAGTACACATGTGTATATGCCTACAGG  895
      |||| |||                                          
seq2  GTCTCCTG------------------------------------------  858

seq1  CCACCAAAACACTTACATACATTTTTTTTTAAAGGAGAGAGAGAATTCAA  945
                                                        
seq2  --------------------------------------------------  858

seq1  GGTTATCTTAGGCTGCATAGTCAGGCTAGGCTTCTTGAGATCATGTCTCA  995
                                                        
seq2  --------------------------------------------------  858

seq1  AGAAATAAAAATACAGTTTATATAGCTGTCTCCTG  1030
                                         
seq2  -----------------------------------  858

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information