MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-137M21
Chromosome	7 (Build37)
Map Location	18,524,974 - 18,525,374
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG434128, 0710005I19Rik, LOC100042835, LOC434130, Ppp5c, Hif3a, Psg16, LOC100042844, LOC640145, Ceacam3, Psg29, LOC414361, LOC671132, LOC100042868, Psg-ps1, LOC666767, Psg30, Ppia-ps7_184.1, Ceacam14, EG381852
Downstream gene	Ceacam11, Ceacam13, LOC384560, Ceacam12, Igfl3, LOC671190, Mill1, Psg18, LOC546936, Psg28, LOC666831, EG574429, EG232930, Psg25, EG545925, Psg23, Psg21, EG434540, BC050099, LOC666863, Sycp1-ps1, Psg19, Psg17, Mill2, Pglyrp1, C530028I08Rik, Nova2
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG434128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434128 MGI:3645856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 1 Protein

name	0710005I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71691 MGI:1918941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042835 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 7 Proteins

name	LOC434130 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	Ppp5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19060 MGI:102666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hif3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53417 MGI:1859778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26436 MGI:1347249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042844 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042844
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC640145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 398 ESTs, 5 Proteins pseudo : _no_value

name	Ceacam3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384557 MGI:3646296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	Psg29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114872 MGI:1891361
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC414361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:414361
definition	note : vitamin K epoxide reductase complex, subunit 1-like 1 pseudogene 2 pseudo : _no_value

name	LOC671132 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins pseudo : _no_value

name	LOC100042868 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Psg-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232919 MGI:1347253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC666767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 10 Proteins pseudo : _no_value

name	Psg30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73250 MGI:1920500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps7_184.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606534
definition	note : peptidylprolyl isomerase A pseudogene 7_184.1 pseudo : _no_value

name	Ceacam14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67084 MGI:1914334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG381852 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381852 MGI:3647191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66996 MGI:1914246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69785 MGI:1917035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC384560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ceacam12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67315 MGI:1914565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232925 MGI:2685426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	Mill1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266815 MGI:2179988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26438 MGI:1347251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins pseudo : _no_value

name	Psg28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114871 MGI:1891360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666831 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG574429 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574429 MGI:3643750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG232930 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232930 MGI:3648786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins

name	Psg25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114868 MGI:1891357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545925 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545925 MGI:3649013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56868 MGI:1891355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72242 MGI:1891353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434540 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434540 MGI:3648784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	BC050099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243862 MGI:2681855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Sycp1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20958 MGI:1098279
definition	gene_synonym : Sycp1-rs note : synaptonemal complex protein 1, pseudogene 1 pseudo : _no_value

name	Psg19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26439 MGI:1347252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26437 MGI:1347250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mill2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pglyrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21946 MGI:1345092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530028I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232933 MGI:2685005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nova2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384569 MGI:104296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379492 GeneID:434128 MGI:3645856
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 1 Protein product : predicted gene, EG434128 transcript_id : XM_485870.4

name	0710005I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119167 GeneID:71691 MGI:1918941
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0710005I19 gene transcript_id : NM_001007569.1

name	LOC100042835 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256288 GeneID:100042835
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 7 Proteins product : similar to Paraneoplastic antigen MA2 transcript_id : XM_001478913.1

name	LOC434130 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256530 GeneID:434130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : hypothetical LOC434130, transcript variant 2 transcript_id : XM_001480113.1

name	LOC434130 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256528 GeneID:434130
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : hypothetical LOC434130, transcript variant 1 transcript_id : XM_001480107.1

name	Ppp5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859593 GeneID:19060 MGI:102666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 5, catalytic subunit transcript_id : NM_011155.1

name	Hif3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393527 GeneID:53417 MGI:1859778
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypoxia inducible factor 3, alpha subunit transcript_id : NM_016868.1

name	Psg16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849784 GeneID:26436 MGI:1347249
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 16 transcript_id : NM_007676.3

name	Ceacam3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256541 GeneID:384557 MGI:3646296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : carcinoembryonic antigen-related cell adhesion molecule 3 transcript_id : XM_357710.6

name	Psg29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356091 GeneID:114872 MGI:1891361
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 29 transcript_id : NM_054064.2

name	LOC100042868 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256298 GeneID:100042868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to pol protein transcript_id : XM_001478955.1

name	Psg30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384595 GeneID:73250 MGI:1920500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 30 transcript_id : NM_028480.2

name	Ceacam14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366076 GeneID:67084 MGI:1914334
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 14 transcript_id : NM_025957.3

name	EG381852 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347954 GeneID:381852 MGI:3647191
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG381852 transcript_id : NM_001034877.2

name	Ceacam11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821666 GeneID:66996 MGI:1914246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 11 transcript_id : NM_023289.2

name	Ceacam13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348500 GeneID:69785 MGI:1917035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 13 transcript_id : NM_028171.2

name	Ceacam13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352676 GeneID:69785 MGI:1917035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 13 transcript_id : NM_027210.2

name	Ceacam12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385587 GeneID:67315 MGI:1914565
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 12 transcript_id : NM_026087.1

name	Igfl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50979275 GeneID:232925 MGI:2685426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IGF-like family member 3 transcript_id : NM_001003393.1

name	Mill1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360553 GeneID:266815 MGI:2179988
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 1 transcript_id : NM_153749.3

name	Psg18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755189 GeneID:26438 MGI:1347251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 18 transcript_id : NM_011963.1

name	Psg28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778834 GeneID:114871 MGI:1891360
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 28 transcript_id : NM_054063.3

name	EG574429 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274189 GeneID:574429 MGI:3643750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574429 transcript_id : NM_001029893.1

name	EG232930 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256317 GeneID:232930 MGI:3648786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : predicted gene, EG232930 transcript_id : XM_894409.3

name	Psg25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75832036 GeneID:114868 MGI:1891357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 25 transcript_id : NM_054060.1

name	EG545925 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81230477 GeneID:545925 MGI:3649013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545925 transcript_id : NM_001037168.1

name	Psg23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350159 GeneID:56868 MGI:1891355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 23 transcript_id : NM_020261.3

name	Psg21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365864 GeneID:72242 MGI:1891353
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 21 transcript_id : NM_027403.3

name	EG434540 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256554 GeneID:434540 MGI:3648784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG434540 transcript_id : XM_486384.3

name	BC050099 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138531 GeneID:243862 MGI:2681855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050099 transcript_id : NM_001004152.1

name	Psg19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755191 GeneID:26439 MGI:1347252
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 19 transcript_id : NM_011964.1

name	Psg17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796627 GeneID:26437 MGI:1347250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 17 transcript_id : NM_007677.2

name	Mill2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52693918 GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 2 transcript_id : NM_153761.2

name	Mill2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24415385 GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 2 transcript_id : NM_153760.1

name	Pglyrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130401 GeneID:21946 MGI:1345092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 1 transcript_id : NM_009402.2

name	C530028I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363777 GeneID:232933 MGI:2685005
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530028I08 gene transcript_id : NM_001033314.2

name	Nova2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274145 GeneID:384569 MGI:104296
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuro-oncological ventral antigen 2 transcript_id : NM_001029877.1

name	EG434128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379493 GeneID:434128 MGI:3645856
definition	codon_start : 1 product : hypothetical protein protein_id : XP_485870.4

name	0710005I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119168 CCDS:CCDS20858.1 GeneID:71691 MGI:1918941
definition	codon_start : 1 product : hypothetical protein LOC71691 protein_id : NP_001007570.1

name	LOC100042835 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256289 GeneID:100042835
definition	codon_start : 1 product : similar to Paraneoplastic antigen MA2 protein_id : XP_001478963.1

name	LOC434130 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256531 GeneID:434130
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001480163.1

name	LOC434130 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256529 GeneID:434130
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001480157.1

name	Ppp5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859594 CCDS:CCDS20859.1 GeneID:19060 MGI:102666
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ANP receptor product : protein phosphatase 5, catalytic subunit protein_id : NP_035285.1

name	Hif3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393528 CCDS:CCDS20860.1 GeneID:53417 MGI:1859778
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IC] GO_function : GO:0003677 - DNA binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0001666 - response to hypoxia [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IPI] codon_start : 1 exception : mismatches in translation note : hypoxia inducible factor three alpha; inhibitory PAS domain protein product : hypoxia inducible factor 3, alpha subunit protein_id : NP_058564.1

name	Psg16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46810280 CCDS:CCDS20861.1 GeneID:26436 MGI:1347249
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 note : carcinoembryonic antigen 11 product : pregnancy specific glycoprotein 16 protein_id : NP_031702.2

name	Ceacam3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256542 GeneID:384557 MGI:3646296
definition	codon_start : 1 product : similar to Carcinoembryonic antigen-related cell adhesion molecule 3 protein_id : XP_357710.5

name	Psg29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74959908 CCDS:CCDS20862.1 GeneID:114872 MGI:1891361
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 29 protein_id : NP_473405.1

name	LOC100042868 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256299 GeneID:100042868
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001479005.1

name	Psg30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625985 CCDS:CCDS20863.1 GeneID:73250 MGI:1920500
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 30 protein_id : NP_082756.1

name	Ceacam14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385448 CCDS:CCDS20864.1 GeneID:67084 MGI:1914334
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CEA-related cell adhesion molecule 14 protein_id : NP_080233.1

name	EG381852 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702219 GeneID:381852 MGI:3647191
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC381852 protein_id : NP_001030049.1

name	Ceacam11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821667 CCDS:CCDS20865.1 GeneID:66996 MGI:1914246
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Ceacam11-C1; Ceacam11-C3; Ceacam11-C4; carcinoembryonic antigen related protein product : CEA-related cell adhesion molecule 11 protein_id : NP_075778.2

name	Ceacam13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312412 GeneID:69785 MGI:1917035
definition	codon_start : 1 note : Ceacam13-C1; Ceacam13-C2 product : CEA-related cell adhesion molecule 13 protein_id : NP_081486.1

name	Ceacam13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312340 CCDS:CCDS20866.1 GeneID:69785 MGI:1917035
definition	codon_start : 1 note : Ceacam13-C1; Ceacam13-C2 product : CEA-related cell adhesion molecule 13 protein_id : NP_082447.1

name	Ceacam12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385588 CCDS:CCDS20867.1 GeneID:67315 MGI:1914565
definition	GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Ceacam12-C1; Ceacam12-C3 product : CEA-related cell adhesion molecule 12 protein_id : NP_080363.1

name	Igfl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50979276 GeneID:232925 MGI:2685426
definition	codon_start : 1 note : insulin growth factor-like product : gene model 580 protein_id : NP_001003393.1

name	Mill1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559897 CCDS:CCDS20868.1 GeneID:266815 MGI:2179988
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MHC I-like leukocyte 1; MHC class I-like located near the LRC, 1 product : MHC I like leukocyte 1 protein_id : NP_715630.2

name	Psg18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755190 CCDS:CCDS20869.1 GeneID:26438 MGI:1347251
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009691 - cytokinin biosynthesis [Evidence TAS]; GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 3 product : pregnancy specific glycoprotein 18 protein_id : NP_036093.1

name	Psg28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778835 CCDS:CCDS20870.1 GeneID:114871 MGI:1891360
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pregnancy-specific glycoprotein 28 protein_id : NP_473404.2

name	EG574429 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274190 CCDS:CCDS20871.1 GeneID:574429 MGI:3643750
definition	codon_start : 1 product : hypothetical protein LOC574429 protein_id : NP_001025064.1

name	EG232930 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256318 GeneID:232930 MGI:3648786
definition	codon_start : 1 product : similar to myotubularin related protein 2 protein_id : XP_899502.3

name	Psg25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832037 CCDS:CCDS20872.1 GeneID:114868 MGI:1891357
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 25 protein_id : NP_473401.1

name	EG545925 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230478 CCDS:CCDS20873.1 GeneID:545925 MGI:3649013
definition	codon_start : 1 product : hypothetical protein LOC545925 protein_id : NP_001032245.1

name	Psg23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19549329 CCDS:CCDS20874.1 GeneID:56868 MGI:1891355
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 23 protein_id : NP_064657.2

name	Psg21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22758148 CCDS:CCDS20875.1 GeneID:72242 MGI:1891353
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 note : pregnancy-specific glrcoprotein 21 product : pregnancy-specific glycoprotein 21 protein_id : NP_081679.2

name	EG434540 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256555 GeneID:434540 MGI:3648784
definition	codon_start : 1 product : similar to pregnancy-specific glycoprotein 21 protein_id : XP_486384.3

name	BC050099 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138532 CCDS:CCDS20876.1 GeneID:243862 MGI:2681855
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243862 protein_id : NP_001004152.1

name	Psg19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755192 CCDS:CCDS20877.1 GeneID:26439 MGI:1347252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 4 product : pregnancy specific glycoprotein 19 protein_id : NP_036094.1

name	Psg17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679495 CCDS:CCDS20878.1 GeneID:26437 MGI:1347250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006955 - immune response [Evidence IDA]; GO:0007565 - pregnancy [Evidence TAS] codon_start : 1 note : carcinoembryonic antigen 2 product : pregnancy specific glycoprotein 17 protein_id : NP_031703.1

name	Mill2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693919 CCDS:CCDS20880.1 GeneID:243864 MGI:2179989
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 note : long form is encoded by transcript variant 1; MHC I-like leukocyte 2; MHC class I-like located near the LRC, 2 product : MHC I like leukocyte 2 long form protein_id : NP_715642.2

name	Mill2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24415386 CCDS:CCDS20879.1 GeneID:243864 MGI:2179989
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 note : short form is encoded by transcript variant 2; MHC I-like leukocyte 2; MHC class I-like located near the LRC, 2 product : MHC I like leukocyte 2 short form protein_id : NP_715641.1

name	Pglyrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679293 CCDS:CCDS20881.1 GeneID:21946 MGI:1345092
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0016019 - peptidoglycan receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0009253 - peptidoglycan catabolism [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : tumor necrosis factor super family 3-like product : peptidoglycan recognition protein 1 protein_id : NP_033428.1

name	C530028I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677484 GeneID:232933 MGI:2685005
definition	codon_start : 1 product : hypothetical protein LOC232933 protein_id : NP_001028486.1

name	Nova2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274146 CCDS:CCDS20882.1 GeneID:384569 MGI:104296
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IDA] codon_start : 1 product : neuro-oncological ventral antigen 2 protein_id : NP_001025048.1

name	LOC100042844 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042844
definition	number : 1 pseudo : _no_value

name	LOC384560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384560
definition	number : 1 pseudo : _no_value

name	LOC384560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384560
definition	number : 2 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 4 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 3 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 2 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 1 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 1 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 2 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 3 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 4 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 5 pseudo : _no_value

name	LOC640145 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256539 GeneID:640145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 398 ESTs, 5 Proteins product : similar to ribosomal protein L15 pseudo : _no_value transcript_id : XR_034552.1

name	LOC671132 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256297 GeneID:671132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins product : hypothetical LOC671132 pseudo : _no_value transcript_id : XR_033994.1

name	Psg-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872155 GeneID:232919 MGI:1347253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein pseudogene 1 pseudo : _no_value transcript_id : NR_002857.1

name	LOC666767 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256302 GeneID:666767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 10 Proteins product : similar to 2410004N11Rik protein pseudo : _no_value transcript_id : XR_034001.1

name	LOC671190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256303 GeneID:671190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to eukaryotic translation elongation factor 1 alpha 1 pseudo : _no_value transcript_id : XR_034015.1

name	LOC546936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256304 GeneID:546936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to myotubularin related protein 2 pseudo : _no_value transcript_id : XR_034021.1

clone name	MSMg01-499L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-108K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-049G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-118N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377L01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277F15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-510L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-137M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-492F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-168C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-065K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-086P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-177O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291B02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-173G06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-479B22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-150B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472C18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-397J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-087E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-492B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-137M21.T7 (MSMg01no137_m21.b1)	MSMg01-137M21.TJ (MSMg01no137_m21.g1)
ACC	AG343636	AG343637
length	724	719
length of high quality (start - end)	654 (71 - 724)	646 (74 - 719)
definition	CHROMAT_FILE: MSMg01no137_m21.b1 PHD_FILE: MSMg01no137_m21.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:54:38 2005	CHROMAT_FILE: MSMg01no137_m21.g1 PHD_FILE: MSMg01no137_m21.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 18:54:38 2005
singlet/doublet	singlet	---
BLAST hit	plural	no hit data
sequence	AATCATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGGCGC GGAATTCAGCCAAGTTGCACCATAACATGGGCCAATTTTTTCAGGTGTTT GATGGAGACTAACATGAACCACAGGGCTGCAAAGGCAAAGGATGAAACTC AGGGGATAAGTCTCAGAATGATCTAGGGAAATGAAGGGTAAAGGCTATAT GCAAGCTTATATCAGAACCATTGTTTTTTTTTTTTGTCATTGTTCTATAA TGATTTTCTCAAACAGGTCAATACCATGAGATATATTTTCTGGAATGCAG ATGACTAGCTTTTTTCTTTAACTTTTTTTTGTGTTCAGTAATTTTGACTA TATGTTTATTTCTATACTGCATACATACCTGGTGTCCACAAAACTCAGTC CACACTAGATCCCATAGAACTGGATTGACAAATGTTTATGAGCTGCCATG GGAGTGCTAGAAATTGAACTGGATCTTCTACAAGAGCATCCTGTGATATT ATACATGAAGACATATCTGCAGCACTCCTGGGTGGATGCTTTCAGAGGCA GATCTAATTGGTAGAAGGTAGAGAACAAGAAATTGATGGAACTATGCCTG GAAGAGATGAGTGTAGTCATTAGATCTAGGCTAGTGGTTTCAGATCATAC CTGTATGACAGCATTGTTTCTAATATCCAATATCTGAAGCCAATACTTGT AAGAATTATTTCTCTAAAGAGAAC	NCCGATGATAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXTCACCTGAGGAATACCGAATGGCAGAG AAGCACCTGAAAAAATGTTCAACATCCTTAATCATCAGGGAAATGCAAAT CAAAACAACCCTAAGATTCCACCTCACACCAGTCAGAATGTCTAAGATCA AAAATTCAGGTGACAGCAGATGCTGGCGAGGATGTGGAGAAAGAGGAACA CTCCTCCATTGTTGGTGGGATTGCAGGCTTGTACAACCACTCTGGAAATC CGTCTGGCGGTTCCTCAGAAAATTGGACATAGTACTACCGGAGGATCCAG CAATACCTCTCCTGGGCATATATCCAGAAGATGCCCCAACTGGTAAGAAG GACACATGCTCCACTATGTTCATAGCAGCATTATTTATAATAGCCAGAAG CTGGAAAGAACCCAGATGCCCCTCAACAGAGGAATGGATACAGAAAATGT GGTACATCTACACAATGGAGTACTACTCAGCTATTAAAAAGAATGAATTT ATGAAATTCCTAGCCAAATGGATGGACCTGGAGGGCATCATCCTGAGTGA GGTAACACATTCACAAAGGAACTCACACAATATGTATTCACTGATAAGTG GATATTAGCCCAAAACCTAGGATACCCAAGATATAAGATACAATTTCCTA AACACATGAAACTCAAGAA
quality values	Open. Hide. 6 6 6 8 8 6 6 8 8 13 30 25 20 18 18 17 17 28 32 33 33 33 33 33 33 37 37 22 22 14 14 10 13 8 6 6 6 7 11 9 9 9 13 10 9 9 9 9 10 21 28 33 33 33 33 31 31 28 28 22 21 10 9 9 9 7 7 7 8 8 19 22 33 33 33 33 33 33 36 48 36 36 38 38 38 42 57 57 57 42 37 37 37 37 37 47 53 47 47 47 47 47 47 50 50 50 68 68 68 68 51 51 50 50 50 50 68 53 53 50 42 41 41 41 41 43 44 48 48 68 68 68 68 68 68 68 68 68 68 50 48 46 46 46 46 57 68 50 50 50 50 50 50 51 68 68 68 57 68 68 68 50 50 50 50 50 50 50 50 50 50 50 50 51 68 68 68 68 51 48 46 46 46 48 57 68 51 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 52 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 52 52 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 62 62 62 62 62 62 62 52 62 62 62 62 62 62 59 52 52 52 59 59 59 59 57 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 68 59 59 57 57 59 57 57 57 57 57 57 57 57 52 57 57 52 57 52 57 57 59 59 59 57 52 43 43 52 52 52 59 59 43 43 52 52 52 52 59 57 57 52 42 42 50 50 52 52 52 52 43 43 50 57 50 50 50 50 48 48 50 57 57 57 57 57 57 57 54 54 47 57 57 57 57 57 57 57 57 54 54 54 42 42 41 41 42 42 43 46 46 46 42 57 39 39 37 39 39 43 43 42 44 41 41 41 44 40 48 48 48 48 48 37 42 30 32 33 39 43 33 32 24 28 28 31 33 28 28 37 37 42 33 33 33 33 37 34 34 28 25 25 34 34 39 32 31 31 25 25 37 37 35 31 25 30 30 39 39 36 36 36 39 47 47 47 43 37 31 31 32 24 25 27 28 33 37 37 24 17 13 13 13 16 21 22 27 32 37 37 37 37 37 30 28 28 33 33 33 34 32 28 22 18 18 18	Open. Hide. 0 3 6 6 9 13 8 8 6 6 8 8 17 17 24 28 33 33 33 36 37 37 28 28 28 33 33 33 34 23 19 9 9 9 9 9 9 9 9 10 8 8 8 8 8 21 21 22 10 12 12 26 21 33 33 25 21 8 8 6 6 6 6 11 11 11 17 15 27 30 33 33 33 33 33 36 36 36 57 57 57 57 50 50 50 50 40 47 57 53 50 50 50 50 48 54 54 54 54 57 57 57 57 68 68 68 68 68 68 68 57 57 48 43 50 50 46 41 41 41 41 41 41 48 48 50 68 68 68 68 68 68 68 68 50 50 57 57 68 68 50 50 50 50 50 50 50 50 50 50 50 50 57 57 57 57 68 57 57 59 59 59 59 52 52 50 50 50 50 51 50 50 50 68 68 68 68 68 68 68 57 57 57 57 57 50 50 50 50 57 57 57 57 59 57 52 52 57 57 57 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 57 59 57 57 57 57 57 57 57 57 57 68 68 68 57 57 57 57 57 57 57 57 57 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 68 68 68 68 68 68 68 68 68 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 62 62 62 62 62 62 62 62 62 68 62 44 41 27 14 14 27 27 31 34 43 43 52 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 62 62 68 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 57 57 59 57 59 57 57 57 57 57 57 57 57 57 57 57 43 39 39 57 59 59 59 59 59 59 57 52 52 57 57 57 57 57 57 57 57 57 52 52 57 57 57 52 59 59 59 57 57 57 57 54 57 57 52 52 52 52 52 57 57 57 57 54 54 54 57 57 57 57 57 57 57 57 59 59 57 57 57 57 57 48 48 57 57 57 57 57 57 57 57 57 57 57 57 57 48 48 48 59 59 59 59 68 59 59 59 59 59 59 57 57 57 57 43 47 47 48 48 54 57 59 57 54 54 54 54 54 50 50 50 50 57 57 57 57 57 59 59 59 59 59 59 59 59 59 48 48 48 48 48 48 48 43 43 40 39 43 43 43 48 43 39 39 30 30 35 39 39 41 59 41 37 37 41 41 39 37 36 30 30 30 30 30 37 37 43 40 40 34 34 30 30 30 37 37 41 41 41 34 34 23 20 22 32 37 39 37 34 28 28 28 34 36 39 37 37 32 29 22 24 21 15 19 24 28 37 37 37 28 30 30 32 32 39 37 37 37 30 30 30 34 34 33 24 29 29 27 30 32 33 33 33 29 37 28 19 18 21 21 24 27 23 23 25 32 28 23 28 34 34 30

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no137_m21.b1 MSMg01no137_m21.b1 CHROMAT_FILE:
MSMg01no137_m21.b1 PHD_FILE: MSMg01no137_m21.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 18:54:38 2005
         (654 letters)



>mm_chr7_18524321_18525374
          Length = 1054

 Score =  739 bits (382), Expect = 0.0
 Identities = 397/402 (98%), Gaps = 2/402 (0%)
 Strand = Plus / Minus

                                                                        
Query: 254  tttttttgtgttcagtaattttgactatatgtttatttctat-actgcatacatacctgg 312
            |||||||||||||||||||||||||||||||||||| ||||| || ||||||||||||||
Sbjct: 1054 tttttttgtgttcagtaattttgactatatgtttatctctataac-gcatacatacctgg 996

                                                                        
Query: 313  tgtccacaaaactcagtccacactagatcccatagaactggattgacaaatgtttatgag 372
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 995  tgtccacaaaactcagtccacactagatcccatagaactggattgacaaatgtttatgag 936

                                                                        
Query: 373  ctgccatgggagtgctagaaattgaactggatcttctacaagagcatcctgtgatattat 432
            || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 935  ctaccatgggagtgctagaaattgaactggatcttctacaagagcatcctgtgatattat 876

                                                                        
Query: 433  acatgaagacatatctgcagcactcctgggtggatgctttcagaggcagatctaattggt 492
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 875  acatgaagacatatctgcagcactcctgggtggatgctttcagaggcagatctaattggt 816

                                                                        
Query: 493  agaaggtagagaacaagaaattgatggaactatgcctggaagagatgagtgtagtcatta 552
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 815  agaaggtagagaacaagaaattgatggaactatgcctggaagagatgagtgtagtcatta 756

                                                                        
Query: 553  gatctaggctagtggtttcagatcatacctgtatgacagcattgtttctaatatccaata 612
            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 755  gatctaggctagtggtttcagatgatacctgtatgacagcattgtttctaatatccaata 696

                                                      
Query: 613  tctgaagccaatacttgtaagaattatttctctaaagagaac 654
            ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 695  tctgaagccaatacttgtaagaattatttctctaaagagaac 654


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 20
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 654
Length of database: 1054
Length adjustment: 10
Effective length of query: 644
Effective length of database: 1044
Effective search space:   672336
Effective search space used:   672336
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information