MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-297B22
Chromosome	7 (Build37)
Map Location	28,756,044 - 28,757,149
singlet/doublet	singlet
Overlap gene	Zfp780b
Upstream gene	Cyp2a12, LOC100043199, Cyp2f2, Gm1450, Egln2, Rab4b, Mia1, Snrpa, Itpkc, Adck4, Numbl, Ltbp4, Shkbp1, Spnb4, Blvrb, EG668045, Sertad3, Sertad1, Prx, Hipk4, Pld3, 2310022A10Rik, Akt2, Ttc9b, Map3k10, C030039L03Rik, Zfp60, LOC100043229, LOC100043233, 4933426I21Rik, Zfp59, 4732475C15Rik, Prkcz2, 1700049G17Rik, EG668175, LOC100043771
Downstream gene	C130069I09Rik, LOC100043772, Psmc4, LOC100043774, 9530053A07Rik, Fbl, Dyrk1b, Eid2, LOC434156, BC089491, Dll3, Timm50, Supt5h, Rps16, Plekhg2, Zfp36, Ixl, Paf1, Samd4b, 1700085B13Rik, Gmfg, Lrfn1, LOC624672, 1700028B04Rik, EG330496, Il28, Sycn, 1190020J12Rik, Pak4, C330005M16Rik, Fbxo27, Fbxo17, Mrps12, Sars2, EG624918, Nfkbib, Sirt2, 5830482F20Rik, Hnrpl, Ech1, Lgals4, Lgals7, Capn12, Actn4, Eif3s12
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cyp2a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13085 MGI:105055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Cyp2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13107 MGI:88608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1450 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384724 MGI:2686296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 Proteins

name	Egln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112406 MGI:1932287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19342 MGI:105071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mia1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12587 MGI:109615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53607 MGI:1855690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Itpkc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233011 MGI:2442554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76889 MGI:1924139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Numbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18223 MGI:894702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108075 MGI:1321395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192192 MGI:2385803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spnb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80297 MGI:1890574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blvrb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233016 MGI:2385271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668045 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668045 MGI:3645709
definition	note : predicted gene, EG668045 pseudo : _no_value

name	Sertad3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170742 MGI:2180697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sertad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55942 MGI:1913438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19153 MGI:108176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Hipk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233020 MGI:2685008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pld3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18807 MGI:1333782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310022A10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66367 MGI:1913617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11652 MGI:104874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ttc9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73032 MGI:1920282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map3k10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269881 MGI:1346879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C030039L03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112415 MGI:2148237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp60 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22718 MGI:99207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043229 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100043233 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	4933426I21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71163 MGI:1918413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Zfp59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22717 MGI:99206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4732475C15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545938 MGI:3584526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkcz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404705 MGI:3029152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 24 Proteins

name	1700049G17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73430 MGI:1920680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668175 MGI:3643781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 65 ESTs, 1 Protein

name	LOC100043771 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 8 Proteins

name	Zfp780b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338354 MGI:2444764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C130069I09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233026 MGI:3036281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 1 Protein

name	LOC100043772 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 1 Protein

name	Psmc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23996 MGI:1346093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	9530053A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319482 MGI:2442118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14113 MGI:95486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dyrk1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13549 MGI:1330302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:386655 MGI:2681174
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434156 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs, 1 Protein

name	BC089491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280621 MGI:3608324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dll3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13389 MGI:1096877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66525 MGI:1913775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Supt5h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20924 MGI:1202400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20055 MGI:98118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101497 MGI:2141874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22695 MGI:99180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ixl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67224 MGI:1914474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Paf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54624 MGI:1923988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Samd4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233033 MGI:2448542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700085B13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76721 MGI:1923971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Gmfg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:63986 MGI:1927135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Lrfn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80749 MGI:2136810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	1700028B04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70001 MGI:1917251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	EG330496 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330496 MGI:3647279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338374 MGI:2450574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sycn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68416 MGI:1915666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190020J12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233038 MGI:2685009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pak4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70584 MGI:1917834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330005M16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101744 MGI:2142121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233040 MGI:2685007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50760 MGI:1354707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24030 MGI:1346333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sars2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71984 MGI:1919234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624918 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624918 MGI:3645242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Nfkbib (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18036 MGI:104752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64383 MGI:1927664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830482F20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320435 MGI:2444024
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15388 MGI:104816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ech1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51798 MGI:1858208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16855 MGI:107536
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lgals7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16858 MGI:1316742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Capn12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60594 MGI:1891369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Actn4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60595 MGI:1890773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif3s12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73830 MGI:1921080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526797 GeneID:13085 MGI:105055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 12 transcript_id : NM_133657.1

name	Cyp2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001559 GeneID:13107 MGI:88608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily f, polypeptide 2 transcript_id : NM_007817.2

name	Gm1450 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256475 GeneID:384724 MGI:2686296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 Proteins product : gene model 1450, (NCBI) transcript_id : XM_357820.4

name	Egln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893236 GeneID:112406 MGI:1932287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGL nine homolog 2 (C. elegans) transcript_id : NM_053208.3

name	Rab4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891837 GeneID:19342 MGI:105071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB4B, member RAS oncogene family transcript_id : NM_029391.2

name	Mia1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365990 GeneID:12587 MGI:109615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma inhibitory activity 1 transcript_id : NM_019394.2

name	Snrpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052105 GeneID:53607 MGI:1855690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide A transcript_id : NM_015782.3

name	Snrpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052540 GeneID:53607 MGI:1855690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide A transcript_id : NM_001046637.1

name	Itpkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795579 GeneID:233011 MGI:2442554
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase C transcript_id : NM_181593.2

name	Adck4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244099 GeneID:76889 MGI:1924139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 4 transcript_id : NM_133770.2

name	Numbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87042276 GeneID:18223 MGI:894702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : numb-like transcript_id : NM_010950.2

name	Ltbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189329 GeneID:108075 MGI:1321395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : latent transforming growth factor beta binding protein 4 transcript_id : NM_175641.1

name	Shkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109659850 GeneID:192192 MGI:2385803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sh3kbp1 binding protein 1 transcript_id : NM_138676.2

name	Spnb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174792 GeneID:80297 MGI:1890574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin beta 4 transcript_id : NM_032610.2

name	Blvrb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893170 GeneID:233016 MGI:2385271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biliverdin reductase B (flavin reductase (NADPH)) transcript_id : NM_144923.3

name	Sertad3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254112 GeneID:170742 MGI:2180697
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SERTA domain containing 3 transcript_id : NM_133210.2

name	Sertad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802555 GeneID:55942 MGI:1913438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SERTA domain containing 1 transcript_id : NM_018820.4

name	Prx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506998 GeneID:19153 MGI:108176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : periaxin transcript_id : NM_019412.1

name	Prx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674284 GeneID:19153 MGI:108176
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : periaxin transcript_id : NM_198048.1

name	Hipk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701817 GeneID:233020 MGI:2685008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homeodomain interacting protein kinase 4 transcript_id : NM_001033315.1

name	Pld3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7242180 GeneID:18807 MGI:1333782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase D family, member 3 transcript_id : NM_011116.1

name	2310022A10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541873 GeneID:66367 MGI:1913617
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310022A10 gene transcript_id : NM_175107.3

name	Akt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27312021 GeneID:11652 MGI:104874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymoma viral proto-oncogene 2 transcript_id : NM_007434.2

name	Ttc9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625932 GeneID:73032 MGI:1920282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetratricopeptide repeat domain 9B transcript_id : NM_028417.1

name	Map3k10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486846 GeneID:269881 MGI:1346879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase kinase 10 transcript_id : NM_001081292.1

name	C030039L03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38259209 GeneID:112415 MGI:2148237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C030039L03 gene transcript_id : NM_198417.1

name	Zfp60 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476065 GeneID:22718 MGI:99207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 60 transcript_id : NM_009560.2

name	Zfp60 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86476063 GeneID:22718 MGI:99207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 60 transcript_id : NM_029531.2

name	LOC100043229 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256479 GeneID:100043229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043229 transcript_id : XM_001479782.1

name	LOC100043233 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256481 GeneID:100043233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100043233 transcript_id : XM_001479790.1

name	4933426I21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256483 GeneID:71163 MGI:1918413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 4933426I21 gene transcript_id : XM_622939.4

name	Zfp59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124269714 GeneID:22717 MGI:99206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 59 transcript_id : NM_011762.3

name	4732475C15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625612 GeneID:545938 MGI:3584526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732475C15 gene transcript_id : NM_001024726.2

name	Prkcz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380064 GeneID:404705 MGI:3029152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 24 Proteins product : protein kinase C, zeta 2 transcript_id : XM_994291.1

name	1700049G17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74315968 GeneID:73430 MGI:1920680
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700049G17 gene transcript_id : NM_028538.1

name	EG668175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380080 GeneID:668175 MGI:3643781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 65 ESTs, 1 Protein product : predicted gene, EG668175, transcript variant 2 transcript_id : XM_001002407.1

name	LOC100043771 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256667 GeneID:100043771
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 8 Proteins product : similar to Josephin domain containing 1 transcript_id : XM_001480984.1

name	Zfp780b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486617 GeneID:338354 MGI:2444764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 780B transcript_id : NM_001081021.1

name	C130069I09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256671 GeneID:233026 MGI:3036281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 1 Protein product : RIKEN cDNA C130069I09 gene, transcript variant 1 transcript_id : XM_133337.8

name	LOC100043772 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256669 GeneID:100043772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001480985.1

name	Psmc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248576 GeneID:23996 MGI:1346093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, ATPase, 4 transcript_id : NM_011874.2

name	LOC100043774 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256673 GeneID:100043774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043774 transcript_id : XM_001480990.1

name	9530053A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373994 GeneID:319482 MGI:2442118
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9530053A07 gene transcript_id : NM_176924.3

name	Fbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982372 GeneID:14113 MGI:95486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibrillarin transcript_id : NM_007991.2

name	Dyrk1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893198 GeneID:13549 MGI:1330302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b transcript_id : NM_001037957.2

name	Dyrk1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753697 GeneID:13549 MGI:1330302
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b transcript_id : NM_010092.1

name	Eid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301483 GeneID:386655 MGI:2681174
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EP300 interacting inhibitor of differentiation 2 transcript_id : NM_198425.2

name	LOC434156 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256487 GeneID:434156
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 37 ESTs, 1 Protein product : similar to EID-2-like inhibitor of differentiation-3 transcript_id : XM_994514.2

name	BC089491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111159468 GeneID:280621 MGI:3608324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC089491 transcript_id : NM_175033.3

name	Dll3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116292183 GeneID:13389 MGI:1096877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : delta-like 3 (Drosophila) transcript_id : NM_007866.2

name	Timm50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802755 GeneID:66525 MGI:1913775
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 50 homolog (yeast) transcript_id : NM_025616.2

name	Supt5h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22094122 GeneID:20924 MGI:1202400
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of Ty 5 homolog (S. cerevisiae) transcript_id : NM_013676.1

name	Rps16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305444 GeneID:20055 MGI:98118
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S16 transcript_id : NM_013647.1

name	Plekhg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446220 GeneID:101497 MGI:2141874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 2 transcript_id : NM_001083912.1

name	Plekhg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922715 GeneID:101497 MGI:2141874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 2 transcript_id : NM_138752.2

name	Zfp36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130057 GeneID:22695 MGI:99180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 36 transcript_id : NM_011756.4

name	Ixl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754100 GeneID:67224 MGI:1914474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : intersex-like (Drosophila) transcript_id : NM_026042.2

name	Paf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891702 GeneID:54624 MGI:1923988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Paf1, RNA polymerase II associated factor, homolog (S. cerevisiae) transcript_id : NM_019458.3

name	Samd4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375565 GeneID:233033 MGI:2448542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterile alpha motif domain containing 4B transcript_id : NM_175021.2

name	1700085B13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256489 GeneID:76721 MGI:1923971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700085B13 gene transcript_id : XM_001479846.1

name	Gmfg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861214 GeneID:63986 MGI:1927135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glia maturation factor, gamma transcript_id : NM_022024.2

name	Gmfg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861221 GeneID:63986 MGI:1927135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glia maturation factor, gamma transcript_id : NM_001039192.1

name	Lrfn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385437 GeneID:80749 MGI:2136810
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat and fibronectin type III domain containing 1 transcript_id : NM_030562.1

name	EG330496 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130494424 GeneID:330496 MGI:3647279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG330496 transcript_id : NM_001024673.2

name	Il28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28893578 GeneID:338374 MGI:2450574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 28 transcript_id : NM_177396.1

name	Sycn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754041 GeneID:68416 MGI:1915666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syncollin transcript_id : NM_026716.2

name	1190020J12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487434 GeneID:233038 MGI:2685009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190020J12 gene transcript_id : NM_001081115.1

name	Pak4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672923 GeneID:70584 MGI:1917834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : p21 (CDKN1A)-activated kinase 4 transcript_id : NM_027470.3

name	C330005M16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377644 GeneID:101744 MGI:2142121
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330005M16 gene transcript_id : NM_175319.3

name	Fbxo27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802348 GeneID:233040 MGI:2685007
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 27 transcript_id : NM_207238.2

name	Fbxo17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657080 GeneID:50760 MGI:1354707
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 17 transcript_id : NM_015796.1

name	Mrps12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803235 GeneID:24030 MGI:1346333
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S12 transcript_id : NM_011885.3

name	Sars2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963764 GeneID:71984 MGI:1919234
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seryl-aminoacyl-tRNA synthetase 2 transcript_id : NM_023637.1

name	EG624918 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380082 GeneID:624918 MGI:3645242
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG624918 transcript_id : XM_898523.2

name	Nfkbib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130180 GeneID:18036 MGI:104752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, beta transcript_id : NM_010908.4

name	Sirt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364001 GeneID:64383 MGI:1927664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sirtuin 2 (silent mating type information regulation 2, homolog) 2 (S. cerevisiae) transcript_id : NM_022432.3

name	5830482F20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379968 GeneID:320435 MGI:2444024
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830482F20 gene transcript_id : NM_177158.3

name	Hnrpl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130380 GeneID:15388 MGI:104816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein L transcript_id : NM_177301.4

name	Ech1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7949036 GeneID:51798 MGI:1858208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enoyl coenzyme A hydratase 1, peroxisomal transcript_id : NM_016772.1

name	Lgals4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849704 GeneID:16855 MGI:107536
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 4 transcript_id : NM_010706.1

name	Lgals7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49619226 GeneID:16858 MGI:1316742
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lectin, galactose binding, soluble 7 transcript_id : NM_008496.4

name	Capn12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11230799 GeneID:60594 MGI:1891369
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calpain 12 transcript_id : NM_021894.1

name	Actn4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18702319 GeneID:60595 MGI:1890773
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : actinin alpha 4 transcript_id : NM_021895.2

name	Eif3s12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359029 GeneID:73830 MGI:1921080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 3, subunit 12 transcript_id : NM_028659.2

name	Cyp2a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526798 CCDS:CCDS21009.1 GeneID:13085 MGI:105055
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a12 product : cytochrome P450, family 2, subfamily a, polypeptide 12 protein_id : NP_598418.1

name	Cyp2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001560 CCDS:CCDS21010.1 GeneID:13107 MGI:88608
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2f2 product : cytochrome P450, family 2, subfamily f, polypeptide 2 protein_id : NP_031843.2

name	Gm1450 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256476 GeneID:384724 MGI:2686296
definition	codon_start : 1 product : similar to cytochrome P450 monooxygenase CYP2T1 protein_id : XP_357820.4

name	Egln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450783 CCDS:CCDS21011.1 GeneID:112406 MGI:1932287
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008198 - ferrous iron binding [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence ISS] [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019826 - oxygen sensor activity [Evidence ISS] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0045732 - positive regulation of protein catabolism [Evidence ISS]; GO:0019538 - protein metabolism [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0030503 - regulation of cell redox homeostasis [Evidence ISS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 note : immediate early response 4 product : EGL nine homolog 2 protein_id : NP_444438.2

name	Rab4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313012 CCDS:CCDS21012.1 GeneID:19342 MGI:105071
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB4B, member RAS oncogene family protein_id : NP_083667.1

name	Mia1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506479 CCDS:CCDS21013.1 GeneID:12587 MGI:109615
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation function : melanoma-inhibitory-activity note : melanoma-inhibitory-activity; cartilage derived retinoic acid sensitive protein; melanoma inhibatory activity product : melanoma inhibitory activity 1 protein_id : NP_062267.1

name	Snrpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052541 GeneID:53607 MGI:1855690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : protein A of the U1 small nuclear RNA; U1 snRNP product : small nuclear ribonucleoprotein polypeptide A protein_id : NP_001040102.1

name	Snrpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052106 CCDS:CCDS21014.1 GeneID:53607 MGI:1855690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : protein A of the U1 small nuclear RNA; U1 snRNP product : small nuclear ribonucleoprotein polypeptide A protein_id : NP_056597.3

name	Itpkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712006 CCDS:CCDS21015.1 GeneID:233011 MGI:2442554
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : inositol 1,4,5-trisphosphate 3-kinase C protein_id : NP_853624.1

name	Adck4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244100 GeneID:76889 MGI:1924139
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : aarF domain containing kinase 4 protein_id : NP_598531.2

name	Numbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87042277 CCDS:CCDS21016.1 GeneID:18223 MGI:894702
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0007409 - axonogenesis [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007405 - neuroblast proliferation [Evidence IGI] codon_start : 1 product : numb-like protein_id : NP_035080.2

name	Ltbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189330 CCDS:CCDS21017.1 GeneID:108075 MGI:1321395
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0005539 - glycosaminoglycan binding [Evidence ISS]; GO:0019838 - growth factor binding [Evidence IEA]; GO:0005178 - integrin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0007275 - development [Evidence ISS]; GO:0030252 - growth hormone secretion [Evidence ISS]; GO:0046879 - hormone secretion [Evidence IMP]; GO:0006457 - protein folding [Evidence ISS]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0030162 - regulation of proteolysis [Evidence ISS]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence ISS]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IMP] codon_start : 1 exception : mismatches in translation product : latent transforming growth factor beta binding protein 4 protein_id : NP_783572.1

name	Shkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109659851 CCDS:CCDS21018.1 GeneID:192192 MGI:2385803
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 note : SETA binding protein 1 product : Sh3kbp1 binding protein 1 protein_id : NP_619617.2

name	Spnb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174793 CCDS:CCDS21019.1 GeneID:80297 MGI:1890574
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043203 - axon hillock [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence IDA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0019226 - transmission of nerve impulse [Evidence IMP] codon_start : 1 note : beta-spectrin 4; quivering; lumbosacral neuroaxonal dystrophy product : spectrin beta 4 protein_id : NP_115999.2

name	Blvrb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450325 GeneID:233016 MGI:2385271
definition	GO_function : GO:0050662 - coenzyme binding [Evidence IEA]; GO:0042602 - flavin reductase activity [Evidence IEA] GO_process : GO:0044237 - cellular metabolism [Evidence IEA] codon_start : 1 product : biliverdin reductase B (flavin reductase (NADPH)) protein_id : NP_659172.1

name	Sertad3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875358 CCDS:CCDS21021.1 GeneID:170742 MGI:2180697
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : replication protein-binding trans-activator; replication protein binding trans-activator product : SERTA domain containing 3 protein_id : NP_573473.1

name	Sertad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055332 CCDS:CCDS21022.1 GeneID:55942 MGI:1913438
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0030308 - negative regulation of cell growth [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : PHD zinc finger- and bromodomain-interacting protein 1 product : p34SEI-1 protein_id : NP_061290.1

name	Prx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674285 CCDS:CCDS21023.1 GeneID:19153 MGI:108176
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation note : isoform L is encoded by transcript variant 1 product : periaxin isoform L protein_id : NP_932165.1

name	Prx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506999 GeneID:19153 MGI:108176
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : isoform S is encoded by transcript variant 2 product : periaxin isoform S protein_id : NP_062285.1

name	Hipk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701818 CCDS:CCDS21024.1 GeneID:233020 MGI:2685008
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : homeodomain interacting protein kinase 4 protein_id : NP_001028487.1

name	Pld3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7242181 CCDS:CCDS21025.1 GeneID:18807 MGI:1333782
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0004630 - phospholipase D activity [Evidence ISS] codon_start : 1 note : phospholipase D3 product : phospholipase D family, member 3 protein_id : NP_035246.1

name	2310022A10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541874 CCDS:CCDS21026.1 GeneID:66367 MGI:1913617
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66367 protein_id : NP_780316.2

name	Akt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680674 CCDS:CCDS21027.1 GeneID:11652 MGI:104874
definition	GO_component : GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0046328 - regulation of JNK cascade [Evidence IDA] codon_start : 1 note : RAC-beta serine/threonine protein kinase; protein kinase B, beta product : thymoma viral proto-oncogene 2 protein_id : NP_031460.1

name	Ttc9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625933 CCDS:CCDS21028.1 GeneID:73032 MGI:1920282
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : tetratricopeptide repeat domain 9B protein_id : NP_082693.1

name	Map3k10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486847 GeneID:269881 MGI:1346879
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IPI] [Evidence IEA] codon_start : 1 note : MKN28 kinase; mixed lineage kinase 2; serine/threonine kinase; MKN28 derived nonreceptor_type product : mitogen activated protein kinase kinase kinase 10 protein_id : NP_001074761.1

name	C030039L03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259210 CCDS:CCDS21029.1 GeneID:112415 MGI:2148237
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC112415 protein_id : NP_940809.1

name	Zfp60 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476066 CCDS:CCDS21030.1 GeneID:22718 MGI:99207
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 60 protein_id : NP_033586.2

name	Zfp60 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86476064 CCDS:CCDS21030.1 GeneID:22718 MGI:99207
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 60 protein_id : NP_083807.2

name	LOC100043229 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256480 GeneID:100043229
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479832.1

name	LOC100043233 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256482 GeneID:100043233
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479840.1

name	4933426I21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256484 GeneID:71163 MGI:1918413
definition	codon_start : 1 product : hypothetical protein LOC71163 protein_id : XP_622939.3

name	Zfp59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124269715 GeneID:22717 MGI:99206
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : zinc finger protein Mfg-2 product : zinc finger protein 59 protein_id : NP_035892.2

name	4732475C15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625613 GeneID:545938 MGI:3584526
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC545938 protein_id : NP_001019897.2

name	Prkcz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380065 GeneID:404705 MGI:3029152
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : similar to Protein kinase C, zeta protein_id : XP_999385.1 transl_except : (pos:complement(28668399..28668401),aa:OTHER) transl_except : (pos:complement(28668354..28668356),aa:OTHER) transl_except : (pos:complement(28668324..28668326),aa:OTHER) transl_except : (pos:complement(28668198..28668200),aa:OTHER) transl_except : (pos:complement(28668150..28668152),aa:OTHER) transl_except : (pos:complement(28668063..28668065),aa:OTHER) transl_except : (pos:complement(28667967..28667969),aa:OTHER) transl_except : (pos:complement(28667853..28667855),aa:OTHER) transl_except : (pos:complement(28667829..28667831),aa:OTHER)

name	1700049G17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315969 CCDS:CCDS21032.1 GeneID:73430 MGI:1920680
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73430 protein_id : NP_082814.1

name	EG668175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380081 GeneID:668175 MGI:3643781
definition	codon_start : 1 product : similar to LOC635138 protein isoform 2 protein_id : XP_001002407.1

name	LOC100043771 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256668 GeneID:100043771
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481034.1

name	Zfp780b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486618 GeneID:338354 MGI:2444764
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 780B protein_id : NP_001074490.1

name	C130069I09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256672 GeneID:233026 MGI:3036281
definition	codon_start : 1 product : similar to LOC672243 protein isoform 1 protein_id : XP_133337.6

name	LOC100043772 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256670 GeneID:100043772
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481035.1

name	Psmc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248577 CCDS:CCDS21034.1 GeneID:23996 MGI:1346093
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005829 - cytosol [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 note : CAR interacting protein 21; CAR interacing protein 21 product : proteasome 26S ATPase subunit 4 protein_id : NP_036004.2

name	LOC100043774 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256674 GeneID:100043774
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481040.1

name	9530053A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892723 CCDS:CCDS21035.1 GeneID:319482 MGI:2442118
definition	codon_start : 1 product : Fc fragment of IgG binding protein protein_id : NP_795898.1

name	Fbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982373 CCDS:CCDS21036.1 GeneID:14113 MGI:95486
definition	GO_component : GO:0015030 - Cajal body [Evidence TAS] [Evidence IDA]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0030515 - snoRNA binding [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence TAS]; GO:0016074 - snoRNA metabolism [Evidence IMP] codon_start : 1 product : fibrillarin protein_id : NP_032017.2

name	Dyrk1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816922 CCDS:CCDS21037.1 GeneID:13549 MGI:1330302
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007520 - myoblast fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 1 product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b isoform b protein_id : NP_001033046.1

name	Dyrk1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753698 GeneID:13549 MGI:1330302
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007520 - myoblast fusion [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 2 product : dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1b isoform a protein_id : NP_034222.1

name	Eid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259218 CCDS:CCDS21038.1 GeneID:386655 MGI:2681174
definition	GO_component : GO:0005622 - intracellular [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0046332 - SMAD binding [Evidence ISS] GO_process : GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS]; GO:0030512 - negative regulation of transforming growth factor beta receptor signaling pathway [Evidence ISS]; GO:0042127 - regulation of cell proliferation [Evidence ISS]; GO:0007183 - SMAD protein heteromerization [Evidence ISS]; GO:0007181 - transforming growth factor beta receptor complex assembly [Evidence ISS] codon_start : 1 note : E1A like inhibitor of differentiation 2 product : CREBBP/EP300 inhibitory protein 2 protein_id : NP_940817.1

name	LOC434156 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256488 GeneID:434156
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999608.2

name	BC089491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76781476 GeneID:280621 MGI:3608324
definition	GO_function : GO:0008430 - selenium binding [Evidence IEA] GO_process : GO:0045454 - cell redox homeostasis [Evidence IEA] codon_start : 1 product : selenoprotein V protein_id : NP_778198.2 transl_except : (pos:complement(29073505..29073507),aa:Sec)

name	Dll3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116292184 GeneID:13389 MGI:1096877
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005112 - Notch binding [Evidence NAS]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0001709 - cell fate determination [Evidence NAS]; GO:0007386 - compartment specification [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence NAS]; GO:0007399 - nervous system development [Evidence NAS]; GO:0007219 - Notch signaling pathway [Evidence NAS] [Evidence IEA]; GO:0048339 - paraxial mesoderm development [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 product : delta-like 3 protein_id : NP_031892.2

name	Timm50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094989 CCDS:CCDS21039.1 GeneID:66525 MGI:1913775
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005134 - interleukin-2 receptor binding [Evidence ISS]; GO:0004721 - phosphoprotein phosphatase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence ISS]; GO:0004725 - protein tyrosine phosphatase activity [Evidence ISS] GO_process : GO:0007006 - mitochondrial membrane organization and biogenesis [Evidence ISS]; GO:0006470 - protein amino acid dephosphorylation [Evidence ISS]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0001836 - release of cytochrome c from mitochondria [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocase of inner mitochondrial membrane 50 homolog protein_id : NP_079892.1

name	Supt5h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094123 GeneID:20924 MGI:1202400
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : suppressor of Ty 5 homolog protein_id : NP_038704.1

name	Rps16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305445 GeneID:20055 MGI:98118
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence ISS] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : snoRNA MBI-142 product : ribosomal protein S16 protein_id : NP_038675.1

name	Plekhg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144446221 GeneID:101497 MGI:2141874
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; common-site lymphoma/leukemia GEF product : common-site lymphoma/leukemia guanine nucleotide exchange factor isoform b protein_id : NP_001077381.1

name	Plekhg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922716 CCDS:CCDS21040.1 GeneID:101497 MGI:2141874
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; common-site lymphoma/leukemia GEF product : common-site lymphoma/leukemia guanine nucleotide exchange factor isoform a protein_id : NP_620091.2

name	Zfp36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756059 CCDS:CCDS21041.1 GeneID:22695 MGI:99180
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003729 - mRNA binding [Evidence ISS] [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006402 - mRNA catabolism [Evidence ISS]; GO:0050728 - negative regulation of inflammatory response [Evidence IMP]; GO:0045638 - negative regulation of myeloid cell differentiation [Evidence IMP]; GO:0007243 - protein kinase cascade [Evidence IDA]; GO:0043488 - regulation of mRNA stability [Evidence IDA]; GO:0050779 - RNA destabilization [Evidence IMP] codon_start : 1 note : tristetraprolin product : zinc finger protein 36 protein_id : NP_035886.1

name	Ixl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754101 CCDS:CCDS21042.1 GeneID:67224 MGI:1914474
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] codon_start : 1 product : intersex-like protein_id : NP_080318.2

name	Paf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980912 CCDS:CCDS21043.1 GeneID:54624 MGI:1923988
definition	codon_start : 1 product : Paf1, RNA polymerase II associated factor, homolog protein_id : NP_062331.2

name	Samd4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239399 CCDS:CCDS21044.1 GeneID:233033 MGI:2448542
definition	codon_start : 1 exception : mismatches in translation product : sterile alpha motif domain containing 4B protein_id : NP_778186.1

name	1700085B13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256490 GeneID:76721 MGI:1923971
definition	codon_start : 1 product : hypothetical protein LOC76721 protein_id : XP_001479896.1

name	Gmfg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11993950 GeneID:63986 MGI:1927135
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : glia maturation factor, gamma isoform 1 protein_id : NP_071307.1

name	Gmfg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861222 GeneID:63986 MGI:1927135
definition	GO_function : GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : glia maturation factor, gamma isoform 2 protein_id : NP_001034281.1

name	Lrfn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385438 CCDS:CCDS21045.1 GeneID:80749 MGI:2136810
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : synaptic differentiation enhancing molecule 1 product : leucine rich repeat and fibronectin type III domain containing 1 protein_id : NP_085039.1

name	EG330496 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:130494425 GeneID:330496 MGI:3647279
definition	codon_start : 1 note : IFN-lambda2 product : interferon-lambda2 protein_id : NP_001019844.2

name	Il28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893579 CCDS:CCDS21047.1 GeneID:338374 MGI:2450574
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0009615 - response to virus [Evidence IEA] codon_start : 1 note : interferon alpha product : interleukin 28 protein_id : NP_796370.1

name	Sycn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754042 CCDS:CCDS21048.1 GeneID:68416 MGI:1915666
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : syncollin protein_id : NP_080992.2

name	1190020J12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487435 GeneID:233038 MGI:2685009
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233038 protein_id : NP_001074584.1

name	Pak4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336032 CCDS:CCDS21049.1 GeneID:70584 MGI:1917834
definition	GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : p21-activated protein kinase 4 protein_id : NP_081746.1

name	C330005M16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425000 CCDS:CCDS21050.1 GeneID:101744 MGI:2142121
definition	codon_start : 1 product : hypothetical protein LOC101744 protein_id : NP_780528.1

name	Fbxo27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402223 CCDS:CCDS21051.1 GeneID:233040 MGI:2685007
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box only protein 27 protein_id : NP_997121.1

name	Fbxo17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657081 GeneID:50760 MGI:1354707
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0030163 - protein catabolism [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 17 product : F-box protein 17 protein_id : NP_056611.1

name	Mrps12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755360 CCDS:CCDS21052.1 GeneID:24030 MGI:1346333
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : ribosomal protein, mitochondrial, S12; mitoribosomal protein s12 product : mitochondrial ribosomal protein S12 protein_id : NP_036015.1

name	Sars2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963765 CCDS:CCDS21053.1 GeneID:71984 MGI:1919234
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence ISS]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004828 - serine-tRNA ligase activity [Evidence ISS] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006434 - seryl-tRNA aminoacylation [Evidence ISS] codon_start : 1 exception : mismatches in translation product : seryl-aminoacyl-tRNA synthetase 2 protein_id : NP_076126.1

name	EG624918 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380083 GeneID:624918 MGI:3645242
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903616.2

name	Nfkbib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24111253 CCDS:CCDS21054.1 GeneID:18036 MGI:104752
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : I(Kappa)B(beta) product : nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, beta protein_id : NP_035038.2

name	Sirt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982681 CCDS:CCDS21055.1 GeneID:64383 MGI:1927664
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] [Evidence ISS] GO_function : GO:0035035 - histone acetyltransferase binding [Evidence ISS]; GO:0042826 - histone deacetylase binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017136 - NAD-dependent histone deacetylase activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0042903 - tubulin deacetylase activity [Evidence ISS]; GO:0043130 - ubiquitin binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA]; GO:0045843 - negative regulation of striated muscle development [Evidence ISS]; GO:0016481 - negative regulation of transcription [Evidence ISS]; GO:0006980 - redox signal response [Evidence ISS]; GO:0007096 - regulation of exit from mitosis [Evidence ISS]; GO:0042325 - regulation of phosphorylation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : silent mating type information regulation 2, (S.cerevisiae, homolog)-like product : sirtuin 2 (silent mating type information regulation 2, homolog) 2 protein_id : NP_071877.2

name	5830482F20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893141 CCDS:CCDS21056.1 GeneID:320435 MGI:2444024
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC320435 protein_id : NP_796132.1

name	Hnrpl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33667042 GeneID:15388 MGI:104816
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0045120 - pronucleus [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : heterogeneous nuclear ribonucleoprotein L protein_id : NP_796275.2

name	Ech1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949037 CCDS:CCDS21057.1 GeneID:51798 MGI:1858208
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : peroxisomal/mitochondrial dienoyl-CoA isomerase product : enoyl coenzyme A hydratase 1, peroxisomal protein_id : NP_058052.1

name	Lgals4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849705 CCDS:CCDS21058.1 GeneID:16855 MGI:107536
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : lectin, galactose binding, soluble 4 protein_id : NP_034836.1

name	Lgals7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543120 CCDS:CCDS21060.1 GeneID:16858 MGI:1316742
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA] codon_start : 1 product : lectin, galactose binding, soluble 7 protein_id : NP_032522.2

name	Capn12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230800 GeneID:60594 MGI:1891369
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] codon_start : 1 function : protease product : calpain 12 protein_id : NP_068694.1

name	Actn4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230802 CCDS:CCDS21061.1 GeneID:60595 MGI:1890773
definition	GO_component : GO:0030863 - cortical cytoskeleton [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0031143 - pseudopodium [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0051015 - actin filament binding [Evidence IDA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence TAS] GO_process : GO:0051017 - actin filament bundle formation [Evidence IDA]; GO:0051271 - negative regulation of cell motility [Evidence IDA]; GO:0051272 - positive regulation of cell motility [Evidence IDA] [Evidence IMP]; GO:0048549 - positive regulation of pinocytosis [Evidence IMP] codon_start : 1 function : cytoskeleton protein product : actinin alpha 4 protein_id : NP_068695.1

name	Eif3s12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312044 CCDS:CCDS21062.1 GeneID:73830 MGI:1921080
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : eukaryotic translation initiation factor 3, subunit 12 protein_id : NP_082935.1

name	LOC100043199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043199
definition	number : 1 pseudo : _no_value

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 4 pseudo : _no_value

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 3 pseudo : _no_value

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 2 pseudo : _no_value

name	LOC624672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624672
definition	number : 1 pseudo : _no_value

name	1700028B04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256491 GeneID:70001 MGI:1917251
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : RIKEN cDNA 1700028B04 gene transcript_id : XR_034419.1

clone name	MSMg01-333O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-321D14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-100P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211N11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-382H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-054F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277I23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265I10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121J12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129L13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-272O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-299D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484F02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-065D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090P12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139H21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160E10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-297B22.b	B6Ng01-297B22.g
ACC	GA092560	GA092561
length	1,055	1,102
definition	B6Ng01-297B22.b	B6Ng01-297B22.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcacattgttgaagaatcttaactgatgtgggaagaccttaaattg aatagaaaacttggtttgacattctgaatttaatattagtaataaatctt aagatgtaaggaatgaaaaaaaaaagatgtaaggaatgtggaaaggcctt cagtaattccaaactaactgtctatcagagaatcctactggagagaaatt ctatgactttaacaagtaaggtgacaagatgtttagatttagttcagctt tcatgcacagtggcaaattcatacaggggggacaccctatcactggaaag aatgtggaaagaccttcaattgcagcgcaggccttcatcataaaagaacc tatgcttgtgtcaaacactatgaaagcaaggaatgtgggaacatttgtag aataagctgttaaagctcatcagagtctgtgtaggtctgaaacccagtga ttgggaagactcaggaaaagcctttcttgaaaatggtaagcttatacaaa atcagaaaattcataattgtcaggagtcttctgcatgtaaaaaaaggtgg acaagccattgcatgaaaatcctgttacttaaaagaatgtggaaacttta agctgccactggatctggttagcatcacagtattcagatcctcttgatga caggaaaccctttagagaatgtaaggggctagagataaagattcctcttt aatataaatggcccattttaaagttcattgttgtcttttttgactctgca ccaagtgaaggacaacaaattttgcttcatgaagttgctgctgttagaat cttgtcacatcaaaatgagcagacaatccacattgtgacactgagcaaac aattttcttgaatcctttattgtaagggtagagagttaatatctgaaaac acttgagattattaaatgaatgtgccatagtgtttgggcaaggtcttaga tgtcatcactctgttaaacaggagtcatgaagtattatcctaacccataa tgtaatatgaactatggttaatggcattttacttcttaagcgaaagtcga ctgag	gaattcttacccaggttgctttttcttccttctctgaattcttttcctca gcattattttggcttctagaagcttttaatccgtttttccaagataaggg tcttgctatgcagggtaaatggtatggctcatttcctccatgctggcctc acaaagcatgatccactgagcccagctgtatagatctttataataaatgt gtatttttaaaatctacacaagcagggaatagtggcctttagtcccagcg tttgggaggcagaggcaagcagatcatgtaaattcaaggccaggctgatg taatatgttctctatatcctgggattattaaaagagacccagtcccaatg aatgaatgaatgaatgaatgaaaatctacacaatgagtcatctctttctt tcgtttaagtgggacgttgcatttccaagccagatctgatcgtcttacta gagcaggagaaagagccctggatggctgtgaaggaagaaacagacaggcc gagcccaggtgagtaagagtgaagtgattcattattggttgtgtgcgcac acacgtgtgcaggtatcctaagaggccctagagagggtcagctccctggg ctggagttataggggctgctgggtctctaacccagggcctcgggcagagc tctcagagttcttgaccactgaaccaaagccaagacggtttcagcagcat tgacagctgtaacgcagggaggggcaccaaatgtctgaattctgtgtctt cgtggtcactgtagtcacggtgtgatggtggcgcctccctgcagcactgg ggaggtggcaaggcagatcccttgggcttgctggcaagtcagctccaggc aatgagagaccctgactcacaagcacagatggacagccagggggacatct gagtgcatataccacacagccttctacctagcttgggcaggagctgttga tggtttttctagttcgcaattgactaggactaactaaaatccaggcatct gagtaccacctatgagcagattttgttagtaagtaatttgaagtaggaga cccaccttttatccacatccttttgagattgggagaccaacgttaacatc tg
quality values	Open. Hide. 58 29 27 23 46 32 18 25 24 29 31 42 33 17 22 22 21 19 28 16 16 18 18 24 24 12 18 18 20 13 9 22 23 21 16 20 21 18 16 37 39 25 22 22 16 22 22 24 24 22 14 16 18 17 13 34 30 34 43 30 24 24 23 12 15 13 13 24 24 26 19 18 19 18 19 23 20 23 23 23 23 19 24 34 30 30 16 22 13 16 19 28 17 13 18 18 30 24 18 11 18 15 14 30 18 34 13 18 34 18 46 31 39 34 46 46 30 43 41 30 30 30 30 24 24 27 37 30 34 28 30 29 23 50 39 39 43 51 43 50 43 38 39 34 50 56 39 43 43 43 40 43 28 20 30 24 27 34 34 34 34 41 43 43 49 41 34 43 43 51 34 50 49 49 43 43 34 13 43 20 41 34 34 34 37 38 41 49 49 51 43 40 27 43 27 39 40 50 51 51 46 35 30 40 39 51 41 51 46 36 30 30 34 24 24 24 30 27 34 30 56 30 51 49 51 34 43 40 46 43 49 40 34 34 39 18 43 39 34 34 30 24 41 41 43 39 23 49 51 43 46 50 41 49 56 43 30 43 34 41 34 56 43 41 34 34 41 34 30 30 18 30 24 34 30 43 59 49 51 59 56 59 43 30 41 34 34 27 28 34 34 34 43 38 46 40 43 43 43 34 51 43 43 51 34 43 41 51 45 36 45 59 51 51 50 46 49 39 40 46 49 51 43 30 24 40 34 43 43 26 56 41 43 41 34 40 30 34 49 27 39 34 27 36 41 30 56 49 49 49 30 30 30 34 34 31 46 56 43 51 49 43 41 41 51 49 43 43 46 43 49 38 46 51 51 43 51 30 43 37 50 51 49 49 56 41 49 43 43 51 51 56 43 51 51 43 43 34 39 30 32 46 49 41 43 27 46 49 59 43 43 39 37 43 34 43 43 49 43 34 34 30 19 48 23 27 39 34 43 34 51 49 41 41 51 39 43 39 38 46 45 38 56 46 46 45 39 36 59 44 43 45 51 51 41 51 50 39 62 44 51 43 39 30 51 59 43 45 43 32 41 45 43 41 51 43 34 41 45 43 34 56 51 43 56 45 30 41 51 56 56 56 42 51 51 51 56 29 32 32 39 35 35 32 19 56 42 51 42 35 35 35 29 32 38 38 39 51 56 39 51 42 42 62 54 51 50 56 51 42 51 34 38 39 31 51 56 56 39 50 43 50 42 50 46 39 47 42 56 50 56 46 42 46 26 42 42 33 39 46 56 47 42 56 47 50 35 38 38 42 50 47 41 52 50 43 52 49 49 41 43 52 47 44 46 62 41 48 52 42 52 42 52 42 33 48 50 41 41 36 42 32 52 52 40 40 39 42 37 41 45 34 41 52 52 52 52 54 32 35 37 32 37 32 46 39 28 42 31 23 42 49 38 42 42 39 24 43 46 35 34 37 50 52 52 52 54 34 54 54 33 25 33 48 30 30 34 41 50 46 40 46 33 47 31 52 34 50 47 37 53 34 41 33 22 50 19 34 27 42 50 32 53 32 35 10 10 21 19 25 19 17 29 39 35 32 28 32 40 21 18 44 22 39 40 37 46 18 41 37 15 9 28 14 13 25 35 50 32 32 16 23 15 19 17 19 26 40 18 35 31 14 6 28 41 16 35 31 31 35 37 39 37 39 41 50 39 32 37 17 25 16 18 46 44 23 28 25 29 13 22 35 23 32 25 38 15 23 39 39 25 14 30 41 33 26 35 32 28 21 39 29 14 9 10 21 40 35 23 32 8 25 31 24 21 23 17 30 18 30 30 24 27 40 18 25 21 23 37 52 17 9 26 44 17 33 37 31 7 31 19 14 30 10 11 11 7 17 27 19 34 31 53 29 40 11 25 34 29 23 31 34 29 22 14 32 29 18 22 14 11 9 6 36 45 25 19 18 23 33 11 14 26 14 15 15 19 14 9 27 8 22 30 16 24 10 15 18 12 14 5 31 21 32 23 29 22 14 21 5 16 21 12 9 24 31 35 37 42 30 7 14 12 19 28 32 6 9 13 46 21 19 21 19 33 9 13 35 25 30 26 41 30 27 8 31 32 13 12 13 5 14 13 14 10 20 21 30 27 9 18 31 29 31 26 9 36 9 31 30 25 23 24 26 13 18 9 9 11 22 12 5 8 13 9 9 22 20 20 13 17 6 32 6 12 8 11 13 19 16 17 14 10 11 8 18 27 11 14 16 6 6 6 9 22 10 6 4 12 34 13 33 6 9 9 13 9 18 20 23 25 5 20 14 18 28 29 7 31 17 21 17 10 11 6 5 30 36 37 32 9 25 12 7 11 25 11 4 13 12 21 5 4 4 12 3 5 21 5 10 10 16 21 16 3	Open. Hide. 62 59 43 59 59 59 34 39 51 43 45 49 15 18 28 30 30 34 23 23 23 13 13 13 18 18 13 13 41 43 41 40 30 39 49 51 36 34 30 30 30 24 40 43 41 34 24 19 23 12 13 19 24 43 30 18 31 35 34 27 25 26 23 34 34 21 33 30 12 29 18 19 31 40 40 30 34 19 13 23 24 18 19 24 38 50 50 34 41 34 24 41 24 51 43 40 34 30 56 43 43 43 43 37 56 49 43 39 34 35 39 31 24 51 49 43 51 49 49 51 59 56 30 41 43 51 51 39 49 49 34 37 37 39 37 35 39 41 43 43 34 49 43 35 49 51 43 51 49 49 43 49 41 30 31 24 32 31 34 43 39 41 40 43 34 43 49 34 27 17 34 34 34 40 30 40 38 38 33 34 39 34 30 49 49 43 41 31 30 30 30 30 34 49 34 34 43 35 46 36 50 36 43 49 43 51 43 50 40 41 41 40 49 43 34 34 49 30 49 34 49 40 49 43 34 59 46 46 50 51 51 34 34 56 43 36 46 46 49 38 50 30 43 51 41 34 30 19 34 30 40 43 40 56 49 49 59 34 46 30 30 24 51 34 51 41 34 41 32 41 24 18 49 51 41 34 46 50 43 34 35 40 39 35 39 34 30 40 59 40 43 39 34 49 40 49 49 49 49 49 49 41 43 43 49 43 50 51 49 51 35 38 39 41 51 41 46 49 56 38 59 43 56 38 36 40 34 43 30 30 34 34 36 28 50 30 49 43 43 43 34 24 41 49 43 38 39 41 49 51 51 49 43 51 51 43 49 56 59 51 49 56 51 46 45 51 56 43 51 51 51 43 45 45 45 45 43 41 43 34 45 30 34 34 51 43 34 43 43 43 51 51 51 51 51 56 59 43 41 43 39 41 24 41 43 39 34 41 34 50 56 51 51 47 44 35 35 35 32 25 31 38 31 27 27 28 25 42 24 38 35 24 35 51 56 39 42 42 51 50 31 18 22 30 30 31 38 31 33 32 23 43 34 42 51 26 56 51 32 51 42 38 31 56 32 34 39 33 33 39 23 47 39 46 43 30 37 39 39 42 43 39 27 50 50 42 37 56 42 42 42 32 24 43 42 29 33 50 33 42 30 42 27 27 35 34 30 26 33 27 39 39 42 42 46 38 27 52 30 39 42 52 52 39 41 52 42 42 46 41 39 42 39 39 30 20 37 35 32 33 47 32 52 42 50 35 31 42 26 35 26 42 32 46 32 39 41 38 42 39 39 26 52 30 35 29 27 29 35 32 27 23 41 26 42 17 19 19 23 23 15 46 32 50 27 42 33 33 34 34 33 35 40 32 33 29 36 41 33 47 34 41 42 47 30 26 34 32 32 32 37 27 42 42 33 35 34 46 32 32 37 40 19 17 21 31 29 29 33 30 22 25 23 26 15 36 50 26 21 21 29 16 15 27 28 31 32 53 23 23 30 31 34 42 31 13 40 21 25 24 31 39 27 38 39 30 22 19 29 33 43 43 50 42 15 14 32 40 26 31 32 21 39 22 32 28 27 40 32 33 34 32 18 25 31 32 13 30 38 52 39 31 32 31 29 29 23 24 32 45 35 40 32 23 32 32 9 35 37 28 33 42 40 31 28 29 37 40 35 28 37 32 37 31 36 32 32 41 39 33 44 29 38 35 29 35 18 23 26 24 31 21 24 32 22 15 32 27 32 32 41 18 23 6 32 34 45 31 26 32 10 29 21 31 36 24 23 21 22 31 31 31 25 31 31 31 33 32 31 28 31 35 26 12 31 31 31 29 24 30 29 36 37 27 31 22 30 29 15 11 7 11 30 28 20 30 30 20 23 29 23 31 31 31 16 20 9 15 30 30 24 30 27 22 22 28 12 10 14 26 23 10 21 33 24 12 6 6 10 28 27 22 26 31 32 21 23 13 29 23 27 27 31 31 21 12 17 25 23 20 23 19 20 24 11 24 24 7 32 32 31 28 31 15 25 8 9 11 9 22 33 29 27 31 33 19 19 37 28 37 22 30 20 24 31 24 24 17 10 30 23 26 16 31 21 12 14 9 12 21 13 10 37 34 27 17 13 7 16 24 33 32 19 27 13 21 8 15 4 4 6 4 5 16 30 9 6 8 5 11 22 17 13 5 16 26 25 12 6 6 11 15 10 20 7 19 22 30 19 32 21 18 13 22 21 9 5 4 12 15 11 9 7 18 15 16 27 13 9 9 7 11 8 5 11 15 8 7 13 6 10 11 5 11 6 5 6 6 25 16 14 17 21 12 6 4 4 7 7 17 9 19 4 7 21 9 15 15 8 14 12 19 4 5 9 10 22 22 23 6 12 17 9 8 5 6 6 21 6 22 6 19 19 8 13 22 7 18 27 16 16 6 6 22 5 7 9 12 5 6 6 22 5 9 12 8 4 7 7 4 14 17 14 17 6 6 5 8 5 4 3 1 9 6 11 9 3 1 2 6 7 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_28756044_28757149
seq2: B6Ng01-297B22.g_67_1168 (reverse)

seq1  CAGATG-TAAGGTGGGTCTTCCCATCTCAAAA-GATGTGGATTAAAGGTG  48
      |||||| ||| || ||||| || ||||||||| ||||||||| |||||||
seq2  CAGATGTTAACGTTGGTCTCCCAATCTCAAAAGGATGTGGATAAAAGGTG  50

seq1  GGTCTTCCTACTTTAAATACTTTACTTAACAAAAATCT-CTCATAGGT-G  96
      |||| |||||||| ||||   |||| |||| ||||||| ||||||||| |
seq2  GGTC-TCCTACTTCAAATTACTTAC-TAAC-AAAATCTGCTCATAGGTGG  97

seq1  TACTCAGATGCTTGGATTTTAGTTAGTTCCTAGTCAATTTGCCAACTAAG  146
      ||||||||||| |||||||||||||| |||||||||| |||| |||||  
seq2  TACTCAGATGCCTGGATTTTAGTTAG-TCCTAGTCAA-TTGCGAACTAGA  145

seq1  AAAACCATC-ACAGCTCCCTGCCAAGCTAGGTAGAAGGCTGTGTGGTATA  195
      ||||||||| ||||||||   |||||||||||||||||||||||||||||
seq2  AAAACCATCAACAGCTCCTGCCCAAGCTAGGTAGAAGGCTGTGTGGTATA  195

seq1  TGCACTCAGATGTCCCCCTGGCTTGTCCATCTGTGCTTTGTGAGTCAGGG  245
      |||||||||||||||||||||| ||||||||||||| |||||||||||||
seq2  TGCACTCAGATGTCCCCCTGGC-TGTCCATCTGTGC-TTGTGAGTCAGGG  243

seq1  TCTCTCATTTGCCTGGAGCTGACTTGCCAGCAAGCCCAAGGGATCTGCCT  295
      ||||||| ||||||||||||||||||||||||||||||||||||||||| 
seq2  TCTCTCA-TTGCCTGGAGCTGACTTGCCAGCAAGCCCAAGGGATCTGCC-  291

seq1  TTGCCACCTCCCCAGTGCTGCAGGGAGGCGCCACCATCACACCGTGACTA  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCACCTCCCCAGTGCTGCAGGGAGGCGCCACCATCACACCGTGACTA  341

seq1  CAGTGACCACGAAGACACAGAATTCAGACATTTGGTGCCCCTCCCTGCGT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGACCACGAAGACACAGAATTCAGACATTTGGTGCCCCTCCCTGCGT  391

seq1  TACAGCTGTCAATGCTGCTGAAACCGTCTTGGCTTTGGTTCAGTGGTCAA  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGCTGTCAATGCTGCTGAAACCGTCTTGGCTTTGGTTCAGTGGTCAA  441

seq1  GAACTCTGAGAGCTCTGCCCGAGGCCCTGGGTTAGAGACCCAGCAGCCCC  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTCTGAGAGCTCTGCCCGAGGCCCTGGGTTAGAGACCCAGCAGCCCC  491

seq1  TATAACTCCAGCCCAGGGAGCTGACCCTCTCTAGGGCCTCTTAGGATACC  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAACTCCAGCCCAGGGAGCTGACCCTCTCTAGGGCCTCTTAGGATACC  541

seq1  TGCACACGTGTGTGCGCACACAACCAATAATGAATCACTTCACTCTTACT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCACACGTGTGTGCGCACACAACCAATAATGAATCACTTCACTCTTACT  591

seq1  CACCTGGGCTCGGCCTGTCTGTTTCTTCCTTCACAGCCATCCAGGGCTCT  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTGGGCTCGGCCTGTCTGTTTCTTCCTTCACAGCCATCCAGGGCTCT  641

seq1  TTCTCCTGCTCTAGTAAGACGATCAGATCTGGCTTGGAAATGCAACGTCC  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCCTGCTCTAGTAAGACGATCAGATCTGGCTTGGAAATGCAACGTCC  691

seq1  CACTTAAACGAAAGAAAGAGATGACTCATTGTGTAGATTTTCATTCATTC  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTAAACGAAAGAAAGAGATGACTCATTGTGTAGATTTTCATTCATTC  741

seq1  ATTCATTCATTCATTGGGACTGGGTCTCTTTTAATAATCCCAGGATATAG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCATTCATTCATTGGGACTGGGTCTCTTTTAATAATCCCAGGATATAG  791

seq1  AGAACATATTACATCAGCCTGGCCTTGAATTTACATGATCTGCTTGCCTC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACATATTACATCAGCCTGGCCTTGAATTTACATGATCTGCTTGCCTC  841

seq1  TGCCTCCCAAACGCTGGGACTAAAGGCCACTATTCCCTGCTTGTGTAGAT  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTCCCAAACGCTGGGACTAAAGGCCACTATTCCCTGCTTGTGTAGAT  891

seq1  TTTAAAAATACACATTTATTATAAAGATCTATACAGCTGGGCTCAGTGGA  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAAAATACACATTTATTATAAAGATCTATACAGCTGGGCTCAGTGGA  941

seq1  TCATGCTTTGTGAGGCCAGCATGGAGGAAATGAGCCATACCATTTACCCT  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGCTTTGTGAGGCCAGCATGGAGGAAATGAGCCATACCATTTACCCT  991

seq1  GCATAGCAAGACCCTTATCTTGGAAAAACGGATTAAAAGCTTCTAGAAGC  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATAGCAAGACCCTTATCTTGGAAAAACGGATTAAAAGCTTCTAGAAGC  1041

seq1  CAAAATAATGCTGAGGAAAAGAATTCAGAGAAGGAAGAAAAAGCAACCTG  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAATAATGCTGAGGAAAAGAATTCAGAGAAGGAAGAAAAAGCAACCTG  1091

seq1  GGTAAGAATTC  1106
      |||||||||||
seq2  GGTAAGAATTC  1102

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information