MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-341A23
Chromosome	7 (Build37)
Map Location	135,546,750 - 135,547,798
singlet/doublet	singlet
Overlap gene	Rgs10
Upstream gene	Zfp764, Zfp688, Zfp689, Prr14, Fbs1, 1700008J07Rik, LOC100043597, D030022P06Rik, Phkg2, Gm166, Rnf40, 1700120K04Rik, Zfp629, Bcl7c, Ctf1, Ctf2, Fbxl19, Tmem142c, Setd1a, Hsd3b7, Stx1b2, Stx4a, Zfp668, Zfp646, BC039632, Vkorc1, Bckdk, Myst1, Prss8, Prss36, Fus, Pycard, Trim72, LOC436010, EG668675, Itgam, Itgax, Itgad, Cox6a2, LOC100043133, Armc5, Tgfb1i1, Slc5a2, BC017158, EG628781
Downstream gene	LOC100043643, Tial1, Bag3, EG639030, Inpp5f, LOC100043651, 1110007A13Rik, Sec23ip, LOC210714, LOC100043144, Ppapdc1a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zfp764 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233893 MGI:2443580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp688 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69234 MGI:1916484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp689 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71131 MGI:1918381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prr14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233895 MGI:2384565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14123 MGI:104648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins

name	1700008J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629159 MGI:1916610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 42 ESTs

name	LOC100043597 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 4 Proteins

name	D030022P06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546001 MGI:2444036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs

name	Phkg2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68961 MGI:1916211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233899 MGI:2685012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233900 MGI:2142048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700120K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68232 MGI:1915482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs

name	Zfp629 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320683 MGI:2444524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl7c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12055 MGI:1332237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13019 MGI:105115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244218 MGI:2684607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233902 MGI:3039600
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem142c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269999 MGI:3039586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233904 MGI:2446244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsd3b7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101502 MGI:2141879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stx1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56216 MGI:1930705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Stx4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20909 MGI:893577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp668 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244219 MGI:2442943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp646 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233905 MGI:3665412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC039632 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330657 MGI:2652890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vkorc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27973 MGI:106442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bckdk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12041 MGI:1276121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67773 MGI:1915023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76560 MGI:1923810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prss36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77613 MGI:1924863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fus (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233908 MGI:1353633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pycard (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66824 MGI:1931465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim72 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434246 MGI:3612190
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins pseudo : _no_value

name	EG668675 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668675 MGI:3648098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 ESTs, 4 Proteins

name	Itgam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16409 MGI:96607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Itgax (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16411 MGI:96609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381924 MGI:3578624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox6a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12862 MGI:104649
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	Armc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233912 MGI:2384586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tgfb1i1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21804 MGI:102784
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246787 MGI:2181411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC017158 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233913 MGI:2384572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628781 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628781 MGI:3644024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 347 ESTs, 4 Proteins

name	Rgs10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67865 MGI:1915115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043643 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tial1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21843 MGI:107913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bag3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29810 MGI:1352493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG639030 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:639030 MGI:3644893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Inpp5f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101490 MGI:2141867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	1110007A13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210711 MGI:1920977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sec23ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207352 MGI:2450915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC210714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:210714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 16 Proteins pseudo : _no_value

name	LOC100043144 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Ppapdc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381925 MGI:2685936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp764 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368979 GeneID:233893 MGI:2443580
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 764 transcript_id : NM_146203.3

name	Zfp688 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802604 GeneID:69234 MGI:1916484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 688 transcript_id : NM_026999.2

name	Zfp689 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340961 GeneID:71131 MGI:1918381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 689 transcript_id : NM_175163.2

name	Prr14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328356 GeneID:233895 MGI:2384565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline rich 14 transcript_id : NM_145589.2

name	Fbs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257715 GeneID:14123 MGI:104648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 30 ESTs, 3 Proteins product : fibrosin 1, transcript variant 1 transcript_id : XM_284344.7

name	1700008J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257798 GeneID:629159 MGI:1916610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 42 ESTs product : RIKEN cDNA 1700008J07 gene transcript_id : XM_001002915.2

name	LOC100043597 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257794 GeneID:100043597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 4 Proteins product : similar to Snf2-related CBP activator protein transcript_id : XM_001480403.1

name	D030022P06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257796 GeneID:546001 MGI:2444036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs product : RIKEN cDNA D030022P06 gene transcript_id : XM_001480404.1

name	Phkg2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356245 GeneID:68961 MGI:1916211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase, gamma 2 (testis) transcript_id : NM_026888.2

name	Gm166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377175 GeneID:233899 MGI:2685012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 166, (NCBI) transcript_id : NM_001033040.2

name	Rnf40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986594 GeneID:233900 MGI:2142048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 40 transcript_id : NM_172281.1

name	Zfp629 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130365 GeneID:320683 MGI:2444524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 629 transcript_id : NM_177226.5

name	Bcl7c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328165 GeneID:12055 MGI:1332237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 7C transcript_id : NM_009746.2

name	Ctf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681074 GeneID:13019 MGI:105115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiotrophin 1 transcript_id : NM_007795.1

name	Ctf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38524597 GeneID:244218 MGI:2684607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiotrophin 2 transcript_id : NM_198858.1

name	Fbxl19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254239 GeneID:233902 MGI:3039600
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 19 transcript_id : NM_172748.2

name	Tmem142c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802906 GeneID:269999 MGI:3039586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 142C transcript_id : NM_198424.3

name	Setd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119508421 GeneID:233904 MGI:2446244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain containing 1A transcript_id : NM_178029.3

name	Hsd3b7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817044 GeneID:101502 MGI:2141879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 transcript_id : NM_133943.2

name	Hsd3b7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:100817047 GeneID:101502 MGI:2141879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 transcript_id : NM_001040684.1

name	Stx1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032003 GeneID:56216 MGI:1930705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : syntaxin 1B2 transcript_id : NM_024414.2

name	Stx4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892174 GeneID:20909 MGI:893577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin 4A (placental) transcript_id : NM_009294.3

name	Zfp668 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802081 GeneID:244219 MGI:2442943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 668 transcript_id : NM_146259.3

name	Zfp646 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491886 GeneID:233905 MGI:3665412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 646 transcript_id : NM_172749.3

name	BC039632 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486910 GeneID:330657 MGI:2652890
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC039632 transcript_id : NM_001081268.1

name	Vkorc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45827741 GeneID:27973 MGI:106442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vitamin K epoxide reductase complex, subunit 1 transcript_id : NM_178600.2

name	Bckdk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88853585 GeneID:12041 MGI:1276121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : branched chain ketoacid dehydrogenase kinase transcript_id : NM_009739.3

name	Myst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312789 GeneID:67773 MGI:1915023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MYST histone acetyltransferase 1 transcript_id : NM_026370.1

name	Prss8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19111159 GeneID:76560 MGI:1923810
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 8 (prostasin) transcript_id : NM_133351.1

name	Prss36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487022 GeneID:77613 MGI:1924863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protease, serine, 36 transcript_id : NM_001081374.1

name	Fus (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112734868 GeneID:233908 MGI:1353633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fusion, derived from t(12;16) malignant liposarcoma (human) transcript_id : NM_139149.2

name	Pycard (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581581 GeneID:66824 MGI:1931465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PYD and CARD domain containing transcript_id : NM_023258.3

name	Trim72 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370482 GeneID:434246 MGI:3612190
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 72 transcript_id : NM_001079932.2

name	EG668675 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257801 GeneID:668675 MGI:3648098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 68 ESTs, 4 Proteins product : predicted gene, EG668675 transcript_id : XM_001480559.1

name	Itgam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:132626288 GeneID:16409 MGI:96607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha M transcript_id : NM_001082960.1

name	Itgam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:132626294 GeneID:16409 MGI:96607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha M transcript_id : NM_008401.2

name	Itgax (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130485 GeneID:16411 MGI:96609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha X transcript_id : NM_021334.2

name	Itgad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274167 GeneID:381924 MGI:3578624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin, alpha D transcript_id : NM_001029872.1

name	Cox6a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816955 GeneID:12862 MGI:104649
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VI a, polypeptide 2 transcript_id : NM_009943.2

name	LOC100043133 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257717 GeneID:100043133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to crooked legs CG14938-PB transcript_id : XM_001479568.1

name	Armc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48928021 GeneID:233912 MGI:2384586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 5 transcript_id : NM_146205.2

name	Tgfb1i1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254611 GeneID:21804 MGI:102784
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming growth factor beta 1 induced transcript 1 transcript_id : NM_009365.2

name	Slc5a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892427 GeneID:246787 MGI:2181411
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium/glucose cotransporter), member 2 transcript_id : NM_133254.3

name	BC017158 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704183 GeneID:233913 MGI:2384572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC017158 transcript_id : NM_145590.1

name	EG628781 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381054 GeneID:628781 MGI:3644024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 346 ESTs, 4 Proteins product : predicted gene, EG628781, transcript variant 1 transcript_id : XM_902363.2

name	Rgs10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388581 GeneID:67865 MGI:1915115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signalling 10 transcript_id : NM_026418.2

name	LOC100043643 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257803 GeneID:100043643
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043643 transcript_id : XM_001480599.1

name	Tial1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687767 GeneID:21843 MGI:107913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Tia1 cytotoxic granule-associated RNA binding protein-like 1 transcript_id : NM_009383.2

name	Bag3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270959 GeneID:29810 MGI:1352493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl2-associated athanogene 3 transcript_id : NM_013863.4

name	EG639030 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94381055 GeneID:639030 MGI:3644893
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG639030 transcript_id : XM_001003100.1

name	Inpp5f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360458 GeneID:101490 MGI:2141867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate-5-phosphatase F transcript_id : NM_178641.4

name	LOC100043651 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257805 GeneID:100043651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to unknown transcript_id : XM_001480620.1

name	1110007A13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130227 GeneID:210711 MGI:1920977
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110007A13 gene transcript_id : NM_145955.3

name	Sec23ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71725364 GeneID:207352 MGI:2450915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Sec23 interacting protein transcript_id : NM_001029982.1

name	Ppapdc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124377994 GeneID:381925 MGI:2685936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidic acid phosphatase type 2 domain containing 1A transcript_id : NM_001080963.1

name	Zfp764 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981907 CCDS:CCDS21865.1 GeneID:233893 MGI:2443580
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 764 protein_id : NP_666315.2

name	Zfp688 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165358 CCDS:CCDS21866.1 GeneID:69234 MGI:1916484
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 688 protein_id : NP_081275.1

name	Zfp689 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424764 CCDS:CCDS21867.1 GeneID:71131 MGI:1918381
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein HIT-39 protein_id : NP_780372.1

name	Prr14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328357 CCDS:CCDS21868.1 GeneID:233895 MGI:2384565
definition	codon_start : 1 product : proline rich 14 protein_id : NP_663564.2

name	Fbs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257716 GeneID:14123 MGI:104648
definition	codon_start : 1 product : fibrosin 1 isoform 1 protein_id : XP_284344.7

name	1700008J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381045 GeneID:629159 MGI:1916610
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002915.1

name	LOC100043597 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257795 GeneID:100043597
definition	codon_start : 1 product : similar to Snf2-related CBP activator protein protein_id : XP_001480453.1

name	D030022P06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257797 GeneID:546001 MGI:2444036
definition	codon_start : 1 product : Snf2-related CBP activator protein protein_id : XP_001480454.1

name	Phkg2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518544 CCDS:CCDS21869.1 GeneID:68961 MGI:1916211
definition	GO_component : GO:0005964 - phosphorylase kinase complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005978 - glycogen biosynthesis [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphorylase kinase, gamma 2 (testis) protein_id : NP_081164.1

name	Gm166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85986579 CCDS:CCDS21870.1 GeneID:233899 MGI:2685012
definition	codon_start : 1 product : hypothetical protein LOC233899 protein_id : NP_001028212.1

name	Rnf40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986595 CCDS:CCDS21871.1 GeneID:233900 MGI:2142048
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ring finger protein 40 protein_id : NP_758485.1

name	Zfp629 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893273 CCDS:CCDS21873.1 GeneID:320683 MGI:2444524
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 629 protein_id : NP_796200.1

name	Bcl7c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753176 CCDS:CCDS21874.1 GeneID:12055 MGI:1332237
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : B-cell CLL/lymphoma 7C protein_id : NP_033876.1

name	Ctf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681075 CCDS:CCDS21875.1 GeneID:13019 MGI:105115
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0048666 - neuron development [Evidence IGI] codon_start : 1 note : cardiotrophin-1 product : cardiotrophin 1 protein_id : NP_031821.1

name	Ctf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38524598 CCDS:CCDS21876.1 GeneID:244218 MGI:2684607
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005127 - ciliary neurotrophic factor receptor binding [Evidence IPI]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005146 - leukemia inhibitory factor receptor binding [Evidence IPI] GO_process : GO:0007275 - development [Evidence IEA]; GO:0040007 - growth [Evidence IEA]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI] codon_start : 1 note : neuropoietin product : cardiotrophin 2 protein_id : NP_942155.1

name	Fbxl19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254240 CCDS:CCDS21877.1 GeneID:233902 MGI:3039600
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 19 protein_id : NP_766336.2

name	Tmem142c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38259222 CCDS:CCDS21878.1 GeneID:269999 MGI:3039586
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : calcium release-activated calcium channel 3 product : hypothetical protein LOC269999 protein_id : NP_940816.1

name	Setd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119508422 GeneID:233904 MGI:2446244
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 note : non-selective cation channel 1 product : SET domain containing 1A protein_id : NP_821172.2

name	Hsd3b7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817045 GeneID:101502 MGI:2141879
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003854 - 3-beta-hydroxy-delta5-steroid dehydrogenase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004769 - steroid delta-isomerase activity [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 isoform a protein_id : NP_598704.2

name	Hsd3b7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:100817048 GeneID:101502 MGI:2141879
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003854 - 3-beta-hydroxy-delta5-steroid dehydrogenase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004769 - steroid delta-isomerase activity [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 isoform b protein_id : NP_001035774.1

name	Stx1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13259378 GeneID:56216 MGI:1930705
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : syntaxin1B; syntaxin 1 b product : syntaxin 1B2 protein_id : NP_077725.1

name	Stx4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678177 CCDS:CCDS21880.1 GeneID:20909 MGI:893577
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006836 - neurotransmitter transport [Evidence IEA]; GO:0016079 - synaptic vesicle exocytosis [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : syntaxin 4A (placental) protein_id : NP_033320.1

name	Zfp668 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122853 CCDS:CCDS21881.1 GeneID:244219 MGI:2442943
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 668 protein_id : NP_666371.1

name	Zfp646 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46358380 CCDS:CCDS21882.1 GeneID:233905 MGI:3665412
definition	codon_start : 1 product : zinc finger protein 646 protein_id : NP_766337.2

name	BC039632 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486911 GeneID:330657 MGI:2652890
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : hypothetical protein LOC330657 protein_id : NP_001074737.1

name	Vkorc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519915 CCDS:CCDS21883.1 GeneID:27973 MGI:106442
definition	EC_number : 1.1.4.1 GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0047057 - vitamin-K-epoxide reductase (warfarin-sensitive) activity [Evidence ISS] [Evidence IDA] GO_process : GO:0050820 - positive regulation of coagulation [Evidence IMP]; GO:0042371 - vitamin K biosynthesis [Evidence ISS]; GO:0042373 - vitamin K metabolism [Evidence IDA] codon_start : 1 note : vitamin K1 epoxide reductase (warfarin-sensitive); phylloquinone epoxide reductase product : vitamin K epoxide reductase complex, subunit 1 protein_id : NP_848715.1

name	Bckdk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753164 CCDS:CCDS21884.1 GeneID:12041 MGI:1276121
definition	GO_component : GO:0005947 - alpha-ketoglutarate dehydrogenase complex (sensu Eukaryota) [Evidence ISS]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016772 - transferase activity, transferring phosphorus-containing groups [Evidence IEA] GO_process : GO:0009083 - branched chain family amino acid catabolism [Evidence ISS]; GO:0016310 - phosphorylation [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : branched chain keto acid dehydrogenase kinase; BCKD-kinase product : branched chain ketoacid dehydrogenase kinase protein_id : NP_033869.1

name	Myst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312790 CCDS:CCDS21885.1 GeneID:67773 MGI:1915023
definition	GO_component : GO:0000776 - kinetochore [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004402 - histone acetyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : histone acetyltransferase Myst1 product : MYST histone acetyltransferase 1 protein_id : NP_080646.1

name	Prss8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111160 GeneID:76560 MGI:1923810
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : channel activating protease 1 product : prostasin protein_id : NP_579929.1

name	Prss36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487023 GeneID:77613 MGI:1924863
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] [Evidence ISS] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IC] codon_start : 1 note : polyserase-2; polyserase-2 protein product : protease, serine, 36 protein_id : NP_001074843.1

name	Fus (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20982845 CCDS:CCDS21886.1 GeneID:233908 MGI:1353633
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : hnRNP P2; RNA-binding protein FUS; translocated in liposarcoma; pigpen protein product : pigpen protein_id : NP_631888.1

name	Pycard (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560222 CCDS:CCDS21888.1 GeneID:66824 MGI:1931465
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005829 - cytosol [Evidence IDA]; GO:0005576 - extracellular region [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016505 - apoptotic protease activator activity [Evidence ISS]; GO:0030693 - caspase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0032090 - Pyrin domain binding [Evidence ISS] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0043280 - positive regulation of caspase activity [Evidence ISS]; GO:0050718 - positive regulation of interleukin-1 beta secretion [Evidence ISS]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IMP]; GO:0043281 - regulation of caspase activity [Evidence IMP] codon_start : 1 exception : mismatches in translation product : PYD and CARD domain containing protein_id : NP_075747.2

name	Trim72 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247302 GeneID:434246 MGI:3612190
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : mitsugumin 53 product : tripartite motif-containing 72 protein_id : NP_001073401.1

name	EG668675 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257802 GeneID:668675 MGI:3648098
definition	codon_start : 1 product : similar to Armadillo repeat containing, X-linked 3 protein_id : XP_001480609.1

name	Itgam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:132626289 GeneID:16409 MGI:96607
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0001846 - opsonin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IMP]; GO:0045123 - cellular extravasation [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 precursor is encoded by transcript variant 1; CD11B (p170); complement component receptor 3 alpha-a; macrophage antigen alpha; complement receptor type 3; cell surface glycoprotein MAC-1 alpha subunit; leukocyte adhesion receptor MO1; Mac-1 alpha product : integrin alpha M isoform 1 precursor protein_id : NP_001076429.1

name	Itgam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:132626295 CCDS:CCDS21889.1 GeneID:16409 MGI:96607
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0001846 - opsonin binding [Evidence IDA] [Evidence IMP]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IMP]; GO:0045123 - cellular extravasation [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0030593 - neutrophil chemotaxis [Evidence IMP]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 2 precursor is encoded by transcript variant 2; CD11B (p170); complement component receptor 3 alpha-a; macrophage antigen alpha; complement receptor type 3; cell surface glycoprotein MAC-1 alpha subunit; leukocyte adhesion receptor MO1; Mac-1 alpha product : integrin alpha M isoform 2 precursor protein_id : NP_032427.2

name	Itgax (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946646 GeneID:16411 MGI:96609
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : CD11C (p150) alpha polypeptide; complement receptor 4; integrin alpha X (Cd11c); integrin aX product : integrin alpha X protein_id : NP_067309.1

name	Itgad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274168 CCDS:CCDS21890.1 GeneID:381924 MGI:3578624
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0008305 - integrin complex [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0050798 - activated T cell proliferation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : integrin, alpha D protein_id : NP_001025043.1

name	Cox6a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816956 CCDS:CCDS21891.1 GeneID:12862 MGI:104649
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : subunit VIaH (heart-type) product : cytochrome c oxidase, subunit VI a, polypeptide 2 protein_id : NP_034073.2

name	LOC100043133 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257718 GeneID:100043133
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479618.1

name	Armc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48928022 CCDS:CCDS21892.1 GeneID:233912 MGI:2384586
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : armadillo repeat containing 5 protein_id : NP_666317.2

name	Tgfb1i1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678313 CCDS:CCDS21893.1 GeneID:21804 MGI:102784
definition	GO_component : GO:0005925 - focal adhesion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045165 - cell fate commitment [Evidence IGI]; GO:0030855 - epithelial cell differentiation [Evidence IGI]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0045599 - negative regulation of fat cell differentiation [Evidence IGI] codon_start : 1 product : transforming growth factor beta 1 induced transcript 1 protein_id : NP_033391.1

name	Slc5a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875434 CCDS:CCDS21894.1 GeneID:246787 MGI:2181411
definition	GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 note : low affinity sodium-dependent glucose cotransporter product : solute carrier family 5 (sodium/glucose cotransporter), member 2 protein_id : NP_573517.1

name	BC017158 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704184 CCDS:CCDS21895.1 GeneID:233913 MGI:2384572
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC233913 protein_id : NP_663565.1

name	EG628781 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907613 GeneID:628781 MGI:3644024
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_907456.1

name	Rgs10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385914 CCDS:CCDS21896.1 GeneID:67865 MGI:1915115
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0009968 - negative regulation of signal transduction [Evidence IEA] codon_start : 1 product : regulator of G-protein signalling 10 protein_id : NP_080694.1

name	LOC100043643 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257804 GeneID:100043643
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480649.1

name	Tial1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678349 CCDS:CCDS21897.1 GeneID:21843 MGI:107913
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0017091 - AU-specific RNA binding [Evidence IDA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007281 - germ cell development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0017145 - stem cell division [Evidence IMP] codon_start : 1 note : Tial1 cytotoxic granule-associated RNA-binding protein-like 1 product : Tial1 cytotoxic granule-associated RNA binding protein-like 1 protein_id : NP_033409.1

name	Bag3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270960 CCDS:CCDS21898.1 GeneID:29810 MGI:1352493
definition	GO_component : GO:0005829 - cytosol [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043066 - negative regulation of apoptosis [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : Bcl-2-interacting death supressor; Bcl-2-interacting death suppressor product : Bcl2-associated athanogene 3 protein_id : NP_038891.4

name	EG639030 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381056 GeneID:639030 MGI:3644893
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001003100.1

name	Inpp5f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542017 CCDS:CCDS21899.1 GeneID:101490 MGI:2141867
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : inositol polyphosphate-5-phosphatase F protein_id : NP_848756.2

name	LOC100043651 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257806 GeneID:100043651
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480670.1

name	1110007A13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122389 GeneID:210711 MGI:1920977
definition	codon_start : 1 product : hypothetical protein LOC210711 protein_id : NP_666067.1

name	Sec23ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71725365 CCDS:CCDS21900.1 GeneID:207352 MGI:2450915
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Sec23 interacting protein protein_id : NP_001025153.1

name	Ppapdc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124377995 GeneID:381925 MGI:2685936
definition	codon_start : 1 product : phosphatidic acid phosphatase type 2 domain containing 1A protein_id : NP_001074432.1

name	LOC100043144 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043144
definition	number : 2 pseudo : _no_value

name	LOC100043144 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043144
definition	number : 1 pseudo : _no_value

name	1700120K04Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257799 GeneID:68232 MGI:1915482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 9 ESTs product : RIKEN cDNA 1700120K04 gene transcript_id : XR_035459.1

name	LOC436010 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257800 GeneID:436010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 3 Proteins product : similar to Yip1 domain family, member 5 pseudo : _no_value transcript_id : XR_034748.1

name	LOC210714 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257807 GeneID:210714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 16 Proteins product : similar to Rho family GTPase 2 pseudo : _no_value transcript_id : XR_034777.1

clone name	MSMg01-321N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-196I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272D07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-271N09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541B13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-404P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-378B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432N10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336N09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062I08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-341A23.b	B6Ng01-341A23.g
ACC	GA124562	GA124563
length	1,053	451
definition	B6Ng01-341A23.b	B6Ng01-341A23.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccttcttcagaaactcctgtagataaaaagggggagagggagtca tactgtgttcaacactgagacaagatacgtttcctttagaagatgacttg gcgaaagtggacggaggagcctggattagtcagcccttgaaaaaaaactc cacccggaaaaacaaagaacgtgtttaatgttgaagcaagtatttcttac gcatttcaccttaatggttttgacattgcaagacacaataaaaatgaagc gggaatctacttgcatttctgagctgacaataaattaccaaaaagtaaat taaagtggaagatatatcagccccttccagacactgtttaaacaaagtgc attcctccaaagccaggcccccccctttttttttaaacaaaagaaaagaa aacatattaagtcctgtccaaatcatggtgatggagaccattttaagttg gaggtgtgctttcctgggactgctggttgaggagtcagcacatggtcagc tctacagctgcgttcaaacctcactggcatccagacaatgctcacagctc tacttcccaccctggggtctccatgaggaccggcagcaccttgccctatc acttaaaaagccaggttgcagggtcagtatggggttcacgtgtgacccgc catgggcagcaggacttatgctggcaggaaaagccatttcttggtggcat taactcgttcctgtccatcagctctcctttgggcttccccggcttcactc tgtcagttaccatccaacctctctcaccagtgatacgttcaaagagactc tgagaccggaaagaacaaaccttttaccccaaagtcccagatcatccttg ccagcactgaaacccctccctctaaaccccattttgggtaaggcatcccc cccatcacccttatctcctctccactactacagggaaaacagagataagc ctccaatgtcccttagtggggagtccagacgccatgaacagatgaatggt tcttagtctgtagccaggtatagtcagtataaacactggccctggtcccc aca	agcttggggctcttcagtcagcacacttgcatgttctgatgtctcaggtc cccctcttccttttcatcctcatttggcggggcggggcagggtgtgtgtg tgcgcgcgcgcgtgcgtgaagcacaactccacatagggagggagggagag ggtgtctatggtcttttccaagctctttcaaatttacaacctgtttttca ttgttattgcatgcacacatgtatatgcatatacagacgcattgttatat ataacctgactagtctgtatattaatggataaccaattggtgtgctctcc cctcccctgctcagcactccttagttgtaggttctaagccttgtgggctt ctccctagccactttgccatgtttatttagtgttgtctgcgttcagctca tgtctaggcagtcatgttggtgagaatttacagatatagcttctgacatt a
quality values	Open. Hide. 47 29 15 30 58 58 54 54 58 58 58 58 28 22 52 58 58 34 40 58 62 62 62 62 62 62 62 42 50 42 50 38 30 22 30 46 32 32 32 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 44 43 62 62 59 62 62 59 59 59 59 59 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 47 43 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 52 62 62 62 46 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 58 58 58 58 58 58 58 58 58 58 42 39 58 58 58 58 45 42 42 54 58 58 58 54 54 58 58 54 58 58 58 58 39 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 47 58 58 54 58 54 58 54 54 58 58 39 58 58 42 54 58 58 58 58 58 54 54 58 58 58 47 58 47 47 51 58 53 51 50 51 50 54 58 51 51 58 53 58 58 46 35 49 58 58 58 58 54 52 51 58 58 58 50 50 58 49 45 42 52 58 52 51 58 50 58 53 58 53 53 51 49 52 58 58 54 58 32 58 58 46 41 51 41 28 44 51 58 46 58 58 58 51 50 58 53 37 51 39 52 49 51 30 49 28 24 43 46 53 52 50 43 51 39 41 54 58 46 46 50 42 39 44 50 51 35 50 51 58 44 34 52 49 51 51 42 50 53 29 51 49 53 45 50 44 38 13 38 49 47 52 49 41 38 49 39 51 54 54 44 32 51 52 43 53 51 52 45 53 47 33 26 44 44 52 52 49 30 31 26 54 54 44 37 22 39 42 29 54 41 31 53 51 37 38 45 45 31 22 54 37 32 30 54 52 54 54 36 34 38 46 32 52 54 53 52 52 32 51 44 30 51 51 31 42 40 37 44 40 39 53 52 34 47 33 33 33 33 53 28 28 35 26 53 42 40 28 52 53 40 42 42 28 17 49 20 28 47 40 34 52 47 28 52 47 47 32 52 32 46 46 31 32 37 45 31 36 42 36 31 32 33 34 31 31 31 30 30 41 26 18 21 45 30 51 51 36 45 36 33 31 26 21 31 31 34 25 31 37 39 30 34 32 45 46 21 21 46 31 36 42 29 31 24 42 26 30 26 35 15 31 8 41 21 41 31 48 32 31 37 35 25 21 46 41 31 28 30 46 46 17 31 31 46 46 32 26 46 34 31 31 38 46 26 28 23 42 34 35 32 11 6 29 27 19 41 21 37 31 25 26 24 27 28 23 31 46 27 19 39 36 26 31 27 46 24 31 31 31 33 46 27 28 39 31 26 15 33 48 41 42 17 43 16 27 42 19 25 29 14 21 27 37 44 48 44 44 44 25 29 9 8 19 25 28 18 30 10 30 32 27 37 23 17 21 24 31 37 15 10 23 34 26 8 27 31 32 19 26 34 18 18 37 39 22 14 6 19 31 17 34 20 13 37 9 22 8 17 6 34 13 14 22 19 31 32 48 24 32 34 11 10 10 14 36 36 9 21 14 19 11 7 7 4 16 6 9 4 10 17 27 21 12 21 11 6 22 20 24 13 13 16 13 13 21 9 17 24 27 21 17 11 17 7 3 3 3 7 8 11 14 11 18 14 5 16 5 7 5 21 24 24 7 3 3 18 11 38 15 5 6 9 7 9 8 14 34 24 7 19 10 9 14 22 10 14 10 7 5	Open. Hide. 38 47 14 26 14 19 8 11 10 8 15 11 38 49 59 47 59 62 59 59 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 51 62 59 43 41 34 28 25 28 40 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 59 51 59 59 50 56 50 59 51 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 62 62 59 51 51 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 51 59 59 59 59 51 49 43 59 51 62 11 13 9 10 10 13 49 59 56 62 62 62 62 62 59 62 56 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 56 56 62 56 51 59 59 59 59 62 62 59 62 62 62 62 59 62 59 59 62 59 59 56 56 56 51 30 39 56 51 56 56 56 56 47 47 47 62 62 51 35 38 23 44 32 39 38 24 35 42 35 51 39 31 32 62 39 56 56 43 30 31 27 28 30 31 39 39 39 37 43 56 56 56 62 62 62 56 51 42 51 26 32 42 29 30 32 24 8 33 33 37 15 20 38 23 34 56 42 56 56 56 50 33 56 39 47 43 33 46 47 56 42 47 47 41 28 33 31 27 35 27 31 25 24 35 35 43 52 31 35 33 35 33 46 34 19 34 29 33 20 12 18 19 18 13 28 18 18 22 17 14 21 52 37 25 33 20 39 17 7 13 9 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr7_135546750_135547798
seq2: B6Ng01-341A23.b_46_1098

seq1  GAATTCCTTCTTCAGAAACTCCTGTAGATAAAAAGGGGGAGAGGGAGTCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTCTTCAGAAACTCCTGTAGATAAAAAGGGGGAGAGGGAGTCA  50

seq1  TACTGTGTTCAACACTGAGACAAGATACGTTTCCTTTAGAAGATGACTTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGTGTTCAACACTGAGACAAGATACGTTTCCTTTAGAAGATGACTTG  100

seq1  GCGAAAGTGGACGGAGGAGCCTGGATTAGTCAGCCCTTGAAAAAAAACTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGAAAGTGGACGGAGGAGCCTGGATTAGTCAGCCCTTGAAAAAAAACTC  150

seq1  CACCCGGAAAAACAAAGAACGTGTTTAATGTTGAAGCAAGTATTTCTTAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCGGAAAAACAAAGAACGTGTTTAATGTTGAAGCAAGTATTTCTTAC  200

seq1  GCATTTCACCTTAATGGTTTTGACATTGCAAGACACAATAAAAATGAAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATTTCACCTTAATGGTTTTGACATTGCAAGACACAATAAAAATGAAGC  250

seq1  GGGAATCTACTTGCATTTCTGAGCTGACAATAAATTACCAAAAAGTAAAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAATCTACTTGCATTTCTGAGCTGACAATAAATTACCAAAAAGTAAAT  300

seq1  TAAAGTGGAAGATATATCAGCCCCTTCCAGACACTGTTTAAACAAAGTGC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAGTGGAAGATATATCAGCCCCTTCCAGACACTGTTTAAACAAAGTGC  350

seq1  ATTCCTCCAAAGCCAGGCCCCCCCCTTTTTTTTTAAACAAAAGAAAAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCTCCAAAGCCAGGCCCCCCCCTTTTTTTTTAAACAAAAGAAAAGAA  400

seq1  AACATATTAAGTCCTGTCCAAATCATGGTGATGGAGACCATTTTAAGTTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATATTAAGTCCTGTCCAAATCATGGTGATGGAGACCATTTTAAGTTG  450

seq1  GAGGTGTGCTTTCCTGGGACTGCTGGTTGAGGAGTCAGCACATGGTCAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTGTGCTTTCCTGGGACTGCTGGTTGAGGAGTCAGCACATGGTCAGC  500

seq1  TCTACAGCTGCGTTCAAACCTCACTGGCATCCAGACAATGCTCACAGCTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTACAGCTGCGTTCAAACCTCACTGGCATCCAGACAATGCTCACAGCTC  550

seq1  TACTTCCCACCCTGGGGTCTCCATGAGGACCGGCAGCACCTTGCCCTATC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTCCCACCCTGGGGTCTCCATGAGGACCGGCAGCACCTTGCCCTATC  600

seq1  ACTTAAAAAGCCAGGTTGCAGGGTCAGTATGGGGTTCACGTGTGACCCGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAAAAAGCCAGGTTGCAGGGTCAGTATGGGGTTCACGTGTGACCCGC  650

seq1  CATGGGCAGCAGGACTTATGCTGGCAGGAAAAGCCATTTCTTGGTGGCAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGGCAGCAGGACTTATGCTGGCAGGAAAAGCCATTTCTTGGTGGCAT  700

seq1  TAACTCGTTCCTGTCCATCAGCTCTCCTTTGGGCTTCCCCGGCTTCACTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTCGTTCCTGTCCATCAGCTCTCCTTTGGGCTTCCCCGGCTTCACTC  750

seq1  TGTCAGTTACCATCCAACCTCTCTCACCAGTGATACGTTCAAAGAGACTC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAGTTACCATCCAACCTCTCTCACCAGTGATACGTTCAAAGAGACTC  800

seq1  TGAGACCGGAAAGAACAAACC-TTTACCCCAAAGTCCCAGATCATCCTTG  849
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  TGAGACCGGAAAGAACAAACCTTTTACCCCAAAGTCCCAGATCATCCTTG  850

seq1  CCAGCACTGAAACCCCTCCCTCTAAACCCCATTTT-GGTAAGGCATCCCC  898
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  CCAGCACTGAAACCCCTCCCTCTAAACCCCATTTTGGGTAAGGCATCCCC  900

seq1  CCCATCACCCTTATCTCCTCTCCACTAACTACAGGGAAAACAGAGATAAG  948
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CCCATCACCCTTATCTCCTCTCCACT-ACTACAGGGAAAACAGAGATAAG  949

seq1  -CTCC-ATGTCCCTTAGT-GGGAGTCCAAGACGGCCATG-ACAGATGAAT  994
       |||| |||||||||||| |||||||| |||| |||||| ||||||||||
seq2  CCTCCAATGTCCCTTAGTGGGGAGTCC-AGAC-GCCATGAACAGATGAAT  997

seq1  GGTTCTTAGTCTGTAGCCAGG-ATAGTCAGTATTAAACACT-GCCCTGGT  1042
      ||||||||||||||||||||| |||||||||| |||||||| ||||||||
seq2  GGTTCTTAGTCTGTAGCCAGGTATAGTCAGTA-TAAACACTGGCCCTGGT  1046

seq1  CCCCACA  1049
      |||||||
seq2  CCCCACA  1053

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information