MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-337E23
Chromosome	7 (Build37)
Map Location	8,449,408 - 8,584,519
singlet/doublet	doublet
Overlap gene	LOC100042703, LOC100041967, LOC100042724
Upstream gene	LOC100041883, EG628117, Vmn2r33, LOC665470, EG665474, EG628368, LOC100042636, LOC665485, EG625353, Vmn2r-ps40, Vmn2r36, LOC638170, LOC100042662, LOC100041942, LOC100042673, LOC100041949, LOC100042681, LOC100042688, LOC100042695, LOC100041956, LOC100041961
Downstream gene	LOC100041977, LOC100041983, LOC100041989, LOC100041998, LOC100042009, LOC100042754, V2r14, EG628128, EG434109, LOC434110, EG628145, EG545909, LOC100042039, LOC100042781, LOC665539, LOC100042795, LOC100042060, EG665552, LOC100042790, LOC100042803
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041883 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG628117 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628117 MGI:3646304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Vmn2r33 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 30 Proteins

name	LOC665470 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	EG665474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665474 MGI:3643732
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG628368 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628368 MGI:3646850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	LOC100042636 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 3 ESTs, 12 Proteins

name	LOC665485 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	EG625353 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins

name	Vmn2r-ps40 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	Vmn2r36 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 22 Proteins

name	LOC638170 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638170
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042662 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 Proteins pseudo : _no_value

name	LOC100041942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC100042673 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 21 Proteins

name	LOC100041949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100042681 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 Proteins

name	LOC100042688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 4 ESTs, 20 Proteins

name	LOC100042695 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 Proteins

name	LOC100041956 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041956
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042703 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins

name	LOC100041967 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041967
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042724 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 22 Proteins

name	LOC100041977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC100041983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	LOC100041989 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100041998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins pseudo : _no_value

name	LOC100042009 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042009
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	LOC100042754 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins pseudo : _no_value

name	V2r14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22305 MGI:1316711
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628128 MGI:3643130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins

name	EG434109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434109 MGI:3646061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	LOC434110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 23 Proteins

name	EG628145 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628145 MGI:3643847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	EG545909 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545909 MGI:3704108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins

name	LOC100042039 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042781 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 23 Proteins

name	LOC665539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	LOC100042795 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100042060 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG665552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665552 MGI:3643128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 6 Proteins pseudo : _no_value

name	LOC100042790 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 Proteins

name	LOC100042803 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042803
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 Proteins pseudo : _no_value

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379371 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 1 transcript_id : XM_620409.3

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903082 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 2 transcript_id : XM_899013.1

name	Vmn2r33 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256174 GeneID:624512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : vomeronasal receptor Vmn2r33, transcript variant 3 transcript_id : XM_899030.3

name	EG628368 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379360 GeneID:628368 MGI:3646850
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : predicted gene, EG628368 transcript_id : XM_893101.2

name	LOC100042636 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256175 GeneID:100042636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 8 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 1 transcript_id : XM_001478838.1

name	LOC100042636 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256177 GeneID:100042636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 2 transcript_id : XM_001478846.1

name	EG625353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379374 GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 Proteins product : predicted gene, EG625353, transcript variant 1 transcript_id : XM_890819.2

name	EG625353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82903106 GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG625353, transcript variant 2 transcript_id : XM_899240.1

name	EG625353 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256181 GeneID:625353 MGI:3646200
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : predicted gene, EG625353, transcript variant 3 transcript_id : XM_899254.3

name	Vmn2r36 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256185 GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : vomeronasal receptor Vmn2r36, transcript variant 2 transcript_id : XM_001478895.1

name	Vmn2r36 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256187 GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : vomeronasal receptor Vmn2r36, transcript variant 3 transcript_id : XM_001478904.1

name	Vmn2r36 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256183 GeneID:100042653
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : vomeronasal receptor Vmn2r36, transcript variant 1 transcript_id : XM_001478890.1

name	LOC100042673 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256193 GeneID:100042673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 2 transcript_id : XM_001478928.1

name	LOC100042673 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256191 GeneID:100042673
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : similar to vomeronasal 2, receptor, 14, transcript variant 1 transcript_id : XM_001478919.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256201 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478937.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256199 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478933.1

name	LOC100042681 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256203 GeneID:100042681
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001478952.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256206 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478969.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256208 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 10 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478976.1

name	LOC100042688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256210 GeneID:100042688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 6 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001478984.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256214 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001478989.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256216 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001478996.1

name	LOC100042695 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256218 GeneID:100042695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479004.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256222 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 30 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479014.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256224 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479020.1

name	LOC100042703 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256226 GeneID:100042703
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479025.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256240 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 11 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479046.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256242 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479051.1

name	LOC100042724 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256238 GeneID:100042724
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479040.1

name	LOC100041983 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256110 GeneID:100041983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : similar to EC2-V2R pheromone receptor protein transcript_id : XM_001477335.1

name	V2r14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734848 GeneID:22305 MGI:1316711
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 2, receptor, 14 transcript_id : NM_009489.2

name	EG628128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379363 GeneID:628128 MGI:3643130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : predicted gene, EG628128 transcript_id : XM_892854.2

name	EG434109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256112 GeneID:434109 MGI:3646061
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : predicted gene, EG434109, transcript variant 1 transcript_id : XM_485851.4

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379383 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_485852.3

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256264 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_899084.3

name	LOC434110 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82903094 GeneID:434110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_899075.1

name	EG545909 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379372 GeneID:545909 MGI:3704108
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 Proteins product : predicted gene, EG545909 transcript_id : XM_620411.3

name	LOC100042039 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256115 GeneID:100042039
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to putative pheromone receptor transcript_id : XM_001477445.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256269 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479133.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256271 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 7 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479139.1

name	LOC100042781 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256267 GeneID:100042781
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479128.1

name	LOC665539 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256117 GeneID:665539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to EC2-V2R pheromone receptor protein transcript_id : XM_001477467.1

name	LOC100042795 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256279 GeneID:100042795
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to 2810047C21Rik protein transcript_id : XM_001479193.1

name	LOC100042060 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256119 GeneID:100042060
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to predicted gene, EG665255 transcript_id : XM_001477489.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256273 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 1 transcript_id : XM_001479158.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256275 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 2 transcript_id : XM_001479164.1

name	LOC100042790 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256277 GeneID:100042790
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : similar to vomeronasal 2, receptor, 15, transcript variant 3 transcript_id : XM_001479175.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903083 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904106.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903087 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904123.1

name	Vmn2r33 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903085 GeneID:624512
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_620409.2

name	EG628368 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379361 GeneID:628368 MGI:3646850
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_898194.2

name	LOC100042636 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256178 GeneID:100042636
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 2 protein_id : XP_001478896.1

name	LOC100042636 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256176 GeneID:100042636
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 1 protein_id : XP_001478888.1

name	EG625353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82903107 GeneID:625353 MGI:3646200
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904333.1

name	EG625353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256182 GeneID:625353 MGI:3646200
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904347.3

name	EG625353 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256180 GeneID:625353 MGI:3646200
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_895912.3

name	Vmn2r36 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256186 GeneID:100042653
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001478945.1

name	Vmn2r36 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256184 GeneID:100042653
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001478940.1

name	Vmn2r36 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256188 GeneID:100042653
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001478954.1

name	LOC100042673 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256194 GeneID:100042673
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 2 protein_id : XP_001478978.1

name	LOC100042673 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256192 GeneID:100042673
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 14 isoform 1 protein_id : XP_001478969.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256202 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001478987.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256200 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001478983.1

name	LOC100042681 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256204 GeneID:100042681
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479002.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256207 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479019.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256209 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479026.1

name	LOC100042688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256211 GeneID:100042688
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479034.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256215 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479039.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256217 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479046.1

name	LOC100042695 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256219 GeneID:100042695
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479054.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256223 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479064.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256225 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479070.1

name	LOC100042703 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256227 GeneID:100042703
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479075.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256239 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479090.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256241 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479096.1

name	LOC100042724 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256243 GeneID:100042724
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479101.1

name	LOC100041983 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256111 GeneID:100041983
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_001477385.1

name	V2r14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112734849 CCDS:CCDS20787.1 GeneID:22305 MGI:1316711
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 note : vomeronasal organ family 2, receptor, 14 product : vomeronasal 2, receptor, 14 protein_id : NP_033515.2

name	EG628128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379364 GeneID:628128 MGI:3643130
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_897947.2

name	EG434109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256113 GeneID:434109 MGI:3646061
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485851.4

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903099 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_904177.1

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903095 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_904168.1

name	LOC434110 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82903097 GeneID:434110
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_485852.2

name	EG545909 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63555338 GeneID:545909 MGI:3704108
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_620411.1

name	LOC100042039 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256116 GeneID:100042039
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001477495.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256268 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479178.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256270 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479183.1

name	LOC100042781 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256272 GeneID:100042781
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479189.1

name	LOC665539 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256118 GeneID:665539
definition	codon_start : 1 product : similar to EC2-V2R pheromone receptor protein protein_id : XP_001477517.1

name	LOC100042795 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256280 GeneID:100042795
definition	codon_start : 1 product : similar to 2810047C21Rik protein protein_id : XP_001479243.1

name	LOC100042060 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256120 GeneID:100042060
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_001477539.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256274 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 1 protein_id : XP_001479208.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256276 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 2 protein_id : XP_001479214.1

name	LOC100042790 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256278 GeneID:100042790
definition	codon_start : 1 product : similar to vomeronasal 2, receptor, 15 isoform 3 protein_id : XP_001479225.1

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 4 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 3 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 2 pseudo : _no_value

name	LOC100041883 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041883
definition	number : 1 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 6 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 5 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 4 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 3 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 2 pseudo : _no_value

name	EG665474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665474
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 7 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps40 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665495
definition	number : 1 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 6 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 5 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 4 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 3 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 2 pseudo : _no_value

name	LOC638170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:638170
definition	number : 1 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 6 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 5 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 4 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 3 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 2 pseudo : _no_value

name	LOC100042662 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042662
definition	number : 1 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 7 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 6 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 5 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 4 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 3 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 2 pseudo : _no_value

name	LOC100041942 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041942
definition	number : 1 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 6 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 5 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 4 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 3 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 2 pseudo : _no_value

name	LOC100041949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041949
definition	number : 1 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 1 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 2 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 3 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 4 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 5 pseudo : _no_value

name	LOC100041956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041956
definition	number : 6 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 1 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 2 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 3 pseudo : _no_value

name	LOC100041961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041961
definition	number : 4 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 1 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 2 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 3 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 4 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 5 pseudo : _no_value

name	LOC100041967 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041967
definition	number : 6 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 1 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 2 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 3 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 4 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 5 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 6 pseudo : _no_value

name	LOC100041977 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041977
definition	number : 7 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 1 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 2 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 3 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 4 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 5 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 6 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 7 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 8 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 9 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 10 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 11 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 12 pseudo : _no_value

name	LOC100041989 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041989
definition	number : 13 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 1 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 2 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 3 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 4 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 5 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 6 pseudo : _no_value

name	LOC100041998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041998
definition	number : 7 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 1 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 2 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 3 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 4 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 5 pseudo : _no_value

name	LOC100042009 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042009
definition	number : 6 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 1 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 2 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 3 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 4 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 5 pseudo : _no_value

name	LOC100042803 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042803
definition	number : 6 pseudo : _no_value

name	EG628117 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256107 GeneID:628117 MGI:3646304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG628117 pseudo : _no_value transcript_id : XR_033094.1

name	LOC665470 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256108 GeneID:665470
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to putative pheromone receptor pseudo : _no_value transcript_id : XR_033101.1

name	LOC665485 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256179 GeneID:665485
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to predicted gene, EG665255 pseudo : _no_value transcript_id : XR_033937.1

name	LOC100042754 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256258 GeneID:100042754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 19 Proteins product : similar to predicted gene, EG665255 pseudo : _no_value transcript_id : XR_034040.1

name	EG628145 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256114 GeneID:628145 MGI:3643847
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG628145 pseudo : _no_value transcript_id : XR_033222.1

name	EG665552 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94379373 GeneID:665552 MGI:3643128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 3 ESTs, 6 Proteins product : predicted gene, EG665552 pseudo : _no_value transcript_id : XR_001747.1

clone name	MSMg01-384L21
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-344N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-337E23.b	B6Ng01-337E23.g
ACC	GA121978	GA121979
length	844	1,108
definition	B6Ng01-337E23.b	B6Ng01-337E23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(8,449,408 - 8,450,250)	(8,583,409 - 8,584,519)
sequence	gaattctgtcaaatgtaaagttggtacatacccaccaaatattgggttat agtgcatgtgtctagttttagaatcactctcactggttgctctagtgata tcaggaagtatcatatctactgaacttccctacagtgtccataaaatctt gcactcattcactttcttcattttctctcagagaactaaactctctaatt attacaattttattctttattttgctttcatggagatggccctctggtaa cagccaaaaaatgttgataaggcagttgaatccaccactttgtgtagaaa aatgagatctaggaagacagggttacacataaaaaccatctaccaaatca aataatcaatgagaaacacagactaactaaataatcagcaaagatgaaat cagaacatattttctgatttccagtaagagcacacacataagaaaatact tacttttttcatctgttcttcaatctactggccaatagtctaaggaggaa atgttccttttctgctgtcaaataaaaatatattatatccaacaatgatc agaagcccagggactctctggatgaattgggaatattgggaagaagctga ggaggagggtgaccagcattctcaacaaacctggacaagcaagatctctc aggcattgagcctctaaccagagatcatacactagctgatgtgaagcccc caacaaatatgcagcataagactgcctggtctagcatcagtgggagagac acacctaaccccagagagacttaagtctccagggattgggaagggctggg cgttggggaggtagggatatcatcttggagatggggggaggagt	gaattccattaaaccgtagtttgaatatcaaatctttctttgcaacaatg ccatcttccatgaattttcaatgagtaaaatgtggatgttaatgaagaat gtgtttcttaaagggacagtgctaatgattatatttccatgaagactgac ttagggaagtgattgtttttgttaatgcattttagacccatttggtttcc cataatataatgcgaattgataaatgtgaaatatttagtgtagccgcaaa cactcaattttctttttgaaaagtcgtttcctagaaagcagcgtaattaa agcatctgactctcattctgttttccagaattttctgagtccaggacctc aatcagaactgcacacagagggcaatctctgaaagaaattaggttcatgc aaatgtcagtagttttacctatcccttccataactacaatatgaatagca tgttgccatagctacaagcttatttcatttcattttttatttattattac tcaattttttttacagtctagtggttatccccctcctggtttgcccccct gactcttcctcatctatcaactcctcccccatatccaagatgatatccct acctccctaacgcccagcccttcccaatccctggggacttaagtctctct ggggttaggtgtgtctatcccactgatgctacaccaggcagtcttatgct gcatatttgttgggggcttcacatcagctagtgtatgatctctggttaga ggctcaatgtctgagagatcttgcttgtccaggtttgatgagactgcttg tgtttctatgggttgtcctcctcttctttttgcaactattcccaattcat ccacaggggcccctggctgatgtccattgttggatataatatatttgtac ttgacagcagaaaaggaacatttcccttcatagactatcgggccaatagc ttgaagacagatgaaaaaagtcagtattttttatgtgtgtgctctacttg aatcagaaaaataatgttctgatttcatctttgctgattatttagtaagg ttgtgtctcactgaatatttggatttgtagaatgatttctaatgggtaaa cagcctgt
quality values	Open. Hide. 49 31 22 32 58 58 47 31 54 41 28 47 62 47 49 62 62 62 43 49 62 62 62 47 62 42 62 51 62 62 62 62 47 43 62 59 59 62 62 62 62 59 62 62 49 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 54 47 58 54 54 52 46 54 58 58 58 52 54 58 54 54 58 58 51 52 58 58 58 54 58 58 58 58 52 58 54 58 58 58 58 54 54 58 54 41 48 58 54 54 54 58 58 51 51 58 58 49 58 54 50 50 41 47 50 50 49 58 29 38 58 53 58 54 58 58 58 42 41 58 58 40 42 58 58 58 58 58 50 40 41 28 58 58 58 58 58 58 33 58 58 35 49 58 54 49 23 58 41 25 58 41 17 58 54 46 58 28 20 43 50 52 53 50 47 51 52 58 53 52 54 50 50 49 44 42 54 50 58 49 35 40 32 58 36 49 43 54 42 39 41 50 54 53 51 52 50 29 58 41 27 46 42 38 39 37 44 44 49 40 39 30 42 34 42 39 45 53 26 35 34 45 45 52 50 40 40 50 47 53 42 41 44 47 33 22 51 47 38 47 52 37 24 22 31 35 35 19 51 46 35 47 39 41 52 42 44 38 33 40 52 52 40 41 46 40 51 32 52 53 45 46 32 45 40 28 34 31 32 29 34 32 45 40 31 32 32 40 36 36 49 41 46 33 30 16 25 34 41 28 34 38 25 53 45 32 29 32 30 31 34 29 31 28 29 32 31 51 30 31 31 31 31 37 31 38 24 31 40 38 15 12 27 31 47 45 35 42 26 47 32 26 34 31 46 40 32 32 31 25 30 46 46 30 31 13 44 22 30 30 47 36 32 25 31 32 32 34 34 36 31 31 32 29 43 8 31 24 31 46 46 46 46 22 28 7 32 18 8 7	Open. Hide. 62 47 42 47 62 62 47 29 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 62 59 59 54 54 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 54 54 53 58 58 58 58 58 58 58 58 58 54 54 51 54 58 58 58 58 58 58 58 58 58 58 58 51 58 58 58 49 58 58 58 58 58 58 51 51 50 58 51 58 54 53 54 58 53 53 51 51 51 54 50 51 58 58 58 58 49 58 58 58 46 43 39 44 49 54 58 54 54 43 37 58 42 49 37 58 58 34 58 54 53 49 43 48 48 43 44 49 51 43 43 41 53 54 50 53 50 58 43 52 40 50 44 51 51 51 50 58 50 49 46 51 50 44 54 51 58 44 58 51 37 32 52 50 37 51 40 52 53 53 51 51 51 52 54 26 26 42 49 39 41 32 54 53 54 52 54 49 41 53 53 53 44 34 31 40 41 34 39 39 37 51 50 46 40 50 35 47 47 39 40 54 49 53 35 39 39 39 47 47 31 49 40 42 47 45 34 39 38 42 25 33 46 37 53 52 54 54 54 54 36 47 52 40 30 44 32 52 42 42 31 52 32 32 31 29 52 31 36 34 45 33 31 45 35 45 31 52 51 32 34 32 23 42 23 46 29 32 28 30 45 36 52 33 41 34 43 46 18 38 19 27 28 39 38 41 33 31 42 30 33 30 32 31 30 32 32 31 47 37 31 32 26 30 51 16 32 28 34 42 31 41 28 40 28 46 31 46 31 31 31 31 31 31 48 36 22 31 42 26 31 42 31 31 42 30 42 31 31 31 31 46 46 46 37 27 22 30 25 32 30 30 31 39 32 46 32 31 21 15 29 31 31 31 30 39 32 36 25 20 47 46 22 23 41 41 23 19 28 19 26 33 32 37 21 42 34 20 22 31 26 26 35 25 13 33 19 31 16 32 25 20 31 29 37 31 21 22 47 26 29 10 27 32 31 26 30 36 32 32 32 33 32 17 31 34 39 26 25 15 14 17 15 21 32 48 31 6 31 12 32 19 15 18 27 31 15 19 24 34 32 32 27 8 31 14 20 8 23 16 21 29 13 32 18 17 28 25 32 7 32 3 8 15 23 15 17 26 15 7 13 29 5 3 5 21 28 28 22 19 18 34 34 47 34 19 11 16 13 17 13 13 17 17 28 13 6 6 21 9 20 13 15 8 21 8 14 18 24 11 24 34 30 30 20 5 5 14 10 8 11 7 15 12 18 23 6 29 14 22 17 13 12 8 28 18 16 18 16 20 23 6 9 16 11 26 16 15 6 17 7 22 5 3 12 9 7 4 2 3 2 3 18 16 21 16 13 9 6 3 5 9 28 21 5 5 22 5 24 12 3 3 6 5 16 25 9 3 2 3 10 5 7 7 10 5 4 5 12 18 8 8 11 4 3 2 1 2 3 4 5 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_8449408_8450250
seq2: B6Ng01-337E23.b_47_890

seq1  GAATTCTGTCAAATGTAAAGTTGGTACATACCCACCAAATATTGGGTTAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGTCAAATGTAAAGTTGGTACATACCCACCAAATATTGGGTTAT  50

seq1  AGTGCATGTGTCTAGTTTTAGAATCACTCTCACTGGTTGCTCTAGTGATA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCATGTGTCTAGTTTTAGAATCACTCTCACTGGTTGCTCTAGTGATA  100

seq1  TCAGGAAGTATCATATCTACTGAACTTCCCTACAGTGTCCATAAAATCTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGAAGTATCATATCTACTGAACTTCCCTACAGTGTCCATAAAATCTT  150

seq1  GCACTCATTCACTTTCTTCATTTTCTCTCAGAGAACTAAACTCTCTAATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTCATTCACTTTCTTCATTTTCTCTCAGAGAACTAAACTCTCTAATT  200

seq1  ATTACAATTTTATTCTTTATTTTGCTTTCATGGAGATGGCCCTCTGGTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACAATTTTATTCTTTATTTTGCTTTCATGGAGATGGCCCTCTGGTAA  250

seq1  CAGCCAAAAAATGTTGATAAGGCAGTTGAATCCACCACTTTGTGTAGAAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCAAAAAATGTTGATAAGGCAGTTGAATCCACCACTTTGTGTAGAAA  300

seq1  AATGAGATCTAGGAAGACAGGGTTACACATAAAAACCATCTACCAAATCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAGATCTAGGAAGACAGGGTTACACATAAAAACCATCTACCAAATCA  350

seq1  AATAATCAATGAGAAACACAGACTAACTAAATAATCAGCAAAGATGAAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAATCAATGAGAAACACAGACTAACTAAATAATCAGCAAAGATGAAAT  400

seq1  CAGAACATATTTTCTGATTTCCAGTAAGAGCACACACATAAGAAAATACT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAACATATTTTCTGATTTCCAGTAAGAGCACACACATAAGAAAATACT  450

seq1  TACTTTTTTCATCTGTTCTTCAATCTACTGGCCAATAGTCTAAGGAGGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTTTTTCATCTGTTCTTCAATCTACTGGCCAATAGTCTAAGGAGGAA  500

seq1  ATGTTCCTTTTCTGCTGTCAAATAAAAATATATTATATCCAACAATGATC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTCCTTTTCTGCTGTCAAATAAAAATATATTATATCCAACAATGATC  550

seq1  AGAAGCCCAGGGACTCTCTGGATGAATTGGGAATATTGGGAAGAAGCTGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGCCCAGGGACTCTCTGGATGAATTGGGAATATTGGGAAGAAGCTGA  600

seq1  GGAGGAGGGTGACCAGCATTCTCAACAAACCTGGACAAGCAAGATCTCTC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGAGGGTGACCAGCATTCTCAACAAACCTGGACAAGCAAGATCTCTC  650

seq1  AGGCATTGAGCCTCTAACCAGAGATCATACACTAGCTGATGTGAAGCCCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCATTGAGCCTCTAACCAGAGATCATACACTAGCTGATGTGAAGCCCC  700

seq1  CAACAAATATGCAGCATAAGACTGCCTGGTCTAGCATCAGTGGGAGAGAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAAATATGCAGCATAAGACTGCCTGGTCTAGCATCAGTGGGAGAGAC  750

seq1  ACACCTAACCCCAGAGAGACTTAAGTCTCCAGGGATTGGGAAGGGCTGGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACCTAACCCCAGAGAGACTTAAGTCTCCAGGGATTGGGAAGGGCTGGG  800

seq1  CGTTGGGGAGGTAGGGATATCATCTTGGAGAT-GGGGGAGGAGT  843
      |||||||||||||||||||||||||||||||| |||||||||||
seq2  CGTTGGGGAGGTAGGGATATCATCTTGGAGATGGGGGGAGGAGT  844

seq1: chr7_8583409_8584519
seq2: B6Ng01-337E23.g_66_1173 (reverse)

seq1  ACAGGCTGGGTTACACA-TAGAAACCA-TCTACCAAATCAAATAATCAGT  48
      ||||||| | |||| || |||||| || ||||| ||  |||||| |||||
seq2  ACAGGCT-GTTTACCCATTAGAAATCATTCTACAAATCCAAATATTCAGT  49

seq1  GAGAAACACAAACTTAACTAAATAATCAGCAAAGATGAAATCAGAACAT-  97
      |||  |||||| ||| ||||||||||||||||||||||||||||||||| 
seq2  GAG--ACACAACCTT-ACTAAATAATCAGCAAAGATGAAATCAGAACATT  96

seq1  -ATTTTCTGATTTCAAGTAAGAGCACACACATAAAAAATACTGACTTTTT  146
        |||||||| ||||||| ||||||||||||||||||||||||||  |||
seq2  ATTTTTCTGA-TTCAAGT-AGAGCACACACATAAAAAATACTGAC--TTT  142

seq1  TTTCATCTGTTCTTCAAGCTATTGG-CCGATAGTCTATGAA-GGAAATGT  194
      ||||||||| ||||||||||||||| ||||||||||||||| ||||||||
seq2  TTTCATCTG-TCTTCAAGCTATTGGCCCGATAGTCTATGAAGGGAAATGT  191

seq1  TCCTTTTCTGCTGTCAAGTACAAATATATTATATCCAACAATGGACATCA  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTTTCTGCTGTCAAGTACAAATATATTATATCCAACAATGGACATCA  241

seq1  GCCAGGGGCCCCTGTGGATGAATTGGGAATAGTTGCAAAAAGAAGAGGAG  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGGGGCCCCTGTGGATGAATTGGGAATAGTTGCAAAAAGAAGAGGAG  291

seq1  GACAACCCATAGAAACACAAGCAGTCTCATCAAACCTGGACAAGCAAGAT  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAACCCATAGAAACACAAGCAGTCTCATCAAACCTGGACAAGCAAGAT  341

seq1  CTCTCAGACATTGAGCCTCTAACCAGAGATCATACACTAGCTGATGTGAA  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCAGACATTGAGCCTCTAACCAGAGATCATACACTAGCTGATGTGAA  391

seq1  GCCCCCAACAAATATGCAGCATAAGACTGCCTGGTGTAGCATCAGTGGGA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCCCAACAAATATGCAGCATAAGACTGCCTGGTGTAGCATCAGTGGGA  441

seq1  TAGACACACCTAACCCCAGAGAGACTTAAGTCCCCAGGGATTGGGAAGGG  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACACACCTAACCCCAGAGAGACTTAAGTCCCCAGGGATTGGGAAGGG  491

seq1  CTGGGCGTTAGGGAGGTAGGGATATCATCTTGGATATGGGGGAGGAGTTG  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGCGTTAGGGAGGTAGGGATATCATCTTGGATATGGGGGAGGAGTTG  541

seq1  ATAGATGAGGAAGAGTCAGGGGGGCAAACCAGGAGGGGGATAACCACTAG  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGATGAGGAAGAGTCAGGGGGGCAAACCAGGAGGGGGATAACCACTAG  591

seq1  ACTGTAAAAAAAATTGAGTAATAATAAATAAAAAATGAAATGAAATAAGC  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTAAAAAAAATTGAGTAATAATAAATAAAAAATGAAATGAAATAAGC  641

seq1  TTGTAGCTATGGCAACATGCTATTCATATTGTAGTTATGGAAGGGATAGG  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTAGCTATGGCAACATGCTATTCATATTGTAGTTATGGAAGGGATAGG  691

seq1  TAAAACTACTGACATTTGCATGAACCTAATTTCTTTCAGAGATTGCCCTC  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAACTACTGACATTTGCATGAACCTAATTTCTTTCAGAGATTGCCCTC  741

seq1  TGTGTGCAGTTCTGATTGAGGTCCTGGACTCAGAAAATTCTGGAAAACAG  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGCAGTTCTGATTGAGGTCCTGGACTCAGAAAATTCTGGAAAACAG  791

seq1  AATGAGAGTCAGATGCTTTAATTACGCTGCTTTCTAGGAAACGACTTTTC  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAGAGTCAGATGCTTTAATTACGCTGCTTTCTAGGAAACGACTTTTC  841

seq1  AAAAAGAAAATTGAGTGTTTGCGGCTACACTAAATATTTCACATTTATCA  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAGAAAATTGAGTGTTTGCGGCTACACTAAATATTTCACATTTATCA  891

seq1  ATTCGCATTATATTATGGGAAACCAAATGGGTCTAAAATGCATTAACAAA  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCGCATTATATTATGGGAAACCAAATGGGTCTAAAATGCATTAACAAA  941

seq1  AACAATCACTTCCCTAAGTCAGTCTTCATGGAAATATAATCATTAGCACT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAATCACTTCCCTAAGTCAGTCTTCATGGAAATATAATCATTAGCACT  991

seq1  GTCCCTTTAAGAAACACATTCTTCATTAACATCCACATTTTACTCATTGA  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCTTTAAGAAACACATTCTTCATTAACATCCACATTTTACTCATTGA  1041

seq1  AAATTCATGGAAGATGGCATTGTTGCAAAGAAAGATTTGATATTCAAACT  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCATGGAAGATGGCATTGTTGCAAAGAAAGATTTGATATTCAAACT  1091

seq1  ACGGTTTAATGGAATTC  1111
      |||||||||||||||||
seq2  ACGGTTTAATGGAATTC  1108

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information