MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-284O01
Chromosome	7 (Build37)
Map Location	51,370,118 - 51,508,957
singlet/doublet	doublet
Overlap gene	Klk1b22, Klk1b16, Klk1b24, Klk1b3, Klk1b4, Klk1b5, Klk1, 1700028J19Rik, LOC668661, Acpt
Upstream gene	LOC100039589, EG668620, Zfp715, Siglecf, Siglecg, LOC100039610, Lim2, Nkg7, Cldnd2, Etfb, 2210412E05Rik, A230106M20Rik, 4931406B18Rik, LOC668630, LOC100039946, Cd33, BC043301, Zfp719, 4933405K07Rik, Ceacam18, Siglece, Atpbd3, Klk14, Klk13, Klk12, Klk11, Klk10, Klk9, Klk8, Klk7, Klk6, Klk5, Klk4, Klk2-ps, Klk15, Klk1b7-ps, Klk1b8, Klk1b1, Klk1b9, Klk1b10-ps, Klk1b11, LOC100039713, Klk1b26, Klk1b18-ps, Klk1b27, Klk1b14-ps, Klk1b15-ps, Klk1b21
Downstream gene	LOC628854, EG638453, Clec11a, Shank1, 1700008O03Rik, Syt3, Lrrc4b, 0610012D14Rik, Josd2, 2310044H10Rik, 1700021P22Rik, Mybpc2, Spib, Pold1, Nr1h2, Napsa, Kcnc3, Myh14, 1700023D19Rik, Zfp473, Vrk3, EG628904, Atf5, Nup62, Il4i1, Tbc1d17, Akt1s1, Pnkp, Ptov1, Med25, Fuz, Ap2a1, Stk22s1, Cpt1c, Prmt1, Bcl2l12, Irf3, AI480556, Rras, Prr12, Prrg2, Nosip, Rcn3, Fcgrt, Rps11, Rnu35b, Rpl13a, Rnu35a, Rnu34, Rnu33, Rnu32, Flt3l, Aldh16a1, Pih1d1, Slc17a7, Gm581, LOC100039953, Tifp39, BC050196, Dkkl1, Tead2, Cd37
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039589 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG668620 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668620 MGI:3643075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp715 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69930 MGI:1917180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglecf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233186 MGI:2681107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglecg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243958 MGI:2443630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039610 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Lim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233187 MGI:104698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nkg7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72310 MGI:1931250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldnd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74276 MGI:1921526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Etfb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110826 MGI:106098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210412E05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75690 MGI:1922940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs

name	A230106M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210094 MGI:2686277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 8 Proteins

name	4931406B18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74054 MGI:1921304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668630 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cd33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12489 MGI:99440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC043301 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210104 MGI:2652821
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp719 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210105 MGI:2444708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 57 ESTs

name	4933405K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74400 MGI:1921650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72431 MGI:1919681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Siglece (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83382 MGI:1932475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atpbd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233189 MGI:2385277
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:317653 MGI:2447564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626834 MGI:3615275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69511 MGI:1916761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 29 Proteins

name	Klk11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56538 MGI:1929977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69540 MGI:1916790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101533 MGI:1921082
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259277 MGI:1343327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23993 MGI:1346336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19144 MGI:1343166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68668 MGI:1915918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56640 MGI:1861379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk2-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16603 MGI:892028
definition	gene_synonym : Gk25; Klk-ps10; mGk-25 note : kallikrein-related peptidase 2, pseudogene pseudo : _no_value

name	Klk15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:317652 MGI:2447533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16604 MGI:892027
definition	gene_synonym : Klk-ps2; mGK-7 note : kallikrein 1-related peptidase b7, pseudogene pseudo : _no_value

name	Klk1b8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16624 MGI:892018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16623 MGI:892019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13648 MGI:95293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b10-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16605 MGI:892026
definition	gene_synonym : Klk-ps3; mGk-10 note : kallikrein 1-related peptidase b10, pseudogene pseudo : _no_value

name	Klk1b11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16613 MGI:892023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039713 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039713
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Klk1b26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16618 MGI:891981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b18-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16609 MGI:892024
definition	gene_synonym : Klk-ps7; mGK-18 note : kallikrein 1-related peptidase b18, pseudogene pseudo : _no_value

name	Klk1b27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16619 MGI:891980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b14-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16614 MGI:891983
definition	gene_synonym : Klk-ps11; Klk14; mGk-14 note : kallikrein 1-related peptidase b14, pseudogene pseudo : _no_value

name	Klk1b15-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16607 MGI:891987
definition	gene_synonym : Gk15; Klk-ps5; mGK-15 note : kallikrein 1-related peptidase b15, pseudogene pseudo : _no_value

name	Klk1b21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16616 MGI:892022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13646 MGI:95291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16615 MGI:891982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16617 MGI:892021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18050 MGI:97322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18048 MGI:97320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1b5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16622 MGI:892020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16612 MGI:102850
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700028J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70004 MGI:1917254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC668661 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Acpt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546967 MGI:3644563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC628854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	EG638453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638453 MGI:3647237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Clec11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20256 MGI:1298219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shank1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243961 MGI:3613677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins

name	1700008O03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69349 MGI:1916599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Syt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20981 MGI:99665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272381 MGI:3027390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	0610012D14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68352 MGI:1915602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Josd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66124 MGI:1913374
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310044H10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69683 MGI:1916933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75538 MGI:1922788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 9 ESTs, 4 Proteins

name	Mybpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233199 MGI:1336170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spib (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272382 MGI:892986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pold1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18971 MGI:97741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr1h2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22260 MGI:1352463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Napsa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16541 MGI:109365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16504 MGI:96669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myh14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71960 MGI:1919210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700023D19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75510 MGI:1922760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Zfp473 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243963 MGI:2442697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vrk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101568 MGI:2182465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628904 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628904 MGI:3645141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Atf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107503 MGI:2141857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18226 MGI:1351500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il4i1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14204 MGI:109552
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233204 MGI:2449973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akt1s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67605 MGI:1914855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnkp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59047 MGI:1891698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptov1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84113 MGI:1933946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75613 MGI:1922863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fuz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70300 MGI:1917550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 ESTs, 1 Protein

name	Ap2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11771 MGI:101921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stk22s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22116 MGI:1347560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cpt1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78070 MGI:2446526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15469 MGI:107846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl2l12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75736 MGI:1922986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54131 MGI:1859179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI480556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233208 MGI:2141980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rras (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20130 MGI:98179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prr12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233210 MGI:2679002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 82 ESTs, 3 Proteins

name	Prrg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65116 MGI:1929596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nosip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66394 MGI:1913644
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rcn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52377 MGI:1277122
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcgrt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14132 MGI:103017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27207 MGI:1351329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu35b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27212 MGI:1351321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22121 MGI:1351455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu35a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27211 MGI:1351319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27210 MGI:1351325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27208 MGI:1351323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27209 MGI:1351324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flt3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14256 MGI:95560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldh16a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69748 MGI:1916998
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pih1d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68845 MGI:1916095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc17a7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72961 MGI:1920211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm581 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210541 MGI:2685427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100039953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tifp39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114640 MGI:2152297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC050196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384619 MGI:2687329
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dkkl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50722 MGI:1354963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tead2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21677 MGI:104904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12493 MGI:88330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668620 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257184 GeneID:668620 MGI:3643075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668620 transcript_id : XM_001002654.2

name	Zfp715 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123173817 GeneID:69930 MGI:1917180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 715 transcript_id : NM_027264.3

name	Siglecf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704167 GeneID:233186 MGI:2681107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin F transcript_id : NM_145581.1

name	Siglecg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345055 GeneID:243958 MGI:2443630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin G transcript_id : NM_172900.2

name	LOC100039610 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257240 GeneID:100039610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039610 transcript_id : XM_001473186.1

name	Lim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370624 GeneID:233187 MGI:104698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lens intrinsic membrane protein 2 transcript_id : NM_177693.3

name	Nkg7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892532 GeneID:72310 MGI:1931250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natural killer cell group 7 sequence transcript_id : NM_024253.4

name	Cldnd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508801 GeneID:74276 MGI:1921526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin domain containing 2 transcript_id : NM_028849.1

name	Etfb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38142459 GeneID:110826 MGI:106098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : electron transferring flavoprotein, beta polypeptide transcript_id : NM_026695.2

name	2210412E05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257243 GeneID:75690 MGI:1922940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs product : RIKEN cDNA 2210412E05 gene transcript_id : XM_355890.5

name	A230106M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380396 GeneID:210094 MGI:2686277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 8 Proteins product : RIKEN cDNA A230106M20 gene transcript_id : XM_357746.5

name	4931406B18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386082 GeneID:74054 MGI:1921304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931406B18 gene transcript_id : NM_028737.3

name	LOC100039946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257254 GeneID:100039946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039946 transcript_id : XM_001473291.1

name	Cd33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946589 GeneID:12489 MGI:99440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD33 antigen transcript_id : NM_021293.1

name	BC043301 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711287 GeneID:210104 MGI:2652821
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC043301 transcript_id : NM_001008549.1

name	Zfp719 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380432 GeneID:210105 MGI:2444708
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 57 ESTs product : zinc finger protein 719, transcript variant 1 transcript_id : XM_145574.6

name	4933405K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354247 GeneID:74400 MGI:1921650
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933405K07 gene transcript_id : NM_028913.2

name	Ceacam18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037298 GeneID:72431 MGI:1919681
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_028236.1

name	Siglece (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032001 GeneID:83382 MGI:1932475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sialic acid binding Ig-like lectin E transcript_id : NM_031181.2

name	Atpbd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704169 GeneID:233189 MGI:2385277
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP binding domain 3 transcript_id : NM_145582.1

name	Klk14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469048 GeneID:317653 MGI:2447564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 14 transcript_id : NM_174866.1

name	Klk13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681721 GeneID:626834 MGI:3615275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 13 transcript_id : NM_001039042.2

name	Klk12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380399 GeneID:69511 MGI:1916761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 29 Proteins product : kallikrein related-peptidase 12 transcript_id : XM_893506.2

name	Klk11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910297 GeneID:56538 MGI:1929977
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 11 transcript_id : NM_019974.1

name	Klk10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130936 GeneID:69540 MGI:1916790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 10 transcript_id : NM_133712.2

name	Klk9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801918 GeneID:101533 MGI:1921082
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 9 transcript_id : NM_028660.2

name	Klk8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893243 GeneID:259277 MGI:1343327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 8 transcript_id : NM_008940.2

name	Klk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981356 GeneID:23993 MGI:1346336
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 7 (chymotryptic, stratum corneum) transcript_id : NM_011872.2

name	Klk6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755179 GeneID:19144 MGI:1343166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 6 transcript_id : NM_011177.1

name	Klk5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801926 GeneID:68668 MGI:1915918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 5 transcript_id : NM_026806.2

name	Klk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910515 GeneID:56640 MGI:1861379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 4 (prostase, enamel matrix, prostate) transcript_id : NM_019928.1

name	Klk15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469044 GeneID:317652 MGI:2447533
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein related-peptidase 15 transcript_id : NM_174865.1

name	Klk1b8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130782 GeneID:16624 MGI:892018
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b8 transcript_id : NM_008457.2

name	Klk1b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981660 GeneID:16623 MGI:892019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b1 transcript_id : NM_010645.2

name	Klk1b9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426850 GeneID:13648 MGI:95293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b9 transcript_id : NM_010116.1

name	Klk1b11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28875779 GeneID:16613 MGI:892023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b11 transcript_id : NM_010640.1

name	Klk1b26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754459 GeneID:16618 MGI:891981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related petidase b26 transcript_id : NM_010644.1

name	Klk1b27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802581 GeneID:16619 MGI:891980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b27 transcript_id : NM_020268.2

name	Klk1b21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956055 GeneID:16616 MGI:892022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b21 transcript_id : NM_010642.1

name	Klk1b22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52693912 GeneID:13646 MGI:95291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b22 transcript_id : NM_010114.1

name	Klk1b16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130791 GeneID:16615 MGI:891982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b16 transcript_id : NM_008454.2

name	Klk1b24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393674 GeneID:16617 MGI:892021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b24 transcript_id : NM_010643.1

name	Klk1b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52851402 GeneID:18050 MGI:97322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b3 transcript_id : NM_008693.1

name	Klk1b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803584 GeneID:18048 MGI:97320
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related pepidase b4 transcript_id : NM_010915.2

name	Klk1b5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130796 GeneID:16622 MGI:892020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1-related peptidase b5 transcript_id : NM_008456.2

name	Klk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357330 GeneID:16612 MGI:102850
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kallikrein 1 transcript_id : NM_010639.6

name	1700028J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380412 GeneID:70004 MGI:1917254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 1700028J19 gene, transcript variant 2 transcript_id : XM_901377.2

name	LOC668661 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257250 GeneID:668661
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical LOC668661 transcript_id : XM_001002944.2

name	Acpt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82905959 GeneID:546967 MGI:3644563
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : acid phosphatase, testicular transcript_id : XM_621786.2

name	LOC628854 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257270 GeneID:628854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC628854 transcript_id : XM_900959.3

name	Clec11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388718 GeneID:20256 MGI:1298219
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 11, member a transcript_id : NM_009131.2

name	Shank1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257271 GeneID:243961 MGI:3613677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 2 Proteins product : SH3/ankyrin domain gene 1 transcript_id : XM_001473991.1

name	1700008O03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257251 GeneID:69349 MGI:1916599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700008O03 gene, transcript variant 1 transcript_id : XM_133454.7

name	Syt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560476 GeneID:20981 MGI:99665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin III transcript_id : NM_016663.2

name	Lrrc4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38016189 GeneID:272381 MGI:3027390
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 4B transcript_id : NM_198250.1

name	0610012D14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312001 GeneID:68352 MGI:1915602
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610012D14 gene transcript_id : NM_026690.1

name	Josd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803436 GeneID:66124 MGI:1913374
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Josephin domain containing 2 transcript_id : NM_025368.2

name	2310044H10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574073 GeneID:69683 MGI:1916933
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310044H10 gene transcript_id : NM_197991.1

name	1700021P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257279 GeneID:75538 MGI:1922788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 4 Proteins product : RIKEN cDNA 1700021P22 gene, transcript variant 6 transcript_id : XM_901475.3

name	Mybpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347841 GeneID:233199 MGI:1336170
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein C, fast-type transcript_id : NM_178067.3

name	Mybpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122730 GeneID:233199 MGI:1336170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin binding protein C, fast-type transcript_id : NM_146189.1

name	Spib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61969657 GeneID:272382 MGI:892986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Spi-B transcription factor (Spi-1/PU.1 related) transcript_id : NM_019866.1

name	Pold1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981550 GeneID:18971 MGI:97741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA directed), delta 1, catalytic subunit transcript_id : NM_011131.2

name	Nr1h2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130379 GeneID:22260 MGI:1352463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 1, group H, member 2 transcript_id : NM_009473.2

name	Napsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680551 GeneID:16541 MGI:109365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : napsin A aspartic peptidase transcript_id : NM_008437.1

name	Kcnc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778991 GeneID:16504 MGI:96669
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage gated channel, Shaw-related subfamily, member 3 transcript_id : NM_008422.2

name	Myh14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130423 GeneID:71960 MGI:1919210
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, heavy polypeptide 14 transcript_id : NM_028021.2

name	1700023D19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380460 GeneID:75510 MGI:1922760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 1700023D19 gene, transcript variant 1 transcript_id : XM_620490.3

name	Zfp473 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922647 GeneID:243963 MGI:2442697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 473 transcript_id : NM_178734.3

name	Vrk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527165 GeneID:101568 MGI:2182465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vaccinia related kinase 3 transcript_id : NM_133945.1

name	EG628904 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380423 GeneID:628904 MGI:3645141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG628904 transcript_id : XM_914602.2

name	Atf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507623 GeneID:107503 MGI:2141857
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : activating transcription factor 5 transcript_id : NM_030693.1

name	Nup62 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716348 GeneID:18226 MGI:1351500
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 62 transcript_id : NM_053074.1

name	Il4i1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802587 GeneID:14204 MGI:109552
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 4 induced 1 transcript_id : NM_010215.2

name	Tbc1d17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111120336 GeneID:233204 MGI:2449973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 17 transcript_id : NM_001042655.1

name	Akt1s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374622 GeneID:67605 MGI:1914855
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AKT1 substrate 1 (proline-rich) transcript_id : NM_026270.2

name	Pnkp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118601008 GeneID:59047 MGI:1891698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polynucleotide kinase 3'- phosphatase transcript_id : NM_021549.2

name	Ptov1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20149317 GeneID:84113 MGI:1933946
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostate tumor over expressed gene 1 transcript_id : NM_133949.1

name	Med25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350961 GeneID:75613 MGI:1922863
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 25 homolog (yeast) transcript_id : NM_029365.2

name	Fuz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257288 GeneID:70300 MGI:1917550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 ESTs, 1 Protein product : fuzzy homolog (Drosophila) transcript_id : XM_001474814.1

name	Ap2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256509 GeneID:11771 MGI:101921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-2, alpha 1 subunit transcript_id : NM_001077264.1

name	Ap2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256501 GeneID:11771 MGI:101921
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-2, alpha 1 subunit transcript_id : NM_007458.2

name	Stk22s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938288 GeneID:22116 MGI:1347560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 22 substrate 1 transcript_id : NM_011651.2

name	Stk22s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117938290 GeneID:22116 MGI:1347560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/threonine kinase 22 substrate 1 transcript_id : NM_001077591.1

name	Cpt1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24211026 GeneID:78070 MGI:2446526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carnitine palmitoyltransferase 1c transcript_id : NM_153679.1

name	Prmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130593 GeneID:15469 MGI:107846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 1 transcript_id : NM_019830.2

name	Bcl2l12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801687 GeneID:75736 MGI:1922986
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-like 12 (proline rich) transcript_id : NM_029410.2

name	Irf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699428 GeneID:54131 MGI:1859179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 3 transcript_id : NM_016849.3

name	AI480556 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56605681 GeneID:233208 MGI:2141980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI480556 transcript_id : NM_001008422.1

name	Rras (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891823 GeneID:20130 MGI:98179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Harvey rat sarcoma oncogene, subgroup R transcript_id : NM_009101.2

name	Prr12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380427 GeneID:233210 MGI:2679002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 82 ESTs, 3 Proteins product : proline rich 12 transcript_id : XM_001003082.1

name	Prrg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930410 GeneID:65116 MGI:1929596
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 transcript_id : NM_022999.1

name	Nosip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801495 GeneID:66394 MGI:1913644
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nitric oxide synthase interacting protein transcript_id : NM_025533.2

name	Rcn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794451 GeneID:52377 MGI:1277122
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulocalbin 3, EF-hand calcium binding domain transcript_id : NM_026555.1

name	Fcgrt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801903 GeneID:14132 MGI:103017
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgG, alpha chain transporter transcript_id : NM_010189.2

name	Rps11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980755 GeneID:27207 MGI:1351329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S11 transcript_id : NM_013725.2

name	Rpl13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892386 GeneID:22121 MGI:1351455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L13a transcript_id : NM_009438.4

name	Flt3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982427 GeneID:14256 MGI:95560
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FMS-like tyrosine kinase 3 ligand transcript_id : NM_013520.2

name	Aldh16a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26080428 GeneID:69748 MGI:1916998
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aldehyde dehydrogenase 16 family, member A1 transcript_id : NM_145954.1

name	Pih1d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802032 GeneID:68845 MGI:1916095
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PIH1 domain containing 1 transcript_id : NM_029406.2

name	Slc17a7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859826 GeneID:72961 MGI:1920211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 transcript_id : NM_182993.1

name	Gm581 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257252 GeneID:210541 MGI:2685427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 581, (NCBI) transcript_id : XM_149934.8

name	LOC100039953 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257256 GeneID:100039953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039953 transcript_id : XM_001473839.1

name	Tifp39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716586 GeneID:114640 MGI:2152297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tuberoinfundibular peptide of 39 residues (TIP39) preprohormone transcript_id : NM_053256.1

name	BC050196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41235780 GeneID:384619 MGI:2687329
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050196 transcript_id : NM_201374.1

name	Dkkl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980690 GeneID:50722 MGI:1354963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dickkopf-like 1 transcript_id : NM_015789.2

name	Tead2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560533 GeneID:21677 MGI:104904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TEA domain family member 2 transcript_id : NM_011565.2

name	Cd37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802952 GeneID:12493 MGI:88330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD37 antigen transcript_id : NM_007645.3

name	EG668620 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257185 GeneID:668620 MGI:3643075
definition	codon_start : 1 product : hypothetical protein LOC435970 protein_id : XP_001002654.2

name	Zfp715 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123173818 GeneID:69930 MGI:1917180
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 715 protein_id : NP_081540.3

name	Siglecf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704168 CCDS:CCDS21167.1 GeneID:233186 MGI:2681107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048029 - monosaccharide binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : sialic acid-binding lectin Siglec-F product : sialic acid binding Ig-like lectin 5 protein_id : NP_663556.1

name	Siglecg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370378 GeneID:243958 MGI:2443630
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : sialic acid binding Ig-like lectin 10 product : sialic acid binding Ig-like lectin G protein_id : NP_766488.1

name	LOC100039610 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257241 GeneID:100039610
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473236.1

name	Lim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244136 CCDS:CCDS21168.1 GeneID:233187 MGI:104698
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence TAS] GO_function : GO:0005212 - structural constituent of eye lens [Evidence TAS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0043010 - eye development (sensu Vertebrata) [Evidence IMP] codon_start : 1 note : total opacity 3 product : lens intrinsic membrane protein 2 protein_id : NP_808361.1

name	Nkg7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980746 CCDS:CCDS21169.1 GeneID:72310 MGI:1931250
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : natural killer cell group 7 sequence protein_id : NP_077215.2

name	Cldnd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508802 GeneID:74276 MGI:1921526
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : claudin domain containing 2 protein_id : NP_083125.1

name	Etfb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38142460 CCDS:CCDS21171.1 GeneID:110826 MGI:106098
definition	GO_component : GO:0017133 - electron transfer flavoprotein complex (sensu Eukaryota) [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0009055 - electron carrier activity [Evidence TAS] [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : electron transferring flavoprotein, beta polypeptide protein_id : NP_080971.2

name	2210412E05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257244 GeneID:75690 MGI:1922940
definition	codon_start : 1 product : hypothetical protein LOC75690 protein_id : XP_355890.4

name	A230106M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905944 GeneID:210094 MGI:2686277
definition	codon_start : 1 product : hypothetical protein protein_id : XP_357746.4

name	4931406B18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541981 CCDS:CCDS21172.1 GeneID:74054 MGI:1921304
definition	codon_start : 1 product : hypothetical protein LOC74054 protein_id : NP_083013.2

name	LOC100039946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257255 GeneID:100039946
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473341.1

name	Cd33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946590 CCDS:CCDS21173.1 GeneID:12489 MGI:99440
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 product : CD33 antigen protein_id : NP_067268.1

name	BC043301 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56711288 GeneID:210104 MGI:2652821
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC210104 protein_id : NP_001008549.1

name	Zfp719 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25050676 GeneID:210105 MGI:2444708
definition	codon_start : 1 product : zinc finger protein 719 isoform 1 protein_id : XP_145574.2

name	4933405K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312718 CCDS:CCDS21176.1 GeneID:74400 MGI:1921650
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74400 protein_id : NP_083189.1

name	Ceacam18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037299 CCDS:CCDS21177.1 GeneID:72431 MGI:1919681
definition	codon_start : 1 product : CEA-related cell adhesion molecule 1 protein_id : NP_082512.1

name	Siglece (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032002 CCDS:CCDS21178.1 GeneID:83382 MGI:1932475
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048029 - monosaccharide binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IDA]; GO:0005057 - receptor signaling protein activity [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IDA] codon_start : 1 note : sialic acid-binding immunoglobulin-like lectin E; sialic acid binding Ig-like lectin 5 product : SIGLEC-like 1 protein_id : NP_112458.2

name	Atpbd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704170 CCDS:CCDS21179.1 GeneID:233189 MGI:2385277
definition	codon_start : 1 product : ATP binding domain 3 protein_id : NP_663557.1

name	Klk14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469049 CCDS:CCDS21180.1 GeneID:317653 MGI:2447564
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 14 protein_id : NP_777355.1

name	Klk13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681722 GeneID:626834 MGI:3615275
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : kallikrein 13 product : kallikrein 13 precursor protein_id : NP_001034131.2

name	Klk12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905950 GeneID:69511 MGI:1916761
definition	codon_start : 1 product : kallikrein 12 protein_id : XP_898599.1

name	Klk11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910298 GeneID:56538 MGI:1929977
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : hippostasin; kallikrein 11 product : protease, serine, 20 protein_id : NP_064358.1

name	Klk10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526892 GeneID:69540 MGI:1916790
definition	codon_start : 1 product : kallikrein 10 protein_id : NP_598473.1

name	Klk9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841069 GeneID:101533 MGI:1921082
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : kallikrein-like protein 3; kallikrein 9 product : kallikrein 9 homolog protein_id : NP_082936.1

name	Klk8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679487 CCDS:CCDS21182.1 GeneID:259277 MGI:1343327
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA]; GO:0050808 - synapse organization and biogenesis [Evidence IMP] codon_start : 1 note : Brain Serine protease 1; neuropsin; protease, serine, 19 (neuropsin); kallikrein 8 product : protease, serine, 19 protein_id : NP_032966.1

name	Klk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777665 CCDS:CCDS21183.1 GeneID:23993 MGI:1346336
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : protease, serine, 6; thymopsin; kallikrein 7 (chymotryptic, stratum corneum) product : kallikrein 7 protein_id : NP_036002.1

name	Klk6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755180 CCDS:CCDS21184.1 GeneID:19144 MGI:1343166
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0042982 - amyloid precursor protein metabolism [Evidence ISS]; GO:0007417 - central nervous system development [Evidence ISS]; GO:0030574 - collagen catabolism [Evidence ISS]; GO:0042445 - hormone metabolism [Evidence ISS]; GO:0042552 - myelination [Evidence ISS]; GO:0016540 - protein autoprocessing [Evidence ISS] codon_start : 1 note : protease, serine, 9; kallikrein 7; protease M; kallikrein 29; kallikrein 6 product : protease, serine, 18 protein_id : NP_035307.1

name	Klk5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113866015 CCDS:CCDS21185.1 GeneID:68668 MGI:1915918
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 5 protein_id : NP_081082.1

name	Klk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910516 CCDS:CCDS21186.1 GeneID:56640 MGI:1861379
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 function : degradation of the enamel matrix during enamel maturation note : protease, serine 17 (enamel matrix, prostate) product : kallikrein 4 (prostase, enamel matrix, prostate) protein_id : NP_064312.1

name	Klk15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469045 CCDS:CCDS21187.1 GeneID:317652 MGI:2447533
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 15 protein_id : NP_777354.1

name	Klk1b8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7705572 CCDS:CCDS21189.1 GeneID:16624 MGI:892018
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 8 protein_id : NP_032483.1

name	Klk1b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8659568 CCDS:CCDS21190.1 GeneID:16623 MGI:892019
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : tissue kallikrein product : kallikrein 1 protein_id : NP_034775.1

name	Klk1b9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426851 CCDS:CCDS21191.1 GeneID:13648 MGI:95293
definition	EC_number : 3.4.21.35 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : epidermal growth factor binding protein type C product : kallikrein 9 protein_id : NP_034246.1

name	Klk1b11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28875780 CCDS:CCDS21192.1 GeneID:16613 MGI:892023
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 11 protein_id : NP_034770.1

name	Klk1b26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754460 GeneID:16618 MGI:891981
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : EGF-BP type B; kallikrein 1-related petidase b25 product : kallikrein 26 protein_id : NP_034774.1

name	Klk1b27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12313877 CCDS:CCDS21194.1 GeneID:16619 MGI:891980
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 note : glandular kallikrein 27 product : kallikrein 27 protein_id : NP_064664.1

name	Klk1b21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956056 CCDS:CCDS21195.1 GeneID:16616 MGI:892022
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IDA] GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 product : kallikrein 21 protein_id : NP_034772.1

name	Klk1b22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693913 CCDS:CCDS21196.1 GeneID:13646 MGI:95291
definition	EC_number : 3.4.21.35 GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : nerve growth factor beta chain endopeptidase; epidermal growth factor binding protein type A product : kallikrein 22 protein_id : NP_034244.1

name	Klk1b16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7019443 CCDS:CCDS21197.1 GeneID:16615 MGI:891982
definition	EC_number : 3.4.21.54 GO_function : GO:0004253 - gamma-renin activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : gamma-renin product : kallikrein 16 protein_id : NP_032480.1

name	Klk1b24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393675 CCDS:CCDS21198.1 GeneID:16617 MGI:892021
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] [Evidence NAS] GO_process : GO:0006508 - proteolysis [Evidence NAS] [Evidence IEA] codon_start : 1 product : kallikrein 24 protein_id : NP_034773.1

name	Klk1b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52851403 CCDS:CCDS21199.1 GeneID:18050 MGI:97322
definition	EC_number : 3.4.21.35 GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IDA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : gamma-NGF; 7S nerve growth factor gamma subunit product : nerve growth factor, gamma protein_id : NP_032719.1

name	Klk1b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8659572 CCDS:CCDS21200.1 GeneID:18048 MGI:97320
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005057 - receptor signaling protein activity [Evidence IDA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0043552 - positive regulation of phosphoinositide 3-kinase activity [Evidence IDA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation note : 7S nerve growth factor alpha subunit; alpha-NGF product : nerve growth factor, alpha protein_id : NP_035045.1

name	Klk1b5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949064 CCDS:CCDS21201.1 GeneID:16622 MGI:892020
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : kallikrein 5 protein_id : NP_032482.1

name	Klk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980868 CCDS:CCDS21202.1 GeneID:16612 MGI:102850
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004293 - tissue kallikrein activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : true tissue kallikrein; kallikrein renal/pancreas/salivary product : kallikrein 6 protein_id : NP_034769.4

name	1700028J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905877 GeneID:70004 MGI:1917254
definition	codon_start : 1 product : hypothetical protein LOC70004 isoform 2 protein_id : XP_906470.1

name	LOC668661 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94380414 GeneID:668661
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002944.1

name	Acpt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905960 GeneID:546967 MGI:3644563
definition	codon_start : 1 product : similar to acid phosphatase protein_id : XP_621786.2

name	LOC628854 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82905962 GeneID:628854
definition	codon_start : 1 product : hypothetical protein protein_id : XP_906052.1

name	Clec11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677869 CCDS:CCDS21203.1 GeneID:20256 MGI:1298219
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence NAS] GO_process : GO:0008284 - positive regulation of cell proliferation [Evidence ISS] codon_start : 1 note : stem cell growth factor product : C-type lectin domain family 11, member a precursor protein_id : NP_033157.1

name	Shank1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257272 GeneID:243961 MGI:3613677
definition	codon_start : 1 product : SH3 and multiple ankyrin repeat domains 1 protein_id : XP_001474041.1

name	1700008O03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380422 GeneID:69349 MGI:1916599
definition	codon_start : 1 product : hypothetical protein LOC69349 isoform 1 protein_id : XP_133454.3

name	Syt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560477 CCDS:CCDS21205.1 GeneID:20981 MGI:99665
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : synaptotagmin 3 protein_id : NP_057872.2

name	Lrrc4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38016190 CCDS:CCDS21206.1 GeneID:272381 MGI:3027390
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : leucine-rich repeats and immunoglobulin-like domains 4 product : leucine rich repeat containing 4B protein_id : NP_937893.1

name	0610012D14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312002 CCDS:CCDS21207.1 GeneID:68352 MGI:1915602
definition	GO_function : GO:0008839 - dihydrodipicolinate reductase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009089 - lysine biosynthesis via diaminopimelate [Evidence IEA]; GO:0006742 - NADP catabolism [Evidence IEA]; GO:0019363 - pyridine nucleotide biosynthesis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68352 protein_id : NP_080966.1

name	Josd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384740 CCDS:CCDS21208.1 GeneID:66124 MGI:1913374
definition	codon_start : 1 product : Josephin domain containing 2 protein_id : NP_079644.1

name	2310044H10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574074 GeneID:69683 MGI:1916933
definition	codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2310044H10 protein_id : NP_932108.1

name	1700021P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257280 GeneID:75538 MGI:1922788
definition	codon_start : 1 product : hypothetical protein LOC75538 isoform 6 protein_id : XP_906568.2

name	Mybpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122731 GeneID:233199 MGI:1336170
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] GO_process : GO:0006936 - muscle contraction [Evidence IPI] codon_start : 1 exception : mismatches in translation note : fast-type C-protein product : myosin binding protein C, fast-type protein_id : NP_666301.1

name	Mybpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017369 GeneID:233199 MGI:1336170
definition	GO_component : GO:0005856 - cytoskeleton [Evidence TAS] GO_function : GO:0005200 - structural constituent of cytoskeleton [Evidence TAS] GO_process : GO:0006936 - muscle contraction [Evidence IPI] codon_start : 1 exception : mismatches in translation note : fast-type C-protein product : myosin binding protein C, fast-type protein_id : NP_835168.1

name	Spib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61969658 CCDS:CCDS21209.1 GeneID:272382 MGI:892986
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0030225 - macrophage differentiation [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Spi-1/PU.1 related; Ets transcription factor Spi-B product : Spi-B transcription factor (Spi-1/PU.1 related) protein_id : NP_063919.1

name	Pold1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981551 CCDS:CCDS21210.1 GeneID:18971 MGI:97741
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008408 - 3'-5' exonuclease activity [Evidence IMP]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006287 - base-excision repair, gap-filling [Evidence IMP]; GO:0006260 - DNA replication [Evidence IEA]; GO:0045004 - DNA replication proofreading [Evidence IMP] codon_start : 1 exception : mismatches in translation note : DNA polymerase delta 1, catalytic domain; polymerase (DNA directed), delta 1, catalytic subunit (125kDa) product : polymerase (DNA directed), delta 1, catalytic subunit protein_id : NP_035261.2

name	Nr1h2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678507 CCDS:CCDS21211.1 GeneID:22260 MGI:1352463
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0004887 - thyroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0044255 - cellular lipid metabolism [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA] [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : liver X receptor; ubiquitously-expressed nuclear receptor 2 product : nuclear receptor subfamily 1, group H, member 2 protein_id : NP_033499.1

name	Napsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680552 CCDS:CCDS21212.1 GeneID:16541 MGI:109365
definition	GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : kidney-derived aspartic protease-like protein product : napsin A aspartic peptidase protein_id : NP_032463.1

name	Kcnc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778992 GeneID:16504 MGI:96669
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : potassium voltage gated channel, Shaw-related subfamily, member 3 protein_id : NP_032448.2

name	Myh14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336026 GeneID:71960 MGI:1919210
definition	GO_component : GO:0016459 - myosin [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0030898 - actin-dependent ATPase activity [Evidence IDA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0000146 - microfilament motor activity [Evidence IDA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030048 - actin filament-based movement [Evidence IDA]; GO:0008360 - regulation of cell shape [Evidence IEA] codon_start : 1 note : nonmuscle myosin heavy chain product : myosin, heavy chain 14 protein_id : NP_082297.1

name	1700023D19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63557333 GeneID:75510 MGI:1922760
definition	codon_start : 1 product : hypothetical protein LOC75510 isoform 1 protein_id : XP_620490.1

name	Zfp473 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922648 CCDS:CCDS21213.1 GeneID:243963 MGI:2442697
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 473 protein_id : NP_848849.2

name	Vrk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527166 CCDS:CCDS21214.1 GeneID:101568 MGI:2182465
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : vaccinia related kinase 3 protein_id : NP_598706.1

name	EG628904 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380424 GeneID:628904 MGI:3645141
definition	codon_start : 1 product : similar to sialic acid binding immunoglobin-like lectin protein_id : XP_919695.2

name	Atf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507624 CCDS:CCDS21215.1 GeneID:107503 MGI:2141857
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription factor-like protein ODA-10; activating transcription factor 7; activating transcription factor X product : ativating transcription factor 5 protein_id : NP_109618.1

name	Nup62 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716349 CCDS:CCDS21216.1 GeneID:18226 MGI:1351500
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence ISS] [Evidence IDA]; GO:0031074 - nucleocytoplasmic shuttling complex [Evidence ISS]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence ISS]; GO:0005487 - nucleocytoplasmic transporter activity [Evidence ISS] [Evidence IEA]; GO:0015288 - porin activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0051425 - PTB domain binding [Evidence IPI]; GO:0030159 - receptor signaling complex scaffold activity [Evidence ISS]; GO:0042169 - SH2 domain binding [Evidence ISS]; GO:0017056 - structural constituent of nuclear pore [Evidence IEA]; GO:0046966 - thyroid hormone receptor binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0043130 - ubiquitin binding [Evidence ISS] GO_process : GO:0008219 - cell death [Evidence ISS]; GO:0016477 - cell migration [Evidence NAS]; GO:0007166 - cell surface receptor linked signal transduction [Evidence ISS]; GO:0009755 - hormone-mediated signaling [Evidence ISS]; GO:0043066 - negative regulation of apoptosis [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS] [Evidence IMP]; GO:0042059 - negative regulation of epidermal growth factor receptor signaling pathway [Evidence IMP]; GO:0043407 - negative regulation of MAPK activity [Evidence IMP]; GO:0043072 - negative regulation of non-apoptotic programmed cell death [Evidence ISS]; GO:0046580 - negative regulation of Ras protein signal transduction [Evidence IMP]; GO:0006913 - nucleocytoplasmic transport [Evidence IEA]; GO:0045742 - positive regulation of epidermal growth factor receptor signaling pathway [Evidence ISS]; GO:0043123 - positive regulation of I-kappaB kinase/NF-kappaB cascade [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0009966 - regulation of signal transduction [Evidence ISS] codon_start : 1 note : nuclear pore complex 1 product : nucleoporin 62 protein_id : NP_444304.1

name	Il4i1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753872 CCDS:CCDS21217.1 GeneID:14204 MGI:109552
definition	GO_component : GO:0005764 - lysosome [Evidence IDA] GO_function : GO:0001716 - L-amino-acid oxidase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IDA]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : interleukin-four induced gene 1; interleukin-four induced gene-1 protein; L-amino acid oxidase; interleukin-four induced protein-1 product : interleukin 4 induced 1 protein_id : NP_034345.1

name	Tbc1d17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111120337 GeneID:233204 MGI:2449973
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] codon_start : 1 product : TBC1 domain family, member 17 protein_id : NP_001036120.1

name	Akt1s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312878 CCDS:CCDS21218.1 GeneID:67605 MGI:1914855
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007219 - Notch signaling pathway [Evidence ISS] codon_start : 1 note : lobe-like product : AKT1 substrate 1 (proline-rich) protein_id : NP_080546.1

name	Pnkp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118601009 GeneID:59047 MGI:1891698
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046404 - ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0046403 - polynucleotide 3'-phosphatase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 note : polynucleotide kinase 3'-phosphatase product : polynucleotide kinase 3'- phosphatase protein_id : NP_067524.2

name	Ptov1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149318 CCDS:CCDS21219.1 GeneID:84113 MGI:1933946
definition	GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA] GO_process : GO:0006418 - tRNA aminoacylation for protein translation [Evidence IEA] codon_start : 1 product : prostate tumor over expressed gene 1 protein_id : NP_598710.1

name	Med25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149312 CCDS:CCDS21220.1 GeneID:75613 MGI:1922863
definition	codon_start : 1 product : mediator of RNA polymerase II transcription, subunit 9 homolog protein_id : NP_083641.1

name	Fuz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257289 GeneID:70300 MGI:1917550
definition	codon_start : 1 product : fuzzy homolog protein_id : XP_001474864.1

name	Ap2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116256510 GeneID:11771 MGI:101921
definition	GO_component : GO:0030122 - AP-2 adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] [Evidence ISS]; GO:0005905 - coated pit [Evidence IEA]; GO:0030117 - membrane coat [Evidence IDA]; GO:0030141 - secretory granule [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence ISS] [Evidence IEA]; GO:0006895 - Golgi to endosome transport [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence TAS] [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : isoform b is encoded by transcript variant 2; adaptor-related protein complex AP-2, alpha 1 subunit product : adaptor protein complex AP-2, alpha 1 subunit isoform b protein_id : NP_001070732.1

name	Ap2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671561 GeneID:11771 MGI:101921
definition	GO_component : GO:0030122 - AP-2 adaptor complex [Evidence ISS]; GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA] [Evidence ISS]; GO:0005905 - coated pit [Evidence IEA]; GO:0030117 - membrane coat [Evidence IDA]; GO:0030141 - secretory granule [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence ISS] [Evidence IEA]; GO:0006895 - Golgi to endosome transport [Evidence ISS]; GO:0006886 - intracellular protein transport [Evidence TAS] [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : isoform a is encoded by transcript variant 1; adaptor-related protein complex AP-2, alpha 1 subunit product : adaptor protein complex AP-2, alpha 1 subunit isoform a protein_id : NP_031484.1

name	Stk22s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938289 GeneID:22116 MGI:1347560
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis-specific serine/threonine kinase substrate 1; clone 4 product : serine/threonine kinase 22 substrate 1 isoform 1 protein_id : NP_035781.2

name	Stk22s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117938291 GeneID:22116 MGI:1347560
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; testis-specific serine/threonine kinase substrate 1; clone 4 product : serine/threonine kinase 22 substrate 1 isoform 2 protein_id : NP_001071059.1

name	Cpt1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24211027 CCDS:CCDS21221.1 GeneID:78070 MGI:2446526
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0004095 - carnitine O-palmitoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : CPT I-C product : carnitine palmitoyltransferase 1, brain protein_id : NP_710146.1

name	Prmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790109 CCDS:CCDS21222.1 GeneID:15469 MGI:107846
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008469 - histone-arginine N-methyltransferase activity [Evidence ISS]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008276 - protein methyltransferase activity [Evidence ISS] [Evidence IMP]; GO:0035242 - protein-arginine omega-N asymmetric methyltransferase activity [Evidence ISS]; GO:0035241 - protein-arginine omega-N monomethyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016275 - [cytochrome c]-arginine N-methyltransferase activity [Evidence ISS] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0019919 - peptidyl-arginine methylation, to asymmetrical-dimethyl arginine [Evidence ISS]; GO:0035247 - peptidyl-arginine omega-N-methylation [Evidence ISS]; GO:0006479 - protein amino acid methylation [Evidence ISS] codon_start : 1 note : arginine N-methyltransferase 1 product : heterogeneous nuclear ribonucleoproteins methyltransferase-like 2 protein_id : NP_062804.1

name	Bcl2l12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21553305 CCDS:CCDS21223.1 GeneID:75736 MGI:1922986
definition	codon_start : 1 product : BCL2-like 12 (proline rich) protein_id : NP_083686.1

name	Irf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393627 CCDS:CCDS21224.1 GeneID:54131 MGI:1859179
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0045351 - interferon type I biosynthesis [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009615 - response to virus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : interferon regulatory factor 3 protein_id : NP_058545.1

name	AI480556 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56605682 CCDS:CCDS21225.1 GeneID:233208 MGI:2141980
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0019904 - protein domain specific binding [Evidence ISS] GO_process : GO:0006397 - mRNA processing [Evidence ISS]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : serine arginine-rich pre-mRNA splicing factor SR-A1 protein_id : NP_001008422.1

name	Rras (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677819 CCDS:CCDS21226.1 GeneID:20130 MGI:98179
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : Harvey rat sarcoma oncogene, subgroup R protein_id : NP_033127.1

name	Prr12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380428 GeneID:233210 MGI:2679002
definition	codon_start : 1 product : proline rich 12 protein_id : XP_001003082.1

name	Prrg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930411 CCDS:CCDS21227.1 GeneID:65116 MGI:1929596
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 protein_id : NP_075375.1

name	Nosip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384956 CCDS:CCDS21228.1 GeneID:66394 MGI:1913644
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence IEA] codon_start : 1 product : nitric oxide synthase interacting protein protein_id : NP_079809.1

name	Rcn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794452 CCDS:CCDS21229.1 GeneID:52377 MGI:1277122
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] codon_start : 1 exception : mismatches in translation product : reticulocalbin 3 protein_id : NP_080831.1

name	Fcgrt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753836 GeneID:14132 MGI:103017
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0019864 - IgG binding [Evidence IEA]; GO:0030106 - MHC class I receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : neonatal Fc receptor product : Fc receptor, IgG, alpha chain transporter protein_id : NP_034319.1

name	Rps11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426889 GeneID:27207 MGI:1351329
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA]; GO:0019843 - rRNA binding [Evidence IEA] codon_start : 1 product : ribosomal protein S11 protein_id : NP_038753.1

name	Rpl13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981945 CCDS:CCDS21230.1 GeneID:22121 MGI:1351455
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0015934 - large ribosomal subunit [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : tissue specific transplantation antigen P198-7; tum-transplantation antigen P198 product : ribosomal protein L13a protein_id : NP_033464.2

name	Flt3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982428 GeneID:14256 MGI:95560
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0030098 - lymphocyte differentiation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : FMS-like tyrosine kinase 3 ligand protein_id : NP_038548.2

name	Aldh16a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080429 CCDS:CCDS21231.1 GeneID:69748 MGI:1916998
definition	codon_start : 1 product : aldehyde dehydrogenase 16 family, member A1 protein_id : NP_666066.1

name	Pih1d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313052 CCDS:CCDS21232.1 GeneID:68845 MGI:1916095
definition	codon_start : 1 product : NOP17 protein_id : NP_083682.1

name	Slc17a7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859827 GeneID:72961 MGI:1920211
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence ISS] GO_function : GO:0015319 - sodium:inorganic phosphate symporter activity [Evidence ISS]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0042137 - sequestering of neurotransmitter [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 protein_id : NP_892038.1

name	Gm581 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257253 GeneID:210541 MGI:2685427
definition	codon_start : 1 product : similar to hCG2036794 protein_id : XP_149934.6

name	LOC100039953 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257257 GeneID:100039953
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473889.1

name	Tifp39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716587 CCDS:CCDS21233.1 GeneID:114640 MGI:2152297
definition	GO_function : GO:0005102 - receptor binding [Evidence TAS] GO_process : GO:0006171 - cAMP biosynthesis [Evidence TAS]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : tuberoinfundibular 39 residue protein product : tuberoinfundibular peptide of 39 residues preprohormone protein_id : NP_444486.1

name	BC050196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41235781 CCDS:CCDS21234.1 GeneID:384619 MGI:2687329
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC384619 protein_id : NP_958762.1

name	Dkkl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980691 CCDS:CCDS21235.1 GeneID:50722 MGI:1354963
definition	codon_start : 1 product : soggy 1 protein_id : NP_056604.2

name	Tead2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106433 CCDS:CCDS21236.1 GeneID:21677 MGI:104904
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IGI] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : a putative transcription factor which binds to the GT-IIC motif and is structurally related to transcriptional enhancer factor-1 (TEF-1) product : TEA domain family member 2 protein_id : NP_035695.1

name	Cd37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680880 CCDS:CCDS21237.1 GeneID:12493 MGI:88330
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 product : CD37 antigen protein_id : NP_031671.1

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 1 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 2 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 3 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 4 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 5 pseudo : _no_value

name	LOC100039589 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039589
definition	number : 6 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 1 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 2 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 3 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 4 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 5 pseudo : _no_value

name	LOC100039713 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039713
definition	number : 6 pseudo : _no_value

name	EG638453 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638453
definition	number : 3 pseudo : _no_value

name	EG638453 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638453
definition	number : 2 pseudo : _no_value

name	EG638453 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638453
definition	number : 1 pseudo : _no_value

name	LOC668630 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257245 GeneID:668630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 ESTs, 5 Proteins product : similar to GTP-binding protein PTD004 pseudo : _no_value transcript_id : XR_031112.1

name	Rnu35b (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:23466421 GeneID:27212 MGI:1351321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U35b small nucleolar transcript_id : NR_000004.8

name	Rnu35a (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:73912721 GeneID:27211 MGI:1351319
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U35a small nucleolar transcript_id : NR_000003.8

name	Rnu34 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:73661179 GeneID:27210 MGI:1351325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U34 small nucleolar transcript_id : NR_002455.1

name	Rnu33 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:29171312 GeneID:27208 MGI:1351323
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U33 small nucleolar transcript_id : NR_001277.2

name	Rnu32 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:73912722 GeneID:27209 MGI:1351324
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U32 small nucleolar transcript_id : NR_000002.8

clone name	MSMg01-413B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138C21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-528B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053D14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391P11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-142K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382P24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-280H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177I21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-161F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-353D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022H20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-284O01.b	B6Ng01-284O01.g
ACC	GA083471	GA083472
length	758	816
definition	B6Ng01-284O01.b	B6Ng01-284O01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(51,508,203 - 51,508,957)	(51,370,118 - 51,370,928)
sequence	gaattccgggggagctccagggaacccgaggaggaagatggagagtgagg atgggtgatggcttggcattgggtggatgggctcttcttcggatggggaa ctagtgatgctactgtcctttccacctccaggaatgtcactgtctctctc atctaccgcaatgacacctcccgcccacccctgccactcagggtccctgg gtgcccagctccctgtccacttgggcgcttccagcagctgactgctccag cccggcctccagcccatggggccccctgccatggttcttatgagcctgcc agccccccaggtgacagccctctacgctggggtgggagtggggagttccc aaggcctgggattcacaacccccatgttcttcctgcagccacggtgcccc tgctggccggagctgtggctgtgctggccgtgctaagcctggggcttggt cttctggcctggaggcccagatgcctgcgggccctgggagggactgtgtg aggggggatgaatagacacaaaaataccccgagctgacactggatcccaa cacgtgtgctcacttgctgctctggcttgtcacttactgtgctcatgcgc gtgtggggatgaaggctgggtgggcctcaagcattatgctttgcttggac actgcaatcaggtgttgtacatacaggtgtcggggctcacaataaccacg tgtgcaggtggggaacctgtagcctgagaagcacacaggactcaattgcc ttaagcaa	gaattcccaaccctggcaggtggctgtgtactacttagatgagtacctat gcgggggagtcctgttggaccgcaactgggttctcacagctgcccactgc tatgaagagtaagtaaaggtggagacaggaaagcaagatggcagccagag atcatgactccaggacaggctggggtactgaagggcaggggagtgggact ggctgaaactatccatgacctcctgggtctctctttactccatcctccag gtttgtgttcagagtcctgtttctttttttttttctctcttattatctgt ctctctcctgtctgtattcacatatgagtgtctccgtggccatctgtcac tgtgtatctctgccttgggacactgggcacaaactttctggttctgggtc tcatgtgtcctcttatatcactactgaccatagtggggaccaggcctaaa gggcccctgaggatagagagtgctgtccctgagggtaggctgtgagagaa gtcctcactctcctcagagcagctctgcctttaggaccttctgtccactc tgaggacacacagagaagagctggtcaggactggagctgggtgaggtaac tgagtacagagagagctggatgctggggagggaggggagggttcagacct tgggctgcaggccaggccttacctgctggggaagttcagccctgtcctag ctgcacctgagcagatttttaggccctaccctttctaccccttgtcttct gttcctgtatttgctctctctgccctctctaaatctatttggatgtatga tatgcatgtatgtatg
quality values	Open. Hide. 58 26 21 37 58 58 49 58 58 58 58 58 29 21 58 58 62 42 33 62 62 47 31 41 42 62 62 62 47 47 56 38 24 30 18 26 18 13 19 50 62 62 51 54 62 62 62 62 59 62 59 43 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 59 54 38 49 49 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 59 62 59 59 59 62 59 62 59 62 62 62 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 54 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 51 62 59 59 59 59 59 59 43 59 59 59 59 59 59 56 62 56 56 51 42 56 56 56 47 56 56 47 42 62 62 47 51 62 62 62 56 56 56 54 47 62 62 62 62 62 47 37 56 62 51 47 44 32 51 51 42 42 37 50 56 62 56 47 51 56 25 25 22 9 31 21 56 56 56 50 33 26 31 28 38 51 39 56 51 62 37 42 39 37 38 31 31 42 51 62 62 43 47 39 40 36 38 56 56 46 16 15 9 9 14 12 56 56 42 41 14 41 47 56 56 56 56 62 56 32 27 30 16 26 33 56 56 46 50 43 36 15 38 18 43 42 52 47 43 43 48 54 22 27 38 24 12 29 28 50 46 24 27 42 46 42 31 24 31 26 30 35 29 35 25 28 43 20 34 27 31 31 33 27 18 21 23 10 23 22 31 38 28 27 35 27 35 27 18 13 19 19 12 9 21 9 23 17 33 33 30 37 39 28 46 23 39 28 17 52 40 42 33 34 19 34 28 30 18 29 28 23 21 21 26 18 17 17 9 9 25 22 12 28 33 35 34 22 16 15 13 10 10 13 22 18 42 37 32 35 31 37 46 24 6 25 18 25 46 52 14 39 42 21 32 12 22 17 17 13 10 13 31 21 18 10 10 7 9 26 14 15 24 27 37 19 14 9 9 13 9	Open. Hide. 62 47 39 47 62 62 62 47 42 62 62 35 35 21 24 21 19 24 25 38 34 49 59 62 62 62 62 59 59 59 59 59 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 32 32 62 59 56 56 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 59 62 59 62 62 59 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 62 56 62 56 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 56 62 62 62 62 54 62 62 62 59 62 62 62 62 56 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 59 62 49 49 49 62 59 59 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 44 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 49 51 62 56 62 62 56 62 62 62 56 56 56 43 62 62 56 62 56 62 56 56 42 54 56 62 62 56 62 62 62 62 62 62 62 62 62 56 62 45 62 62 39 62 62 62 56 62 62 62 62 47 43 62 62 56 62 62 36 41 62 47 50 42 62 52 62 62 42 49 42 62 62 52 62 52 62 62 62 62 62 62 52 49 62 47 48 62 62 62 62 34 58 58 58 58 54 54 54 58 35 54 41 42 53 47 58 58 58 50 54 50 54 54 40 58 20 58 34 45 49 54 58 52 58 54 53 58 54 58 48 54 47 47 45 36 58 58 58 26 58 52 54 54 9 17 9 6 16 24 42 31 54 22 26 39 45 45 47 44 42 33 27 24 46 20 44 20 18 12 12 19 9 20 24 20 9 12 17 21 39 27 15 29 30 41 12 19 50 19 30 20 23 23 12 31 43 24 50 46 39 39 37 32 18 6 20 7 9 23 16 40 27 19 26 25 7 49 42 25 52 28 13 25 21 11 13 10 25 11 19 9 13 15 14 14 16 23 27 24 23 18 12 16 31 21 21 32 23 30 15 22 11 29 11 9 17 16 19 9 13 15 10 9 12 11 24 28 34 41 20 26 16 19 5 14 9 15 12 37 23 29 28 19 29 21 19 27 13 12 18 13 11 16 9 12 12 8 12 9 15 18 24 28 8 17 14 14 31 14 13 9 6 9 6 4 8 16 15 6 14 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_51508203_51508957
seq2: B6Ng01-284O01.b_46_803 (reverse)

seq1  TTGCTTAAGGCAATTGAGTCCTGTGTGC-TCTCAGGCTACAGGTT-CCCA  48
      |||||||||||||||||||||||||||| |||||||||||||||| ||||
seq2  TTGCTTAAGGCAATTGAGTCCTGTGTGCTTCTCAGGCTACAGGTTCCCCA  50

seq1  CCTGCACACGTGCTTATTGTGAGCCCCGACACCTGTATGTACAACACCTG  98
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  CCTGCACACGTGGTTATTGTGAGCCCCGACACCTGTATGTACAACACCTG  100

seq1  ATTGCAGTGTCCAAGC-AAGCATAATGCTTGAGGCCCACCCAGCCTTCAT  147
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  ATTGCAGTGTCCAAGCAAAGCATAATGCTTGAGGCCCACCCAGCCTTCAT  150

seq1  CCCCACACGCGCATGAGCACAGTAAGTGACAAGCCAGAGCAGCAAGTGAG  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACACGCGCATGAGCACAGTAAGTGACAAGCCAGAGCAGCAAGTGAG  200

seq1  CACACGTGTTGGGATCCAGTGTCAGCTCGGGGTATTTTTGTGTCTATTCA  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACGTGTTGGGATCCAGTGTCAGCTCGGGGTATTTTTGTGTCTATTCA  250

seq1  TCCCCCCTCACACAGTCCCTCCCAGGGCCCGCAGGCATCTGGGCCTCCAG  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCCCTCACACAGTCCCTCCCAGGGCCCGCAGGCATCTGGGCCTCCAG  300

seq1  GCCAGAAGACCAAGCCCCAGGCTTAGCACGGCCAGCACAGCCACAGCTCC  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGAAGACCAAGCCCCAGGCTTAGCACGGCCAGCACAGCCACAGCTCC  350

seq1  GGCCAGCAGGGGCACCGTGGCTGCAGGAAGAACATGGGGGTTGTGAATCC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGCAGGGGCACCGTGGCTGCAGGAAGAACATGGGGGTTGTGAATCC  400

seq1  CAGGCCTTGGGAACTCCCCACTCCCACCCCAGCGTAGAGGGCTGTCACCT  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCCTTGGGAACTCCCCACTCCCACCCCAGCGTAGAGGGCTGTCACCT  450

seq1  GGGGGGCTGGCAGGCTCATAAGAACCATGGCAGGGGGCCCCATGGGCTGG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGGGCTGGCAGGCTCATAAGAACCATGGCAGGGGGCCCCATGGGCTGG  500

seq1  AGGCCGGGCTGGAGCAGTCAGCTGCTGGAAGCGCCCAAGTGGACAGGGAG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCCGGGCTGGAGCAGTCAGCTGCTGGAAGCGCCCAAGTGGACAGGGAG  550

seq1  CTGGGCACCCAGGGACCCTGAGTGGCAGGGGTGGGCGGGAGGTGTCATTG  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGCACCCAGGGACCCTGAGTGGCAGGGGTGGGCGGGAGGTGTCATTG  600

seq1  CGGTAGATGAGAGAGACAGTGACATTCCTGGAGGTGGAAAGGACAGTAGC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGTAGATGAGAGAGACAGTGACATTCCTGGAGGTGGAAAGGACAGTAGC  650

seq1  ATCACTAGTTCCCCATCCGAAGAAGAGCCCATCCACCCAATGCCAAGCCA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACTAGTTCCCCATCCGAAGAAGAGCCCATCCACCCAATGCCAAGCCA  700

seq1  TCACCCATCCTCACTCTCCATCTTCCTCCTCGGGTTCCCTGGAGCTCCCC  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACCCATCCTCACTCTCCATCTTCCTCCTCGGGTTCCCTGGAGCTCCCC  750

seq1  CGGAATTC  755
      ||||||||
seq2  CGGAATTC  758

seq1: chr7_51370118_51370928
seq2: B6Ng01-284O01.g_67_882

seq1  GAATTCCCAACCCTGGCAGGTGGCTGTGTACTACTTAGATGAGTACCTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCAACCCTGGCAGGTGGCTGTGTACTACTTAGATGAGTACCTAT  50

seq1  GCGGGGGAGTCCTGTTGGACCGCAACTGGGTTCTCACAGCTGCCCACTGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGGGGAGTCCTGTTGGACCGCAACTGGGTTCTCACAGCTGCCCACTGC  100

seq1  TATGAAGAGTAAGTAAAGGTGGAGACAGGAAAGCAAGATGGCAGCCAGAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAAGAGTAAGTAAAGGTGGAGACAGGAAAGCAAGATGGCAGCCAGAG  150

seq1  ATCATGACTCCAGGACAGGCTGGGGTACTGAAGGGCAGGGGAGTGGGACT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATGACTCCAGGACAGGCTGGGGTACTGAAGGGCAGGGGAGTGGGACT  200

seq1  GGCTGAAACTATCCATGACCTCCTGGGTCTCTCTTTACTCCATCCTCCAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGAAACTATCCATGACCTCCTGGGTCTCTCTTTACTCCATCCTCCAG  250

seq1  GTTTGTGTTCAGAGTCCTGTTTCTTTTTTTTTTTCTCTCTTATTATCTGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGTGTTCAGAGTCCTGTTTCTTTTTTTTTTTCTCTCTTATTATCTGT  300

seq1  CTCTCTCCTGTCTGTATTCACATATGAGTGTCTCCGTGGCCATCTGTCAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCTCCTGTCTGTATTCACATATGAGTGTCTCCGTGGCCATCTGTCAC  350

seq1  TGTGTATCTCTGCCTTGGGACACTGGGCACAAACTTTCTGGTTCTGGGTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTATCTCTGCCTTGGGACACTGGGCACAAACTTTCTGGTTCTGGGTC  400

seq1  TCATGTGTCCTCTTATATCACTACTGACCATAGTGGGGACCAGGCCTAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGTGTCCTCTTATATCACTACTGACCATAGTGGGGACCAGGCCTAAA  450

seq1  GGGCCCCTGAGGATAGAGAGTGCTGTCCCTGAGGGTAGGCTGTGAGAGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCCCTGAGGATAGAGAGTGCTGTCCCTGAGGGTAGGCTGTGAGAGAA  500

seq1  GTCCTCACTCTCCTCAGAGCAGCTCTGCCTTTAGGACCTTCTGTCCACTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTCACTCTCCTCAGAGCAGCTCTGCCTTTAGGACCTTCTGTCCACTC  550

seq1  TGAGGACACACAGAGAAGAGCTGGTCAGGACTGGAGCTGGGTGAGGTAAC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGACACACAGAGAAGAGCTGGTCAGGACTGGAGCTGGGTGAGGTAAC  600

seq1  TGAGTACAGAGAGAGCTGGATGCTGGGGAGGGAGGGGAGGGCTCAGACCT  650
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TGAGTACAGAGAGAGCTGGATGCTGGGGAGGGAGGGGAGGGTTCAGACCT  650

seq1  TGGGCTGCAGGCCAGGCCTTACCTGCTGGGGAAGTTCAGCCCTGTCCTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTGCAGGCCAGGCCTTACCTGCTGGGGAAGTTCAGCCCTGTCCTAG  700

seq1  CTGCACCTGAGCAGA-TTTTAGG-CCTACCCTTTCTA-CCCTTGTCTTCT  747
      ||||||||||||||| ||||||| ||||||||||||| ||||||||||||
seq2  CTGCACCTGAGCAGATTTTTAGGCCCTACCCTTTCTACCCCTTGTCTTCT  750

seq1  GTTCCTGTATTTGCTCTCTCTG-CCTCTCTAAATCTATATGTATGTATGA  796
      |||||||||||||||||||||| ||||||||||||||| || ||||||||
seq2  GTTCCTGTATTTGCTCTCTCTGCCCTCTCTAAATCTATTTGGATGTATGA  800

seq1  -ATGCATGTATGTATG  811
       |||||||||||||||
seq2  TATGCATGTATGTATG  816

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information