MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-326A01
Chromosome	7 (Build37)
Map Location	27,053,364 - 27,158,563
singlet/doublet	doublet
Overlap gene	Cyp2a4, Nlrp9c
Upstream gene	Cic, Pafah1b3, EG623131, Tmem145, Megf8, Cnfn, Lipe, BC024561, LOC434148, Ceacam1, Ceacam2, LOC100043722, EG632778, 2310004L02Rik, B3gnt8, Bckdha, Exosc5, A830041P22Rik, BC028440, Tgfb1, Ccdc97, Hnrpul1, Axl, LOC667950, Cyp2s1, LOC100043732, EG623475, Cyp2b10, LOC232993, EG667957, BC026762, Cyp2b13, EG668047, LOC623532, Cyp2b9, LOC667968
Downstream gene	LOC100043195, Nlrp4a, Nlrp9a, V1re12, EG243881, LOC623830, Cyp2b19, Cyp2g1, LOC100043745, Cyp2a5, EG233005, EG330491, Cyp2a12, LOC100043199, Cyp2f2, Gm1450, Egln2, Rab4b, Mia1, Snrpa, Itpkc, Adck4, Numbl, Ltbp4, Shkbp1, Spnb4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cic (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71722 MGI:1918972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pafah1b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18476 MGI:108414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623131 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623131 MGI:3648539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330485 MGI:3607779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Megf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269878 MGI:2446294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 2 Proteins

name	Cnfn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72383 MGI:1919633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lipe (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	BC024561 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232983 MGI:2387642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434148 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 112 ESTs, 7 Proteins pseudo : _no_value

name	Ceacam1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Ceacam2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26367 MGI:1347246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043722 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins pseudo : _no_value

name	EG632778 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632778 MGI:3646269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310004L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66349 MGI:1913599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Bckdha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12039 MGI:107701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27998 MGI:107889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A830041P22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320208 MGI:2443589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC028440 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232987 MGI:2387643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21803 MGI:98725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52132 MGI:1196455
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrpul1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232989 MGI:2443517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Axl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26362 MGI:1347244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 2 Proteins pseudo : _no_value

name	Cyp2s1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74134 MGI:1921384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043732 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 708 ESTs, 6 Proteins

name	EG623475 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623475 MGI:3648424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins

name	Cyp2b10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13088 MGI:88598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC232993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:232993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG667957 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667957 MGI:3643081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	BC026762 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236428 MGI:2652842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	Cyp2b13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13089 MGI:88599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668047 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668047 MGI:3645710
definition	note : predicted gene, EG668047 pseudo : _no_value

name	LOC623532 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623532
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Cyp2b9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13094 MGI:88600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667968 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Cyp2a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13086 MGI:88596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp9c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330490 MGI:3028627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043195 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043195
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nlrp4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243880 MGI:2443697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp9a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233001 MGI:2675292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	V1re12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171265 MGI:2159634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243881 MGI:3646735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623830 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623830
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Cyp2b19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13090 MGI:107303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp2g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13108 MGI:109612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043745 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Cyp2a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13087 MGI:88597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG233005 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 34 ESTs, 53 Proteins

name	EG330491 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330491 MGI:3647278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs, 4 Proteins

name	Cyp2a12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13085 MGI:105055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043199 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Cyp2f2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13107 MGI:88608
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1450 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384724 MGI:2686296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 Proteins

name	Egln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:112406 MGI:1932287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19342 MGI:105071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mia1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12587 MGI:109615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53607 MGI:1855690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Itpkc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233011 MGI:2442554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adck4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76889 MGI:1924139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Numbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18223 MGI:894702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ltbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108075 MGI:1321395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shkbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192192 MGI:2385803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spnb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80297 MGI:1890574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cic (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475687 GeneID:71722 MGI:1918972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : capicua homolog (Drosophila) transcript_id : NM_027882.2

name	Pafah1b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679200 GeneID:18476 MGI:108414
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit transcript_id : NM_008776.1

name	EG623131 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486844 GeneID:623131 MGI:3648539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG623131 transcript_id : NM_001081294.1

name	Tmem145 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119637852 GeneID:330485 MGI:3607779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 145 transcript_id : NM_183311.2

name	Megf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256457 GeneID:269878 MGI:2446294
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 124 ESTs, 2 Proteins product : multiple EGF-like-domains 8 transcript_id : XM_194337.7

name	Cnfn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487008 GeneID:72383 MGI:1919633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cornifelin transcript_id : NM_001081375.1

name	Lipe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239969 GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, hormone sensitive transcript_id : NM_010719.5

name	Lipe (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239971 GeneID:16890 MGI:96790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lipase, hormone sensitive transcript_id : NM_001039507.1

name	BC024561 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891726 GeneID:232983 MGI:2387642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC024561 transcript_id : NM_153576.2

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719312 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039187.1

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719302 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_011926.2

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719300 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039186.1

name	Ceacam1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85719298 GeneID:26365 MGI:1347245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 1 transcript_id : NM_001039185.1

name	Ceacam2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802842 GeneID:26367 MGI:1347246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 2 transcript_id : NM_007543.3

name	EG632778 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381235 GeneID:632778 MGI:3646269
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG632778 transcript_id : NM_001039243.2

name	2310004L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377182 GeneID:66349 MGI:1913599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310004L02 gene transcript_id : NM_025504.3

name	B3gnt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92087056 GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 transcript_id : NM_146184.4

name	B3gnt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92087052 GeneID:232984 MGI:2385269
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 transcript_id : NM_001036740.2

name	Bckdha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389002 GeneID:12039 MGI:107701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : branched chain ketoacid dehydrogenase E1, alpha polypeptide transcript_id : NM_007533.3

name	Exosc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343823 GeneID:27998 MGI:107889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 5 transcript_id : NM_138586.2

name	A830041P22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378229 GeneID:320208 MGI:2443589
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A830041P22 gene transcript_id : NM_177102.3

name	BC028440 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26024310 GeneID:232987 MGI:2387643
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC028440 transcript_id : NM_172148.1

name	Tgfb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755774 GeneID:21803 MGI:98725
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor, beta 1 transcript_id : NM_011577.1

name	Ccdc97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373814 GeneID:52132 MGI:1196455
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 97 transcript_id : NM_028771.2

name	Hnrpul1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801559 GeneID:232989 MGI:2443517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein U-like 1 transcript_id : NM_144922.2

name	Hnrpul1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342548 GeneID:232989 MGI:2443517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein U-like 1 transcript_id : NM_178089.2

name	Axl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892528 GeneID:26362 MGI:1347244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AXL receptor tyrosine kinase transcript_id : NM_009465.3

name	Cyp2s1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892669 GeneID:74134 MGI:1921384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily s, polypeptide 1 transcript_id : NM_028775.3

name	LOC100043732 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256659 GeneID:100043732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 708 ESTs, 6 Proteins product : similar to ribosomal protein L37a transcript_id : XM_001480907.1

name	EG623475 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256460 GeneID:623475 MGI:3648424
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 3 Proteins product : predicted gene, EG623475 transcript_id : XM_887930.3

name	Cyp2b10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129803 GeneID:13088 MGI:88598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 10 transcript_id : NM_009999.3

name	Cyp2b10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77416369 GeneID:13088 MGI:88598
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 10 transcript_id : NM_009998.4

name	BC026762 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256661 GeneID:236428 MGI:2652842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : cDNA sequence BC026762 transcript_id : XM_001480912.1

name	Cyp2b13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681104 GeneID:13089 MGI:88599
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 13 transcript_id : NM_007813.1

name	Cyp2b9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129801 GeneID:13094 MGI:88600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 9 transcript_id : NM_010000.2

name	Cyp2a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116268117 GeneID:13086 MGI:88596
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 4 transcript_id : NM_009997.2

name	Nlrp9c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815823 GeneID:330490 MGI:3028627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9C transcript_id : NM_001042612.1

name	Nlrp4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803250 GeneID:243880 MGI:2443697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 4A transcript_id : NM_172896.2

name	Nlrp9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299742 GeneID:233001 MGI:2675292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9A transcript_id : NM_001048219.1

name	Nlrp9a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299751 GeneID:233001 MGI:2675292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 9A transcript_id : NM_001048220.1

name	V1re12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21717778 GeneID:171265 MGI:2159634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, E12 transcript_id : NM_134231.1

name	EG243881 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487254 GeneID:243881 MGI:3646735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG243881 transcript_id : NM_001081148.1

name	Cyp2b19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681106 GeneID:13090 MGI:107303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily b, polypeptide 19 transcript_id : NM_007814.1

name	Cyp2g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7304990 GeneID:13108 MGI:109612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily g, polypeptide 1 transcript_id : NM_013809.1

name	LOC100043745 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256663 GeneID:100043745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043745 transcript_id : XM_001480935.1

name	Cyp2a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349519 GeneID:13087 MGI:88597
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 5 transcript_id : NM_007812.3

name	EG233005 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380058 GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 ESTs, 6 Proteins product : predicted gene, EG233005, transcript variant 3 transcript_id : XM_896592.2

name	EG233005 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256665 GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 34 ESTs, 49 Proteins product : predicted gene, EG233005 transcript_id : XM_001480937.1

name	EG233005 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380060 GeneID:233005 MGI:3648316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : predicted gene, EG233005, transcript variant 4 transcript_id : XM_896600.2

name	EG330491 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256473 GeneID:330491 MGI:3647278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs, 4 Proteins product : predicted gene, EG330491 transcript_id : XM_286199.6

name	Cyp2a12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526797 GeneID:13085 MGI:105055
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily a, polypeptide 12 transcript_id : NM_133657.1

name	Cyp2f2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124001559 GeneID:13107 MGI:88608
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily f, polypeptide 2 transcript_id : NM_007817.2

name	Gm1450 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256475 GeneID:384724 MGI:2686296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 Proteins product : gene model 1450, (NCBI) transcript_id : XM_357820.4

name	Egln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893236 GeneID:112406 MGI:1932287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EGL nine homolog 2 (C. elegans) transcript_id : NM_053208.3

name	Rab4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891837 GeneID:19342 MGI:105071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB4B, member RAS oncogene family transcript_id : NM_029391.2

name	Mia1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365990 GeneID:12587 MGI:109615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma inhibitory activity 1 transcript_id : NM_019394.2

name	Snrpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052105 GeneID:53607 MGI:1855690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide A transcript_id : NM_015782.3

name	Snrpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052540 GeneID:53607 MGI:1855690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein polypeptide A transcript_id : NM_001046637.1

name	Itpkc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795579 GeneID:233011 MGI:2442554
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol 1,4,5-trisphosphate 3-kinase C transcript_id : NM_181593.2

name	Adck4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244099 GeneID:76889 MGI:1924139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aarF domain containing kinase 4 transcript_id : NM_133770.2

name	Numbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87042276 GeneID:18223 MGI:894702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : numb-like transcript_id : NM_010950.2

name	Ltbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32189329 GeneID:108075 MGI:1321395
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : latent transforming growth factor beta binding protein 4 transcript_id : NM_175641.1

name	Shkbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109659850 GeneID:192192 MGI:2385803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sh3kbp1 binding protein 1 transcript_id : NM_138676.2

name	Spnb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174792 GeneID:80297 MGI:1890574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spectrin beta 4 transcript_id : NM_032610.2

name	Cic (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16507202 GeneID:71722 MGI:1918972
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : capicua homolog protein_id : NP_082158.1

name	Pafah1b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679201 CCDS:CCDS20979.1 GeneID:18476 MGI:108414
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003847 - 1-alkyl-2-acetylglycerophosphocholine esterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] [Evidence IGI] codon_start : 1 product : platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit protein_id : NP_032802.1

name	EG623131 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486845 GeneID:623131 MGI:3648539
definition	codon_start : 1 product : predicted gene, EG623131 protein_id : NP_001074763.1

name	Tmem145 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119637853 GeneID:330485 MGI:3607779
definition	codon_start : 1 product : hypothetical protein LOC330485 protein_id : NP_899134.2

name	Megf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256458 GeneID:269878 MGI:2446294
definition	codon_start : 1 product : multiple EGF-like-domains 8 protein_id : XP_194337.7

name	Cnfn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487009 GeneID:72383 MGI:1919633
definition	GO_component : GO:0001533 - cornified envelope [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cornifelin protein_id : NP_001074844.1

name	Lipe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239970 CCDS:CCDS20981.1 GeneID:16890 MGI:96790
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016298 - lipase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0046340 - diacylglycerol catabolism [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0019433 - triacylglycerol catabolism [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; hormone-sensitive lipase product : lipase, hormone sensitive isoform 1 protein_id : NP_034849.2

name	Lipe (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87239972 CCDS:CCDS20982.1 GeneID:16890 MGI:96790
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016298 - lipase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0046340 - diacylglycerol catabolism [Evidence IMP]; GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0019433 - triacylglycerol catabolism [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; hormone-sensitive lipase product : lipase, hormone sensitive isoform 2 protein_id : NP_001034596.1

name	BC024561 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133891727 GeneID:232983 MGI:2387642
definition	codon_start : 1 note : 13.6-kDa protein product : VEGF co-regulated chemokine 1 protein_id : NP_705804.2

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719303 CCDS:CCDS20985.1 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 3 protein_id : NP_036056.2

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719299 CCDS:CCDS20984.1 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 1 protein_id : NP_001034274.1

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719313 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 4 protein_id : NP_001034276.1

name	Ceacam1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85719301 GeneID:26365 MGI:1347245
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0043406 - positive regulation of MAPK activity [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; biliary glycoprotein 1; carcinoembryonic antigen 1; carcinoembryonic antigen 7; hepatitis virus receptor; hepatitis virus (MHV-4) susceptibility; mouse hepatitis virus receptor product : carcinoembryonic antigen-related cell adhesion molecule 1 isoform 2 protein_id : NP_001034275.1

name	Ceacam2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671734 CCDS:CCDS20986.1 GeneID:26367 MGI:1347246
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : biliary glycoprotein 2 product : CEA-related cell adhesion molecule 2 protein_id : NP_031569.1

name	EG632778 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986651 CCDS:CCDS20987.1 GeneID:632778 MGI:3646269
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC632778 protein_id : NP_001034332.1

name	2310004L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560249 CCDS:CCDS20988.1 GeneID:66349 MGI:1913599
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC66349 protein_id : NP_079780.2

name	B3gnt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80861482 CCDS:CCDS20989.1 GeneID:232984 MGI:2385269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030311 - poly-N-acetyllactosamine biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 7 protein_id : NP_001031817.1

name	B3gnt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122729 CCDS:CCDS20989.1 GeneID:232984 MGI:2385269
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0030311 - poly-N-acetyllactosamine biosynthesis [Evidence ISS]; GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 product : UDP-Gal:betaGal beta 1,3-galactosyltransferase polypeptide 7 protein_id : NP_666296.1

name	Bckdha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982494 GeneID:12039 MGI:107701
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003863 - 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity [Evidence IEA]; GO:0016536 - cyclin-dependent protein kinase 5 activator regulator activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016624 - oxidoreductase activity, acting on the aldehyde or oxo group of donors, disulfide as acceptor [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : BCKAD E1[a] product : branched chain ketoacid dehydrogenase E1, alpha polypeptide protein_id : NP_031559.2

name	Exosc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070392 CCDS:CCDS20990.1 GeneID:27998 MGI:107889
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA] codon_start : 1 product : exosome component 5 protein_id : NP_613052.1

name	A830041P22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893037 GeneID:320208 MGI:2443589
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320208 protein_id : NP_796076.1

name	BC028440 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26024311 CCDS:CCDS20992.1 GeneID:232987 MGI:2387643
definition	codon_start : 1 product : hypothetical protein LOC232987 protein_id : NP_742160.1

name	Tgfb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755775 CCDS:CCDS20993.1 GeneID:21803 MGI:98725
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0005160 - transforming growth factor beta receptor binding [Evidence TAS] GO_process : GO:0008219 - cell death [Evidence IMP]; GO:0016049 - cell growth [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA] [Evidence TAS]; GO:0006952 - defense response [Evidence TAS]; GO:0008354 - germ cell migration [Evidence IDA]; GO:0040007 - growth [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0048535 - lymph node development [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence TAS]; GO:0030279 - negative regulation of ossification [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence TAS]; GO:0008284 - positive regulation of cell proliferation [Evidence IDA]; GO:0048298 - positive regulation of isotype switching to IgA isotypes [Evidence ISS]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0051098 - regulation of binding [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0051101 - regulation of DNA binding [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0042306 - regulation of protein import into nucleus [Evidence IDA]; GO:0016202 - regulation of striated muscle development [Evidence IDA]; GO:0001501 - skeletal development [Evidence TAS]; GO:0007519 - striated muscle development [Evidence TAS]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 note : TGF-beta 1; regulatory protein; transforming growth factor-beta 1 product : transforming growth factor, beta 1 protein_id : NP_035707.1

name	Ccdc97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311899 CCDS:CCDS20994.1 GeneID:52132 MGI:1196455
definition	codon_start : 1 product : coiled-coil domain containing 97 protein_id : NP_083047.1

name	Hnrpul1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450323 CCDS:CCDS20995.1 GeneID:232989 MGI:2443517
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; EIB-55kDa associated protein 5 product : EIB-55kDa associated protein 5 isoform 1 protein_id : NP_659171.1

name	Hnrpul1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017405 GeneID:232989 MGI:2443517
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; EIB-55kDa associated protein 5 product : EIB-55kDa associated protein 5 isoform 2 protein_id : NP_835190.1

name	Axl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542164 CCDS:CCDS20996.1 GeneID:26362 MGI:1347244
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : ufo oncogene homolog product : AXL receptor tyrosine kinase protein_id : NP_033491.2

name	Cyp2s1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311915 CCDS:CCDS20997.1 GeneID:74134 MGI:1921384
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2s1 product : cytochrome P450, family 2, subfamily s, polypeptide 1 protein_id : NP_083051.1

name	LOC100043732 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256660 GeneID:100043732
definition	codon_start : 1 product : similar to ribosomal protein L37a protein_id : XP_001480957.1

name	EG623475 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256461 GeneID:623475 MGI:3648424
definition	codon_start : 1 product : hypothetical protein protein_id : XP_893023.3

name	Cyp2b10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753576 GeneID:13088 MGI:88598
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 1 is encoded by transcript variant 1; cytochrome P450, family 2, subfamily b, polypeptide 20; cytochrome P450, 2b20; cytochrome P450, 2b10, phenobarbitol inducible, type b product : cytochrome P450, family 2, subfamily b, polypeptide 10 isoform 1 protein_id : NP_034128.1

name	Cyp2b10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50080153 CCDS:CCDS20999.1 GeneID:13088 MGI:88598
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; cytochrome P450, family 2, subfamily b, polypeptide 20; cytochrome P450, 2b20; cytochrome P450, 2b10, phenobarbitol inducible, type b product : cytochrome P450, family 2, subfamily b, polypeptide 10 isoform 2 protein_id : NP_034129.1

name	BC026762 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256662 GeneID:236428 MGI:2652842
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480962.1

name	Cyp2b13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681105 CCDS:CCDS21000.1 GeneID:13089 MGI:88599
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 2b13, phenobarbitol inducible, type c; phenobarbital inducible, type c product : cytochrome P450, family 2, subfamily b, polypeptide 13 protein_id : NP_031839.1

name	Cyp2b9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753578 CCDS:CCDS21001.1 GeneID:13094 MGI:88600
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2b9, phenobarbitol inducible, type a; 16alphaoh-a product : cytochrome P450, family 2, subfamily b, polypeptide 9 protein_id : NP_034130.1

name	Cyp2a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116268118 CCDS:CCDS21002.1 GeneID:13086 MGI:88596
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a4; testosterone 15alpha-hydroxylase product : cytochrome P450, family 2, subfamily a, polypeptide 4 protein_id : NP_034127.2

name	Nlrp9c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815824 GeneID:330490 MGI:3028627
definition	GO_component : GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : NACHT, LRR and PYD containing protein 9c protein_id : NP_001036077.1

name	Nlrp4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370372 CCDS:CCDS21003.1 GeneID:243880 MGI:2443697
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : NACHT/LRR/pyrin domain-containing protein 4 product : NACHT, leucine rich repeat and PYD containing 4A protein_id : NP_766484.1

name	Nlrp9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299743 GeneID:233001 MGI:2675292
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; NACHT, LRR and PYD containing protein 9a product : NACHT, LRR and PYD containing protein 9a isoform 1 protein_id : NP_001041684.1

name	Nlrp9a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299752 GeneID:233001 MGI:2675292
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; NACHT, LRR and PYD containing protein 9a product : NACHT, LRR and PYD containing protein 9a isoform 2 protein_id : NP_001041685.1

name	V1re12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21717779 CCDS:CCDS21005.1 GeneID:171265 MGI:2159634
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0005550 - pheromone binding [Evidence ISS]; GO:0016503 - pheromone receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence ISS] codon_start : 1 product : vomeronasal 1 receptor, E12 protein_id : NP_598992.1

name	EG243881 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487255 GeneID:243881 MGI:3646735
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243881 protein_id : NP_001074617.1

name	Cyp2b19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681107 CCDS:CCDS21006.1 GeneID:13090 MGI:107303
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 function : mixed function monooxygenase note : cytochrome P450, 2b19 product : cytochrome P450, family 2, subfamily b, polypeptide 19 protein_id : NP_031840.1

name	Cyp2g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304991 CCDS:CCDS21007.1 GeneID:13108 MGI:109612
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : cytochrome P450, 2g1 product : cytochrome P450, family 2, subfamily g, polypeptide 1 protein_id : NP_038837.1

name	LOC100043745 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256664 GeneID:100043745
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480985.1

name	Cyp2a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832129 CCDS:CCDS21008.1 GeneID:13087 MGI:88597
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a5 product : cytochrome P450, family 2, subfamily a, polypeptide 5 protein_id : NP_031838.2

name	EG233005 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380059 GeneID:233005 MGI:3648316
definition	codon_start : 1 product : similar to Cytochrome P450, family 2, subfamily a, polypeptide 12 isoform 3 protein_id : XP_901685.2

name	EG233005 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256666 GeneID:233005 MGI:3648316
definition	codon_start : 1 product : similar to Cytochrome P450, family 2, subfamily a, polypeptide 12 protein_id : XP_001480987.1

name	EG233005 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380061 GeneID:233005 MGI:3648316
definition	codon_start : 1 product : similar to Cytochrome P450, family 2, subfamily a, polypeptide 12 isoform 4 protein_id : XP_901693.2

name	EG330491 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256474 GeneID:330491 MGI:3647278
definition	codon_start : 1 product : similar to Cytochrome P450 2A5 (CYPIIA5) (Coumarin 7-hydroxylase) (P450-15-COH) (P450-IIA3.2) protein_id : XP_286199.6

name	Cyp2a12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526798 CCDS:CCDS21009.1 GeneID:13085 MGI:105055
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2a12 product : cytochrome P450, family 2, subfamily a, polypeptide 12 protein_id : NP_598418.1

name	Cyp2f2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124001560 CCDS:CCDS21010.1 GeneID:13107 MGI:88608
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2f2 product : cytochrome P450, family 2, subfamily f, polypeptide 2 protein_id : NP_031843.2

name	Gm1450 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256476 GeneID:384724 MGI:2686296
definition	codon_start : 1 product : similar to cytochrome P450 monooxygenase CYP2T1 protein_id : XP_357820.4

name	Egln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450783 CCDS:CCDS21011.1 GeneID:112406 MGI:1932287
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0008198 - ferrous iron binding [Evidence ISS]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0031418 - L-ascorbic acid binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016706 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors [Evidence ISS] [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA]; GO:0019826 - oxygen sensor activity [Evidence ISS] GO_process : GO:0030520 - estrogen receptor signaling pathway [Evidence ISS]; GO:0045732 - positive regulation of protein catabolism [Evidence ISS]; GO:0019538 - protein metabolism [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0030503 - regulation of cell redox homeostasis [Evidence ISS]; GO:0001666 - response to hypoxia [Evidence ISS] codon_start : 1 note : immediate early response 4 product : EGL nine homolog 2 protein_id : NP_444438.2

name	Rab4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313012 CCDS:CCDS21012.1 GeneID:19342 MGI:105071
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB4B, member RAS oncogene family protein_id : NP_083667.1

name	Mia1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506479 CCDS:CCDS21013.1 GeneID:12587 MGI:109615
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0008083 - growth factor activity [Evidence IEA] GO_process : GO:0007160 - cell-matrix adhesion [Evidence IMP]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation function : melanoma-inhibitory-activity note : melanoma-inhibitory-activity; cartilage derived retinoic acid sensitive protein; melanoma inhibatory activity product : melanoma inhibitory activity 1 protein_id : NP_062267.1

name	Snrpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052541 GeneID:53607 MGI:1855690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : protein A of the U1 small nuclear RNA; U1 snRNP product : small nuclear ribonucleoprotein polypeptide A protein_id : NP_001040102.1

name	Snrpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052106 CCDS:CCDS21014.1 GeneID:53607 MGI:1855690
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : protein A of the U1 small nuclear RNA; U1 snRNP product : small nuclear ribonucleoprotein polypeptide A protein_id : NP_056597.3

name	Itpkc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712006 CCDS:CCDS21015.1 GeneID:233011 MGI:2442554
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : inositol 1,4,5-trisphosphate 3-kinase C protein_id : NP_853624.1

name	Adck4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244100 GeneID:76889 MGI:1924139
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : aarF domain containing kinase 4 protein_id : NP_598531.2

name	Numbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87042277 CCDS:CCDS21016.1 GeneID:18223 MGI:894702
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0007409 - axonogenesis [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0007399 - nervous system development [Evidence IMP]; GO:0007405 - neuroblast proliferation [Evidence IGI] codon_start : 1 product : numb-like protein_id : NP_035080.2

name	Ltbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32189330 CCDS:CCDS21017.1 GeneID:108075 MGI:1321395
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence ISS] [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] [Evidence ISS]; GO:0005539 - glycosaminoglycan binding [Evidence ISS]; GO:0019838 - growth factor binding [Evidence IEA]; GO:0005178 - integrin binding [Evidence ISS]; GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0007275 - development [Evidence ISS]; GO:0030252 - growth hormone secretion [Evidence ISS]; GO:0046879 - hormone secretion [Evidence IMP]; GO:0006457 - protein folding [Evidence ISS]; GO:0045595 - regulation of cell differentiation [Evidence ISS]; GO:0001558 - regulation of cell growth [Evidence ISS]; GO:0030162 - regulation of proteolysis [Evidence ISS]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence ISS]; GO:0007179 - transforming growth factor beta receptor signaling pathway [Evidence IMP] codon_start : 1 exception : mismatches in translation product : latent transforming growth factor beta binding protein 4 protein_id : NP_783572.1

name	Shkbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109659851 CCDS:CCDS21018.1 GeneID:192192 MGI:2385803
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 note : SETA binding protein 1 product : Sh3kbp1 binding protein 1 protein_id : NP_619617.2

name	Spnb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174793 CCDS:CCDS21019.1 GeneID:80297 MGI:1890574
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0043203 - axon hillock [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016363 - nuclear matrix [Evidence IDA] GO_process : GO:0051016 - barbed-end actin filament capping [Evidence IEA]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0019226 - transmission of nerve impulse [Evidence IMP] codon_start : 1 note : beta-spectrin 4; quivering; lumbosacral neuroaxonal dystrophy product : spectrin beta 4 protein_id : NP_115999.2

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 1 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 2 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 3 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 4 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 5 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 6 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 7 pseudo : _no_value

name	LOC232993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:232993
definition	number : 8 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 9 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 8 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 7 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 6 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 5 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 4 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 3 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 2 pseudo : _no_value

name	EG667957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667957
definition	number : 1 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 10 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 9 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 8 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 7 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 6 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 5 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 4 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 3 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 2 pseudo : _no_value

name	LOC623532 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623532
definition	number : 1 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 3 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 2 pseudo : _no_value

name	LOC100043195 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043195
definition	number : 1 pseudo : _no_value

name	LOC623830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623830
definition	number : 1 pseudo : _no_value

name	LOC623830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623830
definition	number : 2 pseudo : _no_value

name	LOC623830 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623830
definition	number : 3 pseudo : _no_value

name	LOC100043199 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043199
definition	number : 1 pseudo : _no_value

name	LOC434148 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256657 GeneID:434148
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 112 ESTs, 7 Proteins product : similar to GrpE-like 2, mitochondrial pseudo : _no_value transcript_id : XR_034878.1

name	LOC100043722 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256658 GeneID:100043722
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to ribosomal protein L15 pseudo : _no_value transcript_id : XR_034880.1

name	LOC667950 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256459 GeneID:667950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 2 Proteins product : similar to chondroitin sulfate proteoglycan 6 (bamacan) pseudo : _no_value transcript_id : XR_034331.1

name	LOC667968 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256463 GeneID:667968
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to ubiquitin specific peptidase 12 pseudo : _no_value transcript_id : XR_034342.1

clone name	MSMg01-407M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153D01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-419A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-115A03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-412D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306J03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-463M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-377D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-406C03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-218K22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-526F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078C09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-164A24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-544H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-437A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500C04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-332J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-351C05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-130A24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-333O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-321D14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-320K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-100P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321J21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-326A01.b	B6Ng01-326A01.g
ACC	GA113920	GA113921
length	1,174	983
definition	B6Ng01-326A01.b	B6Ng01-326A01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(27,157,383 - 27,158,563)	(27,053,364 - 27,053,921)
sequence	gaattcaccaactcgcttctaatatgcaatgtagcttgtactgaagattt ctatctcggtgggattccctggctctttcatggtaaacactctgtagacc agccctgagttgctgtccttactaaatactctgcagaccagccctgagct gccgactccgtcttttgtaatgtttaattagttactgaataggtaacttc cttactgcatttctaccggattccaagctcatcagcttctggcacattgg aacactggtgggagacttaactatatcagaattcaatcttaaaaggcact tataataaaataatactaaaagagagcacatgggtccatacactagacta actcgggcatagggtatgagtatacgggttaatgagaatgccaaagctcc aggaggtgcgtttccgtgaaactctttgcctcatgagtgtttccaggcct ctcgtcctcccaagcaaacttcactggagtgtgcatagcattatttaaag tgtcatgggaaaccatgaacttcaggctcaggaagggtttaaggacatgt tatattaattactgggagaaattcaacacatggtgatattgcacacgaat ctgaaatcagtgatatgtactccacttatttctttatgacatatgtatta taaccagaaggaatgagagtagaaacaccacataaagagatcaaagcaga aaacttaggtgagccaatgtagagcagaggaccccagttgggactttatg gttcatataaataagtcaagctgttaagatggaatttcatggactgggaa tatagctcagttgatagaattcttactttgtatacacttttgagtttgac tcttcagcacaggcttaaataaaagctatggtagctccataactataatc tcagcactgggggataaagttaggaacttaaagtcatccttagctatgta aagaatctgagcctggcttgtttacatgagattctatctaaaaaaggggc aagaatgggaaaatgaaatgtggtccattgaataatggctgctggatgag aatcattctccacaagggacgcctctgaccaggttatccaccccctgata catgtacatacaagcaaagctaagtggactatagtgcatataacatgtac aatattggtgcatgcacaagacat	gaattcatttctcttaggaaggcaaacaagagccatagaagattgagaga gtaaacattgattacttttggcaattttatacctttctttatctctttgc tattctgtggcccaaaatctctggcttttgccaattccctcttgctgata gcagcagtggattaagaaaataagtttaactttggtaaatggtatttctg cctagaaaatggtccattttgttaagatttttccaattttgtagtttata ggcttttgtaataagaaatttcccagtgtctcttgttaagtctcactttt catttctcattttgtttgtttggatactatctctctgtctttggttagtt tgactaaggatttgtctgtcttgttgatttactcaaagaaatagcttttg gtttctttgattttttaaaatcatttacatggtttctaactgcttgattt aagccctgcttgagtatttcattttctactacacttttgtgtgcatgctc tttttaaaaaatatttctagaaatttgaggtatagatttagattactgat atgagaactttctaatttctttatgaagatacttagtgctatgaactttc ctcttaagcctgctttcattgtgtcatataaatttgggtgtgaggcttaa ttttcattgaattctggaaagtcttcaatttctttatttcttgcctgagc tggagataatggaggtgaaaattgttcaatttcaattagtgtatagtgtt tctgtttttttcctgtttttgaagtccagcattaattaatttgatggtag tctgacaagatacaacacattatttcaattttactgtcacttaccaaact taaattaagatgaggtaaacagccctataaccacaatagaaatagaagca gtcatttaaaatccttggaactaaaatgcccagggtcatatagttttggt gcagaattcctaccatacttccaggagagtact
quality values	Open. Hide. 58 31 23 35 58 31 30 62 39 27 62 62 54 62 62 62 62 62 62 62 51 62 62 56 41 47 62 56 56 44 59 32 28 23 34 59 56 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 59 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 54 58 58 54 54 58 54 58 58 58 54 58 58 58 45 53 58 58 58 58 54 54 58 58 54 54 54 54 58 58 58 58 58 58 58 58 58 51 58 58 48 41 58 58 50 58 58 51 58 51 58 58 58 58 58 45 49 53 51 58 58 58 53 54 53 58 58 58 50 51 58 58 58 51 58 54 53 58 51 51 58 58 46 47 53 41 51 58 50 58 58 58 53 53 54 58 47 50 58 58 58 58 54 58 53 53 53 58 51 52 37 58 52 54 58 53 50 53 53 52 52 53 52 58 53 39 58 58 43 40 58 51 50 38 58 58 53 58 42 47 53 53 58 58 37 50 50 46 54 50 53 49 51 51 58 58 51 58 52 33 33 53 58 38 38 52 53 53 10 6 5 12 13 50 54 52 42 25 46 52 52 54 32 50 50 37 37 42 54 49 45 40 51 38 53 53 25 51 18 51 41 25 49 49 47 37 40 42 45 54 54 35 29 26 39 54 46 33 40 41 51 33 53 40 34 37 53 53 53 54 37 45 53 46 24 53 45 53 53 45 52 45 53 35 39 43 53 32 33 21 35 37 45 28 15 51 34 36 35 32 41 35 31 31 30 36 49 46 35 37 35 34 45 40 33 39 53 34 40 26 53 42 31 31 28 38 31 45 31 46 29 38 31 43 31 31 31 51 31 45 30 29 31 25 31 23 35 45 51 51 30 34 42 32 43 51 42 31 31 25 31 42 38 42 34 22 32 43 31 31 27 26 19 20 31 37 32 46 28 36 32 48 46 41 28 34 36 32 36 43 42 30 25 22 38 34 27 30 18 41 24 24 31 31 31 27 23 19 28 42 37 34 31 29 31 31 32 30 41 48 48 46 36 19 9 31 47 28 35 25 31 31 33 31 30 25 31 26 21 21 41 25 22 38 33 30 38 26 32 27 37 32 28 35 34 33 32 28 32 21 48 21 19 22 28 21 32 25 25 29 6 11 21 19 23 25 19 31 14 29 21 48 25 24 32 21 29 32 34 21 33 18 23 33 20 17 23 26 34 33 48 48 48 36 4 4 13 34 27 29 33 14 21 29 37 32 22 34 18 20 36 37 29 28 25 19 38 14 13 20 13 9 21 11 24 8 25 6 5 6 19 10 18 10 24 26 15 21 14 10 27 19 13 18 15 9 4 8 3 8 28 27 15 21 12 29 22 13 15 24 5 12 8 19 7 5 13 25 4 12 11 19 8 13 24 24 24 24 27 27 10 21 22 14 16 5 8 18 14 6 25 28 28 28 24 12 7 2 3 5 9 4 7 20 11 6 6 5 8 4 6 5 21 5 9 14 11 11 11 19 12 11 8 3 6 8 15 4 3 7 4 6 8 7 2 5 12 8 8 4 8 8 4 6 4 3 3 4 3 7 4 5 6 4 4 6 8 7 7 7 16 5 9 8 6 6 10 4 8 8 5 13 5 7	Open. Hide. 62 47 33 38 62 47 43 54 62 56 62 22 21 21 26 22 10 27 24 28 44 59 51 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 51 54 43 38 29 59 59 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 54 58 58 58 58 58 58 54 54 58 58 54 54 54 58 58 58 58 54 54 58 58 58 58 58 58 52 58 54 58 58 52 58 54 54 58 58 54 58 53 54 54 54 58 58 58 58 58 54 54 58 58 58 58 52 54 39 49 58 54 58 58 54 58 58 58 58 52 58 58 58 58 51 58 58 58 58 58 51 58 58 40 50 58 48 58 58 58 58 58 58 58 50 47 37 45 54 58 53 58 52 51 50 51 52 51 50 58 50 49 58 58 58 58 44 42 58 40 58 51 32 58 32 58 53 52 35 49 58 58 49 50 42 53 51 49 54 50 34 58 53 53 58 41 40 58 51 49 50 54 50 50 49 32 49 44 58 58 46 39 58 41 39 35 58 52 50 51 42 50 41 58 52 51 54 31 51 52 53 52 54 35 39 32 49 34 35 54 40 50 18 44 22 52 49 54 36 41 33 54 44 25 23 39 20 51 54 54 44 39 34 53 49 30 33 41 41 33 24 33 35 42 52 42 54 38 54 33 53 39 54 21 54 54 54 54 54 40 37 45 37 44 10 54 54 54 53 37 31 35 32 34 40 52 32 36 52 32 33 14 9 46 34 32 26 20 6 40 31 43 35 32 23 33 29 32 31 36 52 32 32 25 24 25 43 29 24 21 25 31 21 43 41 31 32 31 24 25 17 20 51 45 42 32 26 35 51 51 31 15 31 30 42 26 31 13 31 31 26 21 33 37 31 32 23 33 34 20 28 46 28 26 46 6 29 24 29 21 31 33 25 14 6 10 21 22 14 15 25 35 46 37 38 24 23 14 13 17 18 17 31 16 33 30 23 15 12 28 31 27 22 17 16 23 30 39 30 24 30 27 19 18 37 11 26 31 24 26 18 21 25 25 31 7 6 21 14 33 32 37 48 38 31 31 26 32 44 31 24 31 31 26 6 12 18 30 31 26 19 20 25 48 33 21 15 24 21 22 30 22 24 25 31 8 33 9 9 19 19 16 28 18 32 32 32 20 25 4 18 17 22 32 34 10 20 9 33 22 32 21

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_27157383_27158563
seq2: B6Ng01-326A01.b_47_1220 (reverse)

seq1  ATGTC-TGTGCATGCAC--ATA-TGTACATG-TATATGCAACCTAATAAG  45
      ||||| |||||||||||  ||| |||||||| ||||||||  |||   ||
seq2  ATGTCTTGTGCATGCACCAATATTGTACATGTTATATGCA--CTA--TAG  46

seq1  TCCACTTAGCTTTGCTTGTATGTACATGTATCCAGGGGGTGGATAACCTG  95
      ||||||||||||||||||||||||||||||| ||||||||||||||||| 
seq2  TCCACTTAGCTTTGCTTGTATGTACATGTAT-CAGGGGGTGGATAACCT-  94

seq1  GGTCAGA-GCGTCCCCTTGTGGAGAATGATTCTCCATTCCAGCAGCCATT  144
      ||||||| |||| |||||||||||||||||||||   |||||||||||||
seq2  GGTCAGAGGCGT-CCCTTGTGGAGAATGATTCTC--ATCCAGCAGCCATT  141

seq1  ATTC-ATTGACCACATTTCATTTTCCCATTCTTGCCCCCTTTTTTTAGAT  193
      |||| || ||||||||||||||||||||||||||||||  ||||||||||
seq2  ATTCAATGGACCACATTTCATTTTCCCATTCTTGCCCC--TTTTTTAGAT  189

seq1  AGAATCTCATGTAAACAAGCCAGGCTTCAGATTCTTTACATAGCTAAGGA  243
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AGAATCTCATGTAAACAAGCCAGGC-TCAGATTCTTTACATAGCTAAGGA  238

seq1  TGACTTTTAAGTTCCTAACTTTATCCCCCAGTGCTGAGATTATAGTTATG  293
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAC-TTTAAGTTCCTAACTTTATCCCCCAGTGCTGAGATTATAGTTATG  287

seq1  GAGCTACCATAGCTTTTATTTAAGCCTGTGCTGAAGAGTCAAACTCAAAA  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTACCATAGCTTTTATTTAAGCCTGTGCTGAAGAGTCAAACTCAAAA  337

seq1  GTGTATACAAAGTAAGAATTCTATCAACTGAGCTATATTCCCAGTCCATG  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTATACAAAGTAAGAATTCTATCAACTGAGCTATATTCCCAGTCCATG  387

seq1  AAATTCCATCTTAACAGCTTGACTTATTTATATGAACCATAAAGTCCCAA  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCCATCTTAACAGCTTGACTTATTTATATGAACCATAAAGTCCCAA  437

seq1  CTGGGGTCCTCTGCTCTACATTGGCTCACCTAAGTTTTTCTGCTTTGATC  493
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  CTGGGGTCCTCTGCTCTACATTGGCTCACCTAAG-TTTTCTGCTTTGATC  486

seq1  TCTTTATGTGGTGTTTCTACTCTCATTCCTTCTGGTTATAATACATATGT  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTATGTGGTGTTTCTACTCTCATTCCTTCTGGTTATAATACATATGT  536

seq1  CATAAAGAAATAAGTGGAGTACATATCACTGATTTCAGATTCGTGTGCAA  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAAAGAAATAAGTGGAGTACATATCACTGATTTCAGATTCGTGTGCAA  586

seq1  TATCACCATGTGTTGAATTTCTCCCAGTAATTAATATAACATGTCCTTAA  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCACCATGTGTTGAATTTCTCCCAGTAATTAATATAACATGTCCTTAA  636

seq1  ACCCTTCCTGAGCCTGAAGTTCATGGTTTCCCATGACACTTTAAATAATG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTTCCTGAGCCTGAAGTTCATGGTTTCCCATGACACTTTAAATAATG  686

seq1  CTATGCACACTCCAGTGAAGTTTGCTTGGGAGGACGAGAGGCCTGGAAAC  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATGCACACTCCAGTGAAGTTTGCTTGGGAGGACGAGAGGCCTGGAAAC  736

seq1  ACTCATGAGGCAAAGAGTTTCACGGAAACGCACCTCCTGGAGCTTTGGCA  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCATGAGGCAAAGAGTTTCACGGAAACGCACCTCCTGGAGCTTTGGCA  786

seq1  TTCTCATTAACCCGTATACTCATACCCTATGCCCGAGTTAGTCTAGTGTA  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCATTAACCCGTATACTCATACCCTATGCCCGAGTTAGTCTAGTGTA  836

seq1  TGGACCCATGTGCTCTCTTTTAGTATTATTTTATTATAAGTGCCTTTTAA  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGACCCATGTGCTCTCTTTTAGTATTATTTTATTATAAGTGCCTTTTAA  886

seq1  GATTGAATTCTGATATAGTTAAGTCTCCCACCAGTGTTCCAATGTGCCAG  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGAATTCTGATATAGTTAAGTCTCCCACCAGTGTTCCAATGTGCCAG  936

seq1  AAGCTGATGAGCTTGGAATCCGGTAGAAATGCAGTAAGGAAGTTACCTAT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCTGATGAGCTTGGAATCCGGTAGAAATGCAGTAAGGAAGTTACCTAT  986

seq1  TCAGTAACTAATTAAACATTACAAAAGACGGAGTCGGCAGCTCAGGGCTG  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTAACTAATTAAACATTACAAAAGACGGAGTCGGCAGCTCAGGGCTG  1036

seq1  GTCTGCAGAGTATTTAGTAAGGACAGCAACTCAGGGCTGGTCTACAGAGT  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTGCAGAGTATTTAGTAAGGACAGCAACTCAGGGCTGGTCTACAGAGT  1086

seq1  GTTTACCATGAAAGAGCCAGGGAATCCCACCGAGATAGAAATCTTCAGTA  1143
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTACCATGAAAGAGCCAGGGAATCCCACCGAGATAGAAATCTTCAGTA  1136

seq1  CAAGCTACATTGCATATTAGAAGCGAGTTGGTGAATTC  1181
      ||||||||||||||||||||||||||||||||||||||
seq2  CAAGCTACATTGCATATTAGAAGCGAGTTGGTGAATTC  1174

seq1: chr7_27053364_27053921
seq2: B6Ng01-326A01.g_65_622

seq1  GAATTCATTTCTCTTAGGAAGGCAAACAAGAGCCATAGAAGATTGAGAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTTCTCTTAGGAAGGCAAACAAGAGCCATAGAAGATTGAGAGA  50

seq1  GTAAACATTGATTACTTTTGGCAATTTTATACCTTTCTTTATCTCTTTGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAACATTGATTACTTTTGGCAATTTTATACCTTTCTTTATCTCTTTGC  100

seq1  TATTCTGTGGCCCAAAATCTCTGGCTTTTGCCAATTCCCTCTTGCTGATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCTGTGGCCCAAAATCTCTGGCTTTTGCCAATTCCCTCTTGCTGATA  150

seq1  GCAGCAGTGGATTAAGAAAATAAGTTTAACTTTGGTAAATGGTATTTCTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCAGTGGATTAAGAAAATAAGTTTAACTTTGGTAAATGGTATTTCTG  200

seq1  CCTAGAAAATGGTCCATTTTGTTAAGATTTTTCCAATTTTGTAGTTTATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGAAAATGGTCCATTTTGTTAAGATTTTTCCAATTTTGTAGTTTATA  250

seq1  GGCTTTTGTAATAAGAAATTTCCCAGTGTCTCTTGTTAAGTCTCACTTTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTTGTAATAAGAAATTTCCCAGTGTCTCTTGTTAAGTCTCACTTTT  300

seq1  CATTTCTCATTTTGTTTGTTTGGATACTATCTCTCTGTCTTTGGTTAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTCTCATTTTGTTTGTTTGGATACTATCTCTCTGTCTTTGGTTAGTT  350

seq1  TGACTAAGGATTTGTCTGTCTTGTTGATTTACTCAAAGAAATAGCTTTTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTAAGGATTTGTCTGTCTTGTTGATTTACTCAAAGAAATAGCTTTTG  400

seq1  GTTTCTTTGATTTTTTAAAATCATTTACATGGTTTCTAACTGCTTGATTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTCTTTGATTTTTTAAAATCATTTACATGGTTTCTAACTGCTTGATTT  450

seq1  AAGCCCTGCTTGAGTATTTCATTTTCTACTACACTTTTGTGTGCATGCTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCCTGCTTGAGTATTTCATTTTCTACTACACTTTTGTGTGCATGCTC  500

seq1  TTTTTAAAAAATATTTCTAGAAATTTGAGGTATAGATTTAGATTACTGAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAAAAAATATTTCTAGAAATTTGAGGTATAGATTTAGATTACTGAT  550

seq1  ATGAGAAC  558
      ||||||||
seq2  ATGAGAAC  558

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information