MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-321G21
Chromosome	7 (Build37)
Map Location	107,180,827 - 107,312,113
singlet/doublet	doublet
Overlap gene	Chrdl2, Pold3, 2610209A20Rik
Upstream gene	Uvrag, Dgat2, Mogat2, Mtap6, Serpinh1, Gdpd5, 2810406K13Rik, Rps3, Rnu15-b, EG449630, Arrb1, EG245190, Slco2b1, Olfr520, Olfr521, Neu3, Spcs2, Xrra1, EG330602
Downstream gene	Kcne3, LOC631577, Pgm2l1, Gpx2-ps1, P4ha3, Ppme1, AU020772, Ucp3, Ucp2, Dnajb13, LOC667112, Chchd8, Mrpl48, LOC100041155, Rab6, LOC100041167, Plekhb1, B930006L02Rik, LOC100041204, Tnfrsf19l, Arhgef17, P2ry6, P2ry2, LOC100049539, EG435996, Fchsd2, EG622673
Link	Open Mouse BAC browser

Click to get alignment info.

name	Uvrag (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78610 MGI:1925860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67800 MGI:1915050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mogat2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233549 MGI:2663253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17760 MGI:1201690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Serpinh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12406 MGI:88283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdpd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233552 MGI:2686926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810406K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72184 MGI:1919434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 27 Proteins

name	Rps3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27050 MGI:1350917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnu15-b (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:449631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG449630 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:449630 MGI:3645887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arrb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109689 MGI:99473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG245190 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245190 MGI:3646425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 5 Proteins

name	Slco2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101488 MGI:1351872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr520 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259066 MGI:3030354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr521 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258353 MGI:3030355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neu3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50877 MGI:1355305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spcs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66624 MGI:1913874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xrra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:446101 MGI:2181647
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 2 Proteins

name	EG330602 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330602 MGI:3643844
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrdl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69121 MGI:1916371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pold3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67967 MGI:1915217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610209A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67164 MGI:1914414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcne3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57442 MGI:1891124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631577 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631577
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	Pgm2l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70974 MGI:1918224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpx2-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14777 MGI:106627
definition	gene_synonym : AU041318 note : glutathione peroxidase 2, pseudogene 1 pseudo : _no_value

name	P4ha3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320452 MGI:2444049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppme1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72590 MGI:1919840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU020772 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277939 MGI:2142166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ucp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22229 MGI:1099787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ucp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22228 MGI:109354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69387 MGI:1916637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667112 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Chchd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68185 MGI:1915435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52443 MGI:1289321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 1 Protein pseudo : _no_value

name	Rab6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19346 MGI:894313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Plekhb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27276 MGI:1351469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930006L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319604 MGI:2442372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 mRNAs, 3757 ESTs, 25 Proteins

name	Tnfrsf19l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320100 MGI:2443373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207212 MGI:2673002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2ry6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233571 MGI:2673874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2ry2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18442 MGI:105107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100049539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100049539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG435996 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435996 MGI:3645951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Fchsd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207278 MGI:2448475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622673 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622673 MGI:3643600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 677 ESTs, 6 Proteins

name	Uvrag (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982283 GeneID:78610 MGI:1925860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UV radiation resistance associated gene transcript_id : NM_178635.2

name	Dgat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129808 GeneID:67800 MGI:1915050
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 2 transcript_id : NM_026384.3

name	Mogat2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328427 GeneID:233549 MGI:2663253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoacylglycerol O-acyltransferase 2 transcript_id : NM_177448.3

name	Mtap6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113204612 GeneID:17760 MGI:1201690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 6 transcript_id : NM_010837.3

name	Mtap6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520591 GeneID:17760 MGI:1201690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 6 transcript_id : NM_001048167.1

name	Mtap6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520593 GeneID:17760 MGI:1201690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 6 transcript_id : NM_001043355.2

name	Serpinh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753303 GeneID:12406 MGI:88283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade H, member 1 transcript_id : NM_009825.1

name	Gdpd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52345430 GeneID:233552 MGI:2686926
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerophosphodiester phosphodiesterase domain containing 5 transcript_id : NM_201352.2

name	2810406K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380877 GeneID:72184 MGI:1919434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 27 Proteins product : RIKEN cDNA 2810406K13 gene, transcript variant 1 transcript_id : XM_133597.5

name	Rps3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270974 GeneID:27050 MGI:1350917
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S3 transcript_id : NM_012052.2

name	Arrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750059 GeneID:109689 MGI:99473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin, beta 1 transcript_id : NM_177231.2

name	Arrb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:79750060 GeneID:109689 MGI:99473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin, beta 1 transcript_id : NM_178220.3

name	EG245190 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380878 GeneID:245190 MGI:3646425
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 18 ESTs, 5 Proteins product : predicted gene, EG245190 transcript_id : XM_486328.4

name	Slco2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378388 GeneID:101488 MGI:1351872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier organic anion transporter family, member 2b1 transcript_id : NM_175316.3

name	Olfr520 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128832 GeneID:259066 MGI:3030354
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 520 transcript_id : NM_147063.1

name	Olfr521 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129586 GeneID:258353 MGI:3030355
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 521 transcript_id : NM_146356.1

name	Neu3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131105 GeneID:50877 MGI:1355305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuraminidase 3 transcript_id : NM_016720.2

name	Spcs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364005 GeneID:66624 MGI:1913874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal peptidase complex subunit 2 homolog (S. cerevisiae) transcript_id : NM_025668.3

name	Xrra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257605 GeneID:446101 MGI:2181647
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 2 Proteins product : X-ray radiation resistance associated 1 transcript_id : XM_194369.7

name	EG330602 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34303996 GeneID:330602 MGI:3643844
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG330602 transcript_id : NM_183313.1

name	Chrdl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982586 GeneID:69121 MGI:1916371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chordin-like 2 transcript_id : NM_133709.2

name	Pold3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802038 GeneID:67967 MGI:1915217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (DNA-directed), delta 3, accessory subunit transcript_id : NM_133692.2

name	2610209A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385513 GeneID:67164 MGI:1914414
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610209A20 gene transcript_id : NM_026010.1

name	Kcne3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386703 GeneID:57442 MGI:1891124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, Isk-related subfamily, gene 3 transcript_id : NM_020574.4

name	Pgm2l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381668 GeneID:70974 MGI:1918224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoglucomutase 2-like 1 transcript_id : NM_027629.2

name	P4ha3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674233 GeneID:320452 MGI:2444049
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III transcript_id : NM_177161.3

name	Ppme1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130470 GeneID:72590 MGI:1919840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase methylesterase 1 transcript_id : NM_028292.2

name	AU020772 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347499 GeneID:277939 MGI:2142166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU020772 transcript_id : NM_001017985.2

name	Ucp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892795 GeneID:22229 MGI:1099787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uncoupling protein 3 (mitochondrial, proton carrier) transcript_id : NM_009464.3

name	Ucp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801756 GeneID:22228 MGI:109354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uncoupling protein 2 (mitochondrial, proton carrier) transcript_id : NM_011671.3

name	Dnajb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29648321 GeneID:69387 MGI:1916637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) related, subfamily B, member 13 transcript_id : NM_153527.2

name	Chchd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948296 GeneID:68185 MGI:1915435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 8 transcript_id : NM_183270.2

name	Mrpl48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38505260 GeneID:52443 MGI:1289321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L48 transcript_id : NM_198831.1

name	Mrpl48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38505258 GeneID:52443 MGI:1289321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L48 transcript_id : NM_026971.2

name	Rab6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801837 GeneID:19346 MGI:894313
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB6, member RAS oncogene family transcript_id : NM_024287.3

name	Plekhb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802374 GeneID:27276 MGI:1351469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family B (evectins) member 1 transcript_id : NM_013746.2

name	B930006L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592074 GeneID:319604 MGI:2442372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930006L02 gene transcript_id : NM_178764.3

name	LOC100041204 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257622 GeneID:100041204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 mRNAs, 3757 ESTs, 25 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript_id : XM_001475962.1

name	Tnfrsf19l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376970 GeneID:320100 MGI:2443373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 19-like transcript_id : NM_177073.4

name	Arhgef17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487438 GeneID:207212 MGI:2673002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 17 transcript_id : NM_001081116.1

name	P2ry6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147202 GeneID:233571 MGI:2673874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrimidinergic receptor P2Y, G-protein coupled, 6 transcript_id : NM_183168.1

name	P2ry2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354330 GeneID:18442 MGI:105107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2Y, G-protein coupled 2 transcript_id : NM_008773.3

name	LOC100049539 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257608 GeneID:100049539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG667495 transcript_id : XM_001487794.1

name	EG435996 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82907276 GeneID:435996 MGI:3645951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG435996 transcript_id : XM_488060.2

name	Fchsd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39841024 GeneID:207278 MGI:2448475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCH and double SH3 domains 2 transcript_id : NM_199012.1

name	EG622673 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380859 GeneID:622673 MGI:3643600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 677 ESTs, 6 Proteins product : predicted gene, EG622673 transcript_id : XM_889462.2

name	Uvrag (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982284 CCDS:CCDS21476.1 GeneID:78610 MGI:1925860
definition	codon_start : 1 exception : mismatches in translation product : UV radiation resistance associated protein_id : NP_848750.2

name	Dgat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16975490 CCDS:CCDS21477.1 GeneID:67800 MGI:1915050
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS] [Evidence IDA] GO_function : GO:0003846 - 2-acylglycerol O-acyltransferase activity [Evidence IDA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004144 - diacylglycerol O-acyltransferase activity [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006071 - glycerol metabolism [Evidence IEA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0019432 - triacylglycerol biosynthesis [Evidence ISS] [Evidence IMP] [Evidence IDA] codon_start : 1 note : diacylglycerol acyltransferase 2 product : diacylglycerol O-acyltransferase 2 protein_id : NP_080660.1

name	Mogat2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28974982 CCDS:CCDS21478.1 GeneID:233549 MGI:2663253
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003846 - 2-acylglycerol O-acyltransferase activity [Evidence ISS] [Evidence IDA]; GO:0016407 - acetyltransferase activity [Evidence IDA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006651 - diacylglycerol biosynthesis [Evidence IDA]; GO:0006071 - glycerol metabolism [Evidence IEA]; GO:0050892 - intestinal absorption [Evidence IDA]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IDA]; GO:0046462 - monoacylglycerol metabolism [Evidence ISS]; GO:0019432 - triacylglycerol biosynthesis [Evidence IDA] codon_start : 1 note : acyl CoA:monoacylglycerol acyltransferase 2; mannoside acetylglucosaminyltransferase 1-like product : monoacylglycerol O-acyltransferase 2 protein_id : NP_803231.1

name	Mtap6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113204613 CCDS:CCDS21479.1 GeneID:17760 MGI:1201690
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : microtubule-associated protein 6 isoform 1 protein_id : NP_034967.2

name	Mtap6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114520592 GeneID:17760 MGI:1201690
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : microtubule-associated protein 6 isoform 2 protein_id : NP_001041632.1

name	Mtap6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114520594 GeneID:17760 MGI:1201690
definition	GO_component : GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : microtubule-associated protein 6 isoform 3 protein_id : NP_001036820.2

name	Serpinh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753304 CCDS:CCDS21480.1 GeneID:12406 MGI:88283
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IDA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0009408 - response to heat [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : collagen binding protein 1; serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1; serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2; beta enolase repressor factor 1; serine (or cysteine) proteinase inhibitor, clade H, member 2 product : serine (or cysteine) proteinase inhibitor, clade H, member 1 protein_id : NP_033955.1

name	Gdpd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52345431 CCDS:CCDS21481.1 GeneID:233552 MGI:2686926
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008889 - glycerophosphodiester phosphodiesterase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006071 - glycerol metabolism [Evidence IEA] codon_start : 1 product : glycerophosphodiester phosphodiesterase domain containing 5 protein_id : NP_958740.2

name	2810406K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907178 GeneID:72184 MGI:1919434
definition	codon_start : 1 product : hypothetical protein LOC72184 isoform 1 protein_id : XP_133597.3

name	Rps3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755372 GeneID:27050 MGI:1350917
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : ribosomal protein S3 protein_id : NP_036182.1

name	Arrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089716 GeneID:109689 MGI:99473
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform A is encoded by transcript variant a; arrestin, beta 1, isoform B; beta-arrestin1 product : arrestin, beta 1 isoform A protein_id : NP_796205.1

name	Arrb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30089688 CCDS:CCDS21484.1 GeneID:109689 MGI:99473
definition	GO_component : GO:0005622 - intracellular [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform B is encoded by transcript variant b; arrestin, beta 1, isoform B; beta-arrestin1 product : arrestin, beta 1 isoform B protein_id : NP_835738.1

name	EG245190 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51829389 GeneID:245190 MGI:3646425
definition	codon_start : 1 product : similar to hCG1820409 protein_id : XP_486328.1

name	Slco2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789421 CCDS:CCDS21485.1 GeneID:101488 MGI:1351872
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : solute carrier family 21 (organic anion transporter), member 9 product : solute carrier organic anion transporter family, member 2b1 protein_id : NP_780525.1

name	Olfr520 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128833 CCDS:CCDS21486.1 GeneID:259066 MGI:3030354
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-2411789-2412739; olfactory receptor MOR101-1 product : olfactory receptor 520 protein_id : NP_667274.1

name	Olfr521 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129587 CCDS:CCDS21487.1 GeneID:258353 MGI:3030355
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PBJ9-2443810-2444775; olfactory receptor MOR101-2 product : olfactory receptor 521 protein_id : NP_666468.1

name	Neu3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710068 CCDS:CCDS21489.1 GeneID:50877 MGI:1355305
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0016997 - alpha-sialidase activity [Evidence ISS]; GO:0004308 - exo-alpha-sialidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : membrane sialidase; ganglioside sialidase product : neuraminidase 3 protein_id : NP_057929.1

name	Spcs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385134 GeneID:66624 MGI:1913874
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA]; GO:0005787 - signal peptidase complex [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0009003 - signal peptidase activity [Evidence IEA] GO_process : GO:0006465 - signal peptide processing [Evidence IEA] codon_start : 1 product : signal peptidase complex subunit 2 homolog protein_id : NP_079944.1

name	Xrra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907272 GeneID:446101 MGI:2181647
definition	codon_start : 1 product : X-ray radiation resistance associated 1 protein_id : XP_194369.5

name	EG330602 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34303997 GeneID:330602 MGI:3643844
definition	codon_start : 1 product : hypothetical protein LOC330602 protein_id : NP_899136.1

name	Chrdl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982587 CCDS:CCDS21492.1 GeneID:69121 MGI:1916371
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0051216 - cartilage development [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0030514 - negative regulation of BMP signaling pathway [Evidence IDA]; GO:0001503 - ossification [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chordin like 2 product : chordin-like 2 protein_id : NP_598470.2

name	Pold3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789321 CCDS:CCDS21493.1 GeneID:67967 MGI:1915217
definition	GO_component : GO:0043625 - delta DNA polymerase complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003891 - delta DNA polymerase activity [Evidence ISS]; GO:0003887 - DNA-directed DNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0000731 - DNA synthesis during DNA repair [Evidence ISS]; GO:0006298 - mismatch repair [Evidence ISS] codon_start : 1 note : GC12 product : polymerase (DNA directed), delta 3 protein_id : NP_598453.1

name	2610209A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385514 CCDS:CCDS21494.1 GeneID:67164 MGI:1914414
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67164 protein_id : NP_080286.1

name	Kcne3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181220 CCDS:CCDS21495.1 GeneID:57442 MGI:1891124
definition	GO_component : GO:0008076 - voltage-gated potassium channel complex [Evidence ISS] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence ISS]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : minK-related peptide 2 product : potassium voltage-gated channel, Isk-related subfamily, gene 3 protein_id : NP_065599.1

name	Pgm2l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076969 GeneID:70974 MGI:1918224
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004614 - phosphoglucomutase activity [Evidence IEA] GO_process : GO:0006006 - glucose metabolism [Evidence IEA] codon_start : 1 product : phosphoglucomutase 2-like 1 protein_id : NP_081905.1

name	P4ha3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674234 CCDS:CCDS21496.1 GeneID:320452 MGI:2444049
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0019538 - protein metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : collagen prolyl 4-hydroxylase alpha 3 protein_id : NP_796135.2

name	Ppme1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794138 GeneID:72590 MGI:1919840
definition	GO_function : GO:0016789 - carboxylic ester hydrolase activity [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0051722 - protein C-terminal methylesterase activity [Evidence ISS]; GO:0051721 - protein phosphatase 2A binding [Evidence ISS]; GO:0008601 - protein phosphatase type 2A regulator activity [Evidence ISS]; GO:0004759 - serine esterase activity [Evidence IEA] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0006482 - protein amino acid demethylation [Evidence ISS] codon_start : 1 product : protein phosphatase methylesterase 1 protein_id : NP_082568.1

name	AU020772 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347500 GeneID:277939 MGI:2142166
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC277939 protein_id : NP_001017985.2

name	Ucp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678495 CCDS:CCDS21497.1 GeneID:22229 MGI:1099787
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IMP] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0017077 - oxidative phosphorylation uncoupler activity [Evidence IMP]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IMP]; GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0000303 - response to superoxide [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : uncoupling protein 3, mitochondrial product : uncoupling protein 3 (mitochondrial, proton carrier) protein_id : NP_033490.1

name	Ucp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543920 CCDS:CCDS21498.1 GeneID:22228 MGI:109354
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : uncoupling protein 2, mitochondrial product : uncoupling protein 2 (mitochondrial, proton carrier) protein_id : NP_035801.2

name	Dnajb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29648322 CCDS:CCDS21499.1 GeneID:69387 MGI:1916637
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : spermatogenesis apoptosis-related protein protein_id : NP_705755.2

name	Chchd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304060 GeneID:68185 MGI:1915435
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 8 protein_id : NP_899093.1

name	Mrpl48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38505259 GeneID:52443 MGI:1289321
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : mitochondrial ribosomal protein L48 isoform 1 protein_id : NP_081247.2

name	Mrpl48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38505261 CCDS:CCDS21502.1 GeneID:52443 MGI:1289321
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : mitochondrial ribosomal protein L48 isoform 2 protein_id : NP_942128.1

name	Rab6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195674 CCDS:CCDS21503.1 GeneID:19346 MGI:894313
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB6A, member RAS oncogene family protein_id : NP_077249.1

name	Plekhb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305379 CCDS:CCDS21504.1 GeneID:27276 MGI:1351469
definition	GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : PH domain containing protein in retina 1 product : pleckstrin homology domain containing, family B (evectins) member 1 protein_id : NP_038774.1

name	LOC100041204 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257623 GeneID:100041204
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_001476012.1

name	B930006L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520227 CCDS:CCDS21505.1 GeneID:319604 MGI:2442372
definition	codon_start : 1 product : hypothetical protein LOC319604 protein_id : NP_848879.1

name	Tnfrsf19l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982219 CCDS:CCDS21506.1 GeneID:320100 MGI:2443373
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : tumor necrosis factor receptor superfamily, member 19-like protein_id : NP_796047.2

name	Arhgef17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487439 GeneID:207212 MGI:2673002
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : Rho guanine nucleotide exchange factor (GEF) 17 protein_id : NP_001074585.1

name	P2ry6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147203 CCDS:CCDS21507.1 GeneID:233571 MGI:2673874
definition	GO_function : GO:0019103 - pyrimidine nucleotide binding [Evidence IC]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0045029 - UDP-activated nucleotide receptor activity [Evidence IDA] GO_process : GO:0007165 - signal transduction [Evidence IEA]; GO:0030321 - transepithelial chloride transport [Evidence IDA] codon_start : 1 product : pyrimidinergic receptor P2Y, G-protein coupled, 6 protein_id : NP_898991.1

name	P2ry2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560661 CCDS:CCDS21508.1 GeneID:18442 MGI:105107
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : purinergic receptor P2Y, G-protein coupled 2 protein_id : NP_032799.2

name	LOC100049539 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257609 GeneID:100049539
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487844.1

name	EG435996 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907277 GeneID:435996 MGI:3645951
definition	codon_start : 1 product : similar to ribosomal protein S29 protein_id : XP_488060.2

name	Fchsd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841025 GeneID:207278 MGI:2448475
definition	GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 note : SH3 multiple domains 3 product : FCH and double SH3 domains 2 protein_id : NP_950177.1

name	EG622673 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907223 GeneID:622673 MGI:3643600
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894555.1

name	LOC631577 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631577
definition	number : 3 pseudo : _no_value

name	LOC631577 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631577
definition	number : 2 pseudo : _no_value

name	LOC631577 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631577
definition	number : 1 pseudo : _no_value

name	LOC667112 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667112
definition	number : 1 pseudo : _no_value

name	Rnu15-b (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:54111254 GeneID:449631
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA, U15b small nucleolar transcript_id : NR_002173.1

name	EG449630 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:54111252 GeneID:449630 MGI:3645887
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG449630 transcript_id : NR_002172.1

name	LOC100041155 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257618 GeneID:100041155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 1 Protein product : similar to RIKEN cDNA 2310005N03 pseudo : _no_value transcript_id : XR_032447.1

name	LOC100041167 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257619 GeneID:100041167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to cytochrome c oxidase subunit IV pseudo : _no_value transcript_id : XR_032453.1

clone name	MSMg01-358A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-426F08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512P20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-143K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-321G21.b	B6Ng01-321G21.g
ACC	GA110536	GA110537
length	1,182	1,163
definition	B6Ng01-321G21.b	B6Ng01-321G21.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(107,310,917 - 107,312,113)	(107,180,827 - 107,181,981)
sequence	gaattccacaaggctttacataggacccatcaaattaaaggtcaatataa actgtcatgtctaaaatggcttgagtcagagctgaccaccaggcagcact tcctgcaagtgtgtatgacctcattatagtttttgtgtttttcctttata gactggcattgagaaatgttcatcgctgtagcctcacctcacgaattctg agctatggcgctgatcgatcagtatgaaggtatatataccccaacatgta cctaaagggacacataagagctggcgctggtgcacaggtgggcagcatga gagactgtgagtgcaatcttgtgtctgtaagcatgagtgtgtgcatttgt gtgtgtgttaacattcgtgtgtcgtggtatgtgtgtggagatcagaggac aacacagtccatcttagatctttttggttttgttttttaaagatttattt attattttacgtatatgagtacactgtagctatacagatggttgtgagcc atcatgtggtggctgggaattgaactcaggacctctgctcaatccggccc aaagatttatttattgttatatgtaagtacactgtagctgtctttagaca caccagaagagggtgtcagatttcattacagatggttgtgagccaccatg tgctgggatttgaactcagaaccttcagaagagcagtcagtactcttaac tgctgagccatctctctagccccatcttatatcttttgttgtcttcacta cattagccaggccagttgaccctgcaggtttatggtctctcctgtctctg catctcatattaccacgggaactctgggtttaacagatgtgcacttctta gggtttctattgctgcagtgaaacaccatgaccccaagaagctgtgaaga gagagtttatttggcttacacttttatattgtaggtcatcactgaacgga gtcagagcaggactcaaacagggcaggacctggaggcagagctgatgcag aggcgatgtagggtgctgatgctgctgcctcccatgctgctcagcctgct tgctttttacgacccaaggacatcagctcacagaatagcatctgaaatgt tgcctccccacaactccaaccatcacctattacgaaaacatccctaaggc ctttctgcaactgatcttaaggcatttctcat	gaattccaagtctgggaaagaatttggcaaagtcatggtgacagtgccat aggaaagggtgtgtctggtctaggaagacagctcggttggtaaagcgctt tcctcaaagcctgagaacctgagttcagcccccccaccccccgaggccat gtgaaaagcctgggcactgtggcatatgcttgcaatcacagccctagaga agagcagccagactagcctgcctcatgagctccaggccagtgaaagaccc tgtcacaaaggaaaggggcaaccttagtgaggatggtacccaaggttgtc tgtctgtcctctgtcttccatagtcacacacacatatgtgaacacacatt taaaagaggaagggtaaaagataaacagaacctagtgtgatcagtcctgt ggagaggaggctgtggtcaccttcaagctgggtcaggaagccatcccact gaggctgagtgggcgggtcactcacttgctgaccacagaaagcaagagca gaaggactggcatttgcaaaagcttggtttcctcctgggacctcaagttt tagctagggatgggccatgctcaagacacaaaagctcctgttcaatgatg tctgaataaacacggctctggatttttatcatatgttgtaggctagagaa aagcttgaatggtctacatgggtcagccttctcttctttattttcccttt tatctctccccctcctttctttcctcccttttccctcccccttccttccc tccctgtttccctccttccctccctcctcccctcctttccttcctccttt cctcctcccttccctattcccctccttccttccctcccttctcccttcct ttccttcctcttttccctcctcccctctctactcccctcctttcttcctt ctgtctctccttccttctctctctccttccctccctccctacccttccat cctttccctccctcccttctcccctccatccttctttccctacatgtggg cagaatatgaggattgttgctggtgacaggggcagcagcagaggaggagc ctaaaggaacaggttttttacttacttgtggaggtgacagtggttagaag aaagccagaaacattcaaatggttccacatttaaggaattatggttagaa gaccatggctctg
quality values	Open. Hide. 58 31 33 26 58 62 31 14 62 42 54 62 62 62 62 62 54 62 51 31 62 47 62 62 47 47 62 47 44 62 59 56 56 56 38 37 56 56 43 62 59 46 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 49 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 56 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 59 62 62 62 62 62 59 62 62 62 62 59 59 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 56 62 56 62 62 62 47 56 46 56 62 56 62 56 62 52 53 54 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 48 58 54 58 54 54 54 48 58 41 54 54 31 46 52 52 52 54 52 48 52 54 52 54 52 54 52 54 52 46 43 52 47 58 54 54 39 58 54 54 54 58 54 54 54 58 58 48 58 52 58 52 58 58 58 49 58 47 52 52 52 52 46 54 58 54 54 52 52 58 58 58 53 58 58 51 52 47 44 47 47 50 47 41 38 49 42 58 58 42 58 20 58 58 50 58 58 53 58 52 58 37 50 51 50 42 49 51 50 44 31 50 58 33 58 51 34 58 54 42 50 51 31 38 22 42 30 26 40 53 51 48 51 58 52 58 58 58 28 31 58 54 51 51 51 50 51 43 50 32 51 39 29 39 43 47 34 42 29 58 43 37 54 17 50 51 39 49 42 53 50 42 41 40 54 42 53 50 40 50 39 49 50 40 51 50 46 21 25 33 29 53 33 53 42 41 37 39 49 37 50 50 35 34 35 52 53 53 49 49 40 49 49 38 52 54 54 39 54 37 40 54 33 47 42 52 40 33 37 37 38 45 39 53 37 52 32 35 41 32 31 44 25 36 38 32 49 51 40 34 15 42 45 33 37 35 20 12 46 32 53 45 34 32 34 38 31 37 39 30 28 26 45 32 40 26 30 34 31 42 36 32 28 40 26 36 28 31 31 36 31 31 32 27 22 24 33 18 46 32 35 36 31 39 26 31 32 51 41 29 51 31 31 37 31 31 27 34 23 32 32 31 30 32 34 35 32 31 31 31 33 19 47 40 23 48 42 30 29 31 27 33 31 31 38 30 26 32 26 29 32 37 46 21 28 28 21 20 21 31 28 19 15 24 22 20 12 31 29 32 31 20 31 37 29 30 27 32 27 19 39 15 37 33 38 32 31 47 27 30 30 47 23 19 33 31 37 24 32 24 18 24 32 48 48 34 31 29 20 24 19 31 18 20 24 21 35 32 32 31 24 28 32 32 33 25 5 5 10 25 24 21 34 27 21 18 34 12 15 10 15 13 4 10 33 28 21 32 25 16 10 13 34 26 32 33 19 16 4 9 21 33 10 25 16 9 20 21 7 4 7 10 31 34 22 32 16 19 33 7 5 20 9 11 11 7 24 20 14 10 6 16 47 28 16 27 17 20 7 14 3 5 23 15 30 13 20 9 7 7 12 14 21 23 18 19 27 7 12 8 8 17 17 27 11 18 19 20 20 17 21 24 24 24 28 34 34 34 22 6 4 3 8 13 8 14 4 8 20 5 21 15 8 7 16 8 6 13 7 17 6 5 5 7 18 6 5 6 8 9 11 11 7 8 10 22 28 23 7 11 7 4 5 14 19 4 22 24 21 13 5 5 11 11 6 5 11 24 4 6 12 6 7 21 7 6 11 4 10 11 6 13 4 4 4 15 17 19 6 4 4 5 4 20 5 8 5 2 2 2 5 4 14 17 7 9 7 11 7 5 3 5 1 5 8 7 5 7 5 2 2 1 18 6 3 3 16 5 10 8 20 6 5	Open. Hide. 62 47 51 47 62 62 47 33 59 62 62 62 62 62 49 49 33 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 42 49 54 54 54 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 49 49 49 34 54 62 62 62 62 62 62 54 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 58 54 45 58 58 58 54 48 58 49 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 43 58 58 58 58 58 45 38 58 58 58 54 54 58 58 58 58 58 54 52 58 58 52 58 49 58 45 42 58 58 44 45 45 49 58 58 58 54 54 52 58 54 58 50 52 51 50 58 58 58 50 48 51 50 54 54 58 58 53 46 46 54 49 58 49 51 58 58 51 58 54 58 41 46 49 58 58 58 49 58 51 58 51 58 53 51 50 58 36 39 58 58 58 49 52 51 52 50 51 52 52 58 51 58 58 53 53 32 58 48 51 40 30 58 42 49 58 38 44 37 51 53 58 51 58 53 50 58 58 40 53 50 50 49 40 50 50 58 58 47 42 47 27 51 58 42 51 53 39 51 50 50 43 40 58 58 51 41 58 58 50 53 54 54 40 54 54 42 40 49 41 49 51 50 38 38 49 54 54 41 52 54 30 54 37 49 24 42 35 29 38 17 20 54 50 38 54 54 42 27 54 54 29 23 54 54 54 54 49 30 16 42 42 44 23 54 44 36 30 49 46 34 51 44 44 42 33 52 51 45 37 33 33 49 30 54 36 20 33 54 53 52 36 38 40 32 52 52 49 42 32 52 51 49 40 31 33 29 32 25 36 20 29 39 34 53 18 18 40 32 32 51 35 32 40 40 31 29 27 46 35 28 42 51 30 33 46 46 46 31 26 25 16 17 14 32 28 36 32 41 33 43 28 51 45 33 38 30 31 28 46 31 26 25 16 46 30 46 24 30 31 30 28 16 40 32 32 30 48 46 27 31 48 33 31 31 46 43 27 46 46 46 27 30 13 18 10 5 12 11 21 46 46 37 36 24 24 32 46 31 31 37 27 18 33 21 32 31 21 33 23 30 27 24 23 30 28 23 21 27 21 27 29 31 30 37 25 30 31 31 29 21 21 25 23 17 43 24 25 27 44 33 31 26 44 29 10 17 30 41 30 28 8 16 6 5 5 9 21 12 41 19 22 41 25 17 29 41 29 17 19 41 21 13 30 32 32 37 33 39 25 24 10 18 32 32 22 19 34 31 33 31 48 29 21 48 26 15 32 28 32 28 33 28 37 48 18 23 21 22 22 28 18 14 15 16 31 12 12 10 7 5 5 11 33 32 32 23 19 20 10 11 7 6 13 18 30 22 6 13 17 13 23 11 5 8 7 5 20 4 10 18 12 5 9 15 5 11 21 20 40 18 7 14 8 13 9 9 14 14 9 33 31 34 27 27 18 22 11 10 7 21 12 8 6 5 22 8 14 13 9 13 10 10 9 3 2 2 7 13 4 6 1 2 4 10 5 21 23 23 4 9 14 6 4 18 20 5 8 6 16 15 4 5 7 11 4 7 8 2 3 4 9 5 24 5 9 23 19 5 7 15 13 15 8 11 9 5 5 7 3 3 2 5 3 8 3 3 2 3 7 5 2 3 7 2 2 6 6 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_107310917_107312113
seq2: B6Ng01-321G21.b_44_1225 (reverse)

seq1  ATGAGAAAATGCCTCTTTAAGATCAGGCTGCAGGAAAGCCTGTAGGG-TG  49
      ||||| |||||||   ||||||||| | ||||| || |||| ||||| ||
seq2  ATGAG-AAATGCC---TTAAGATCA-GTTGCAGAAAGGCCT-TAGGGATG  44

seq1  TTTTCGTAATTAGTGATGGTTGGGGTTGTGGGG-GGCACATTTTCAGATG  98
      ||||||||||  ||||||||||| ||||||||| ||||   |||||||||
seq2  TTTTCGTAATAGGTGATGGTTGGAGTTGTGGGGAGGCAACATTTCAGATG  94

seq1  CTA-TCTGTGGGCTGGTGGTCCTGGGGTCTGTAAAAAAGCAAGCAGGCTG  147
      ||| |||||| |||| | ||||| ||||| || |||||||||||||||||
seq2  CTATTCTGTGAGCTGAT-GTCCTTGGGTC-GT-AAAAAGCAAGCAGGCTG  141

seq1  AGCAAGCCATGGGGAGCAAGCCAGCACTCAGCACCCCTACATCGCCTCTG  197
      ||||   ||||||  |||   ||||| |||||| ||||||||||||||||
seq2  AGCA--GCATGGGAGGCA--GCAGCA-TCAGCA-CCCTACATCGCCTCTG  185

seq1  CATCAGCTCCTGCCTCCAGGTCCCTGCCCTGTTTGAGTCCCTGCTCTGAC  247
      |||||||| |||||||||||| |||||||||||||||| |||||||||||
seq2  CATCAGCT-CTGCCTCCAGGT-CCTGCCCTGTTTGAGT-CCTGCTCTGAC  232

seq1  TCCCTTCAGTGATGACCTACAATATAAAAGTGTAAGCCAAATAAACTCTC  297
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGTTCAGTGATGACCTACAATATAAAAGTGTAAGCCAAATAAACTCTC  282

seq1  TCTTCACAGCTTCTTGGGGTCATGGTGTTTCACTGCAGCAATAGAAACCC  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCACAGCTTCTTGGGGTCATGGTGTTTCACTGCAGCAATAGAAACCC  332

seq1  TAAGAAGTGCACATCTGTTAAACCCAGAGTTCCCGTGGTAATATGAGATG  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAAGTGCACATCTGTTAAACCCAGAGTTCCCGTGGTAATATGAGATG  382

seq1  CAGAGACAGGAGAGACCATAAACCTGCAGGGTCAACTGGCCTGGCTAATG  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGACAGGAGAGACCATAAACCTGCAGGGTCAACTGGCCTGGCTAATG  432

seq1  TAGTGAAGACAACAAAAGATATAAGATGGGGCTAGAGAGATGGCTCAGCA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGAAGACAACAAAAGATATAAGATGGGGCTAGAGAGATGGCTCAGCA  482

seq1  GTTAAGAGTACTGACTGCTCTTCTGAAGGTTCTGAGTTCAAATCCCAGCA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAGAGTACTGACTGCTCTTCTGAAGGTTCTGAGTTCAAATCCCAGCA  532

seq1  CATGGTGGCTCACAACCATCTGTAATGAAATCTGACACCCTCTTCTGGTG  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGTGGCTCACAACCATCTGTAATGAAATCTGACACCCTCTTCTGGTG  582

seq1  TGTCTAAAGACAGCTACAGTGTACTTACATATAACAATAAATAAATCTTT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTAAAGACAGCTACAGTGTACTTACATATAACAATAAATAAATCTTT  632

seq1  GGGCCGGATTGAGCAGAGGTCCTGAGTTCAATTCCCAGCCACCACATGAT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCGGATTGAGCAGAGGTCCTGAGTTCAATTCCCAGCCACCACATGAT  682

seq1  GGCTCACAACCATCTGTATAGCTACAGTGTACTCATATACGTAAAATAAT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTCACAACCATCTGTATAGCTACAGTGTACTCATATACGTAAAATAAT  732

seq1  AAATAAATCTTTAAAAAACAAAACCAAAAAGATCTAAGATGGACTGTGTT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAAATCTTTAAAAAACAAAACCAAAAAGATCTAAGATGGACTGTGTT  782

seq1  GTCCTCTGATCTCCACACACATACCACGACACACGAATGTTAACACACAC  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTCTGATCTCCACACACATACCACGACACACGAATGTTAACACACAC  832

seq1  ACAAATGCACACACTCATGCTTACAGACACAAGATTGCACTCACAGTCTC  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAATGCACACACTCATGCTTACAGACACAAGATTGCACTCACAGTCTC  882

seq1  TCATGCTGCCCACCTGTGCACCAGCGCCAGCTCTTATGTGTCCCTTTAGG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGCTGCCCACCTGTGCACCAGCGCCAGCTCTTATGTGTCCCTTTAGG  932

seq1  TACATGTTGGGGTATATATACCTTCATACTGATCGATCAGCGCCATAGCT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATGTTGGGGTATATATACCTTCATACTGATCGATCAGCGCCATAGCT  982

seq1  CAGAATTCGTGAGGTGAGGCTACAGCGATGAACATTTCTCAATGCCAGTC  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAATTCGTGAGGTGAGGCTACAGCGATGAACATTTCTCAATGCCAGTC  1032

seq1  TATAAAGGAAAAACACAAAAACTATAATGAGGTCATACACACTTGCAGGA  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAAGGAAAAACACAAAAACTATAATGAGGTCATACACACTTGCAGGA  1082

seq1  AGTGCTGCCTGGTGGTCAGCTCTGACTCAAGCCATTTTAGACATGACAGT  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCTGCCTGGTGGTCAGCTCTGACTCAAGCCATTTTAGACATGACAGT  1132

seq1  TTATATTGACCTTTAATTTGATGGGTCCTATGTAAAGCCTTGTGGAATTC  1197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATATTGACCTTTAATTTGATGGGTCCTATGTAAAGCCTTGTGGAATTC  1182

seq1: chr7_107180827_107181981
seq2: B6Ng01-321G21.g_64_1226

seq1  GAATTCCAAGTCTGGGAAAGAATTTGGCAAAGTCATGGTGACAGTGCCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAAGTCTGGGAAAGAATTTGGCAAAGTCATGGTGACAGTGCCAT  50

seq1  AGGAAAGGGTGTGTCTGGTCTAGGAAGACAGCTCGGTTGGTAAAGCGCTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAAGGGTGTGTCTGGTCTAGGAAGACAGCTCGGTTGGTAAAGCGCTT  100

seq1  TCCTCAAAGCCTGAGAACCTGAGTTCAGCCCCCCCACCCCCCGAGGCCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCAAAGCCTGAGAACCTGAGTTCAGCCCCCCCACCCCCCGAGGCCAT  150

seq1  GTGAAAAGCCTGGGCACTGTGGCATATGCTTGCAATCACAGCCCTAGAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAAAGCCTGGGCACTGTGGCATATGCTTGCAATCACAGCCCTAGAGA  200

seq1  AGAGCAGCCAGACTAGCCTGCCTCATGAGCTCCAGGCCAGTGAAAGACCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGCAGCCAGACTAGCCTGCCTCATGAGCTCCAGGCCAGTGAAAGACCC  250

seq1  TGTCACAAAGGAAAGGGGCAACCTTAGTGAGGATGGTACCCAAGGTTGTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCACAAAGGAAAGGGGCAACCTTAGTGAGGATGGTACCCAAGGTTGTC  300

seq1  TGTCTGTCCTCTGTCTTCCATAGTCACACACACATATGTGAACACACATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTGTCCTCTGTCTTCCATAGTCACACACACATATGTGAACACACATT  350

seq1  TAAAAGAGGAAGGGTAAAAGATAAACAGAACCTAGTGTGATCAGTCCTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAGAGGAAGGGTAAAAGATAAACAGAACCTAGTGTGATCAGTCCTGT  400

seq1  GGAGAGGAGGCTGTGGTCACCTTCAAGCTGGGTCAGGAAGCCATCCCACT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGGAGGCTGTGGTCACCTTCAAGCTGGGTCAGGAAGCCATCCCACT  450

seq1  GAGGCTGAGTGGGCGGGTCACTCACTTGCTGACCACAGAAAGCAAGAGCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCTGAGTGGGCGGGTCACTCACTTGCTGACCACAGAAAGCAAGAGCA  500

seq1  GAAGGACTGGCATTTGCAAAAGCTTGGTTTCCTCCTGGGACCTCAAGTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGACTGGCATTTGCAAAAGCTTGGTTTCCTCCTGGGACCTCAAGTTT  550

seq1  TAGCTAGGGATGGGCCATGCTCAAGACACAAAAGCTCCTGTTCAATGATG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTAGGGATGGGCCATGCTCAAGACACAAAAGCTCCTGTTCAATGATG  600

seq1  TCTGAATAAACACGGCTCTGGATTTTTATCATATGTTGTAGGCTAGAGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGAATAAACACGGCTCTGGATTTTTATCATATGTTGTAGGCTAGAGAA  650

seq1  AAGCTTGAATGGTCTACATGGGTCAGCCTTCTCTTCTTTATTTTCCCTTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTTGAATGGTCTACATGGGTCAGCCTTCTCTTCTTTATTTTCCCTTT  700

seq1  TATCTCTCCCCCTCCTTTCTTTCCTCCCTTTTCCCTCCCCCTTCCTTCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTCTCCCCCTCCTTTCTTTCCTCCCTTTTCCCTCCCCCTTCCTTCCC  750

seq1  TCCCTGTTTCCCTCCTTCCCTCCCTCCTCCCCTCCTTTCCTTCCTCCTTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTGTTTCCCTCCTTCCCTCCCTCCTCCCCTCCTTTCCTTCCTCCTTT  800

seq1  CCTCCTCCCTTCCCTATTCCCCTCCTTCCTTCCCTCCCTTCTCCCTTCCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCCCTTCCCTATTCCCCTCCTTCCTTCCCTCCCTTCTCCCTTCCT  850

seq1  TTCCTTCCTCTTTTCCCTCCTCCCCTCTCTCCTCCCCTCCTTTCTTCCTT  900
      |||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  TTCCTTCCTCTTTTCCCTCCTCCCCTCTCTACTCCCCTCCTTTCTTCCTT  900

seq1  CTGTCTCTCCTTCCTTCTCTCTCTCCTTCCCTCCCTCCCTACCCTTCCCT  950
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  CTGTCTCTCCTTCCTTCTCTCTCTCCTTCCCTCCCTCCCTACCCTTCCAT  950

seq1  CCTTTCCCTCCCTCCCTTCTCCCCTCCATCCTTCTTTCCCTACATGTGGG  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTCCCTCCCTCCCTTCTCCCCTCCATCCTTCTTTCCCTACATGTGGG  1000

seq1  CAG-ATATGAGGA-TGTTGCTGGTGACAGGGGCAGCAGCAGAGGAGGAGG  1048
      ||| ||||||||| ||||||||||||||||||||||||||||||||||| 
seq2  CAGAATATGAGGATTGTTGCTGGTGACAGGGGCAGCAGCAGAGGAGGAGC  1050

seq1  CTAAAGGAACAGG--TTTTACTTAC-TGTGGAGGTGACAGGTGGTCAGA-  1094
      |||||||||||||  |||||||||| ||||||||||||| ||||| ||| 
seq2  CTAAAGGAACAGGTTTTTTACTTACTTGTGGAGGTGACA-GTGGTTAGAA  1099

seq1  -GAAGCCAG-AACATTTCAATGGT--CACCATTA--GGATTATGGTTTAA  1138
        ||||||| ||||||  ||||||  |||  |||  | |||||||||  |
seq2  GAAAGCCAGAAACATTCAAATGGTTCCACATTTAAGGAATTATGGTT--A  1147

seq1  GAAGGACCAGGGCTCTG  1155
      ||| ||||| |||||||
seq2  GAA-GACCATGGCTCTG  1163

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information