MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-144J18
Chromosome	7 (Build37)
Map Location	18,933,761 - 18,934,009
singlet/doublet	singlet
Overlap gene	Psg18
Upstream gene	LOC414361, LOC671132, LOC100042868, Psg-ps1, LOC666767, Psg30, Ppia-ps7_184.1, Ceacam14, EG381852, Ceacam11, Ceacam13, LOC384560, Ceacam12, Igfl3, LOC671190, Mill1
Downstream gene	LOC546936, Psg28, LOC666831, EG574429, EG232930, Psg25, EG545925, Psg23, Psg21, EG434540, BC050099, LOC666863, Sycp1-ps1, Psg19, Psg17, Mill2, Pglyrp1, C530028I08Rik, Nova2, Nanos2, P42pop, Irf2bp1, Foxa3, Sympk, Rshl1, Dmwd, Dmpk, Six5, EG243866, Fbxo46, Qpctl, Snrpd2, Gipr, Eml2, Gpr4, Opa3, Vasp, C79127, Rtn2, Fosb, D830036C21Rik, Ercc1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC414361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:414361
definition	note : vitamin K epoxide reductase complex, subunit 1-like 1 pseudogene 2 pseudo : _no_value

name	LOC671132 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins pseudo : _no_value

name	LOC100042868 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Psg-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232919 MGI:1347253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC666767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 10 Proteins pseudo : _no_value

name	Psg30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73250 MGI:1920500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppia-ps7_184.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606534
definition	note : peptidylprolyl isomerase A pseudogene 7_184.1 pseudo : _no_value

name	Ceacam14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67084 MGI:1914334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG381852 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381852 MGI:3647191
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66996 MGI:1914246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ceacam13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69785 MGI:1917035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC384560 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384560
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ceacam12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67315 MGI:1914565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igfl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232925 MGI:2685426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins pseudo : _no_value

name	Mill1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:266815 MGI:2179988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26438 MGI:1347251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins pseudo : _no_value

name	Psg28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114871 MGI:1891360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666831 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666831
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG574429 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574429 MGI:3643750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG232930 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232930 MGI:3648786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins

name	Psg25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114868 MGI:1891357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG545925 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545925 MGI:3649013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56868 MGI:1891355
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72242 MGI:1891353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434540 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434540 MGI:3648784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	BC050099 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243862 MGI:2681855
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Sycp1-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20958 MGI:1098279
definition	gene_synonym : Sycp1-rs note : synaptonemal complex protein 1, pseudogene 1 pseudo : _no_value

name	Psg19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26439 MGI:1347252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psg17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26437 MGI:1347250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mill2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pglyrp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21946 MGI:1345092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C530028I08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232933 MGI:2685005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nova2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384569 MGI:104296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nanos2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378430 MGI:2676627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P42pop (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232934 MGI:2446472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf2bp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272359 MGI:2442159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15377 MGI:1347477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sympk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68188 MGI:1915438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 217 ESTs, 2 Proteins

name	Rshl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83434 MGI:1927643
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmwd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13401 MGI:94907
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dmpk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13400 MGI:94906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Six5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20475 MGI:106220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG243866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243866 MGI:3647482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Fbxo46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243867 MGI:2444918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Qpctl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67369 MGI:1914619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snrpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107686 MGI:98345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gipr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381853 MGI:1352753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eml2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 87 ESTs, 13 Proteins

name	Gpr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319197 MGI:2441992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Opa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403187 MGI:2686271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vasp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22323 MGI:109268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C79127 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232941 MGI:2142330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20167 MGI:107612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fosb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14282 MGI:95575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830036C21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330479 MGI:2685688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ercc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13870 MGI:95412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042868 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256298 GeneID:100042868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : similar to pol protein transcript_id : XM_001478955.1

name	Psg30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384595 GeneID:73250 MGI:1920500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 30 transcript_id : NM_028480.2

name	Ceacam14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366076 GeneID:67084 MGI:1914334
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 14 transcript_id : NM_025957.3

name	EG381852 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347954 GeneID:381852 MGI:3647191
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG381852 transcript_id : NM_001034877.2

name	Ceacam11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112821666 GeneID:66996 MGI:1914246
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 11 transcript_id : NM_023289.2

name	Ceacam13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348500 GeneID:69785 MGI:1917035
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 13 transcript_id : NM_028171.2

name	Ceacam13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352676 GeneID:69785 MGI:1917035
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 13 transcript_id : NM_027210.2

name	Ceacam12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385587 GeneID:67315 MGI:1914565
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CEA-related cell adhesion molecule 12 transcript_id : NM_026087.1

name	Igfl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50979275 GeneID:232925 MGI:2685426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IGF-like family member 3 transcript_id : NM_001003393.1

name	Mill1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360553 GeneID:266815 MGI:2179988
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 1 transcript_id : NM_153749.3

name	Psg18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755189 GeneID:26438 MGI:1347251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 18 transcript_id : NM_011963.1

name	Psg28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778834 GeneID:114871 MGI:1891360
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 28 transcript_id : NM_054063.3

name	EG574429 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274189 GeneID:574429 MGI:3643750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574429 transcript_id : NM_001029893.1

name	EG232930 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256317 GeneID:232930 MGI:3648786
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : predicted gene, EG232930 transcript_id : XM_894409.3

name	Psg25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75832036 GeneID:114868 MGI:1891357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 25 transcript_id : NM_054060.1

name	EG545925 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81230477 GeneID:545925 MGI:3649013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG545925 transcript_id : NM_001037168.1

name	Psg23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350159 GeneID:56868 MGI:1891355
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 23 transcript_id : NM_020261.3

name	Psg21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365864 GeneID:72242 MGI:1891353
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy-specific glycoprotein 21 transcript_id : NM_027403.3

name	EG434540 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256554 GeneID:434540 MGI:3648784
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG434540 transcript_id : XM_486384.3

name	BC050099 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52138531 GeneID:243862 MGI:2681855
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC050099 transcript_id : NM_001004152.1

name	Psg19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755191 GeneID:26439 MGI:1347252
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 19 transcript_id : NM_011964.1

name	Psg17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796627 GeneID:26437 MGI:1347250
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein 17 transcript_id : NM_007677.2

name	Mill2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52693918 GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 2 transcript_id : NM_153761.2

name	Mill2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24415385 GeneID:243864 MGI:2179989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MHC I like leukocyte 2 transcript_id : NM_153760.1

name	Pglyrp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130401 GeneID:21946 MGI:1345092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidoglycan recognition protein 1 transcript_id : NM_009402.2

name	C530028I08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363777 GeneID:232933 MGI:2685005
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C530028I08 gene transcript_id : NM_001033314.2

name	Nova2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274145 GeneID:384569 MGI:104296
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuro-oncological ventral antigen 2 transcript_id : NM_001029877.1

name	Nanos2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34610230 GeneID:378430 MGI:2676627
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nanos homolog 2 (Drosophila) transcript_id : NM_194064.1

name	P42pop (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381397 GeneID:232934 MGI:2446472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Myb protein P42POP transcript_id : NM_145579.2

name	Irf2bp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129220 GeneID:272359 MGI:2442159
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 2 binding protein 1 transcript_id : NM_178757.3

name	Foxa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130865 GeneID:15377 MGI:1347477
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box A3 transcript_id : NM_008260.2

name	Sympk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256562 GeneID:68188 MGI:1915438
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 217 ESTs, 2 Proteins product : symplekin transcript_id : XM_485873.4

name	Rshl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13752582 GeneID:83434 MGI:1927643
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : radial spokehead-like 1 transcript_id : NM_031255.1

name	Dmwd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31044424 GeneID:13401 MGI:94907
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrophia myotonica-containing WD repeat motif transcript_id : NM_010058.1

name	Dmpk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14192944 GeneID:13400 MGI:94906
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrophia myotonica-protein kinase transcript_id : NM_032418.1

name	Six5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:73532775 GeneID:20475 MGI:106220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sine oculis-related homeobox 5 homolog (Drosophila) transcript_id : NM_011383.1

name	EG243866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379512 GeneID:243866 MGI:3647482
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG243866 transcript_id : XM_485874.4

name	Fbxo46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342111 GeneID:243867 MGI:2444918
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 46 transcript_id : NM_175530.2

name	Qpctl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129858 GeneID:67369 MGI:1914619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaminyl-peptide cyclotransferase-like transcript_id : NM_026111.3

name	Snrpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037144 GeneID:107686 MGI:98345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear ribonucleoprotein D2 transcript_id : NM_026943.1

name	Gipr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249102 GeneID:381853 MGI:1352753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastric inhibitory polypeptide receptor transcript_id : NM_001080815.1

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379500 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 80 ESTs, 2 Proteins product : echinoderm microtubule associated protein like 2, transcript variant 3 transcript_id : XM_895770.2

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379501 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 75 ESTs, 11 Proteins product : echinoderm microtubule associated protein like 2, transcript variant 4 transcript_id : XM_895785.2

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379502 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 76 ESTs, 4 Proteins product : echinoderm microtubule associated protein like 2, transcript variant 1 transcript_id : XM_133217.8

name	Eml2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256568 GeneID:72205 MGI:1919455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 66 ESTs, 2 Proteins product : echinoderm microtubule associated protein like 2 transcript_id : XM_001480295.1

name	Gpr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358081 GeneID:319197 MGI:2441992
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 4 transcript_id : NM_175668.3

name	Opa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801352 GeneID:403187 MGI:2686271
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : optic atrophy 3 (human) transcript_id : NM_207525.3

name	Vasp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33469092 GeneID:22323 MGI:109268
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasodilator-stimulated phosphoprotein transcript_id : NM_009499.1

name	C79127 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355065 GeneID:232941 MGI:2142330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C79127 transcript_id : NM_177691.3

name	Rtn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129806 GeneID:20167 MGI:107612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 2 (Z-band associated protein) transcript_id : NM_013648.5

name	Rtn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372064 GeneID:20167 MGI:107612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reticulon 2 (Z-band associated protein) transcript_id : NM_001025364.2

name	Fosb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110350004 GeneID:14282 MGI:95575
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FBJ osteosarcoma oncogene B transcript_id : NM_008036.2

name	D830036C21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379514 GeneID:330479 MGI:2685688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA D830036C21 gene transcript_id : XM_987344.1

name	Ercc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679678 GeneID:13870 MGI:95412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency, complementation group 1 transcript_id : NM_007948.1

name	LOC100042868 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256299 GeneID:100042868
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001479005.1

name	Psg30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625985 CCDS:CCDS20863.1 GeneID:73250 MGI:1920500
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 30 protein_id : NP_082756.1

name	Ceacam14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385448 CCDS:CCDS20864.1 GeneID:67084 MGI:1914334
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CEA-related cell adhesion molecule 14 protein_id : NP_080233.1

name	EG381852 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702219 GeneID:381852 MGI:3647191
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC381852 protein_id : NP_001030049.1

name	Ceacam11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112821667 CCDS:CCDS20865.1 GeneID:66996 MGI:1914246
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Ceacam11-C1; Ceacam11-C3; Ceacam11-C4; carcinoembryonic antigen related protein product : CEA-related cell adhesion molecule 11 protein_id : NP_075778.2

name	Ceacam13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312412 GeneID:69785 MGI:1917035
definition	codon_start : 1 note : Ceacam13-C1; Ceacam13-C2 product : CEA-related cell adhesion molecule 13 protein_id : NP_081486.1

name	Ceacam13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312340 CCDS:CCDS20866.1 GeneID:69785 MGI:1917035
definition	codon_start : 1 note : Ceacam13-C1; Ceacam13-C2 product : CEA-related cell adhesion molecule 13 protein_id : NP_082447.1

name	Ceacam12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385588 CCDS:CCDS20867.1 GeneID:67315 MGI:1914565
definition	GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Ceacam12-C1; Ceacam12-C3 product : CEA-related cell adhesion molecule 12 protein_id : NP_080363.1

name	Igfl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50979276 GeneID:232925 MGI:2685426
definition	codon_start : 1 note : insulin growth factor-like product : gene model 580 protein_id : NP_001003393.1

name	Mill1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559897 CCDS:CCDS20868.1 GeneID:266815 MGI:2179988
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MHC I-like leukocyte 1; MHC class I-like located near the LRC, 1 product : MHC I like leukocyte 1 protein_id : NP_715630.2

name	Psg18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755190 CCDS:CCDS20869.1 GeneID:26438 MGI:1347251
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009691 - cytokinin biosynthesis [Evidence TAS]; GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 3 product : pregnancy specific glycoprotein 18 protein_id : NP_036093.1

name	Psg28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778835 CCDS:CCDS20870.1 GeneID:114871 MGI:1891360
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation product : pregnancy-specific glycoprotein 28 protein_id : NP_473404.2

name	EG574429 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274190 CCDS:CCDS20871.1 GeneID:574429 MGI:3643750
definition	codon_start : 1 product : hypothetical protein LOC574429 protein_id : NP_001025064.1

name	EG232930 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256318 GeneID:232930 MGI:3648786
definition	codon_start : 1 product : similar to myotubularin related protein 2 protein_id : XP_899502.3

name	Psg25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75832037 CCDS:CCDS20872.1 GeneID:114868 MGI:1891357
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 25 protein_id : NP_473401.1

name	EG545925 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230478 CCDS:CCDS20873.1 GeneID:545925 MGI:3649013
definition	codon_start : 1 product : hypothetical protein LOC545925 protein_id : NP_001032245.1

name	Psg23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19549329 CCDS:CCDS20874.1 GeneID:56868 MGI:1891355
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 product : pregnancy-specific glycoprotein 23 protein_id : NP_064657.2

name	Psg21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22758148 CCDS:CCDS20875.1 GeneID:72242 MGI:1891353
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 note : pregnancy-specific glrcoprotein 21 product : pregnancy-specific glycoprotein 21 protein_id : NP_081679.2

name	EG434540 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256555 GeneID:434540 MGI:3648784
definition	codon_start : 1 product : similar to pregnancy-specific glycoprotein 21 protein_id : XP_486384.3

name	BC050099 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138532 CCDS:CCDS20876.1 GeneID:243862 MGI:2681855
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC243862 protein_id : NP_001004152.1

name	Psg19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755192 CCDS:CCDS20877.1 GeneID:26439 MGI:1347252
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0007565 - pregnancy [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carcinoembryonic antigen 4 product : pregnancy specific glycoprotein 19 protein_id : NP_036094.1

name	Psg17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679495 CCDS:CCDS20878.1 GeneID:26437 MGI:1347250
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006955 - immune response [Evidence IDA]; GO:0007565 - pregnancy [Evidence TAS] codon_start : 1 note : carcinoembryonic antigen 2 product : pregnancy specific glycoprotein 17 protein_id : NP_031703.1

name	Mill2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52693919 CCDS:CCDS20880.1 GeneID:243864 MGI:2179989
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 note : long form is encoded by transcript variant 1; MHC I-like leukocyte 2; MHC class I-like located near the LRC, 2 product : MHC I like leukocyte 2 long form protein_id : NP_715642.2

name	Mill2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24415386 CCDS:CCDS20879.1 GeneID:243864 MGI:2179989
definition	GO_component : GO:0042612 - MHC class I protein complex [Evidence IEA] GO_function : GO:0030106 - MHC class I receptor activity [Evidence IEA] GO_process : GO:0019882 - antigen processing and presentation [Evidence IEA] codon_start : 1 note : short form is encoded by transcript variant 2; MHC I-like leukocyte 2; MHC class I-like located near the LRC, 2 product : MHC I like leukocyte 2 short form protein_id : NP_715641.1

name	Pglyrp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679293 CCDS:CCDS20881.1 GeneID:21946 MGI:1345092
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008745 - N-acetylmuramoyl-L-alanine amidase activity [Evidence IEA]; GO:0016019 - peptidoglycan receptor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0009253 - peptidoglycan catabolism [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : tumor necrosis factor super family 3-like product : peptidoglycan recognition protein 1 protein_id : NP_033428.1

name	C530028I08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677484 GeneID:232933 MGI:2685005
definition	codon_start : 1 product : hypothetical protein LOC232933 protein_id : NP_001028486.1

name	Nova2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274146 CCDS:CCDS20882.1 GeneID:384569 MGI:104296
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IDA] codon_start : 1 product : neuro-oncological ventral antigen 2 protein_id : NP_001025048.1

name	Nanos2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34610231 CCDS:CCDS20883.1 GeneID:378430 MGI:2676627
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation product : nanos homolog 2 protein_id : NP_918953.1

name	P42pop (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704164 GeneID:232934 MGI:2446472
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0007076 - mitotic chromosome condensation [Evidence IEA]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 note : partner of profilin product : Myb protein P42POP protein_id : NP_663554.1

name	Irf2bp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982348 CCDS:CCDS20885.1 GeneID:272359 MGI:2442159
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003714 - transcription corepressor activity [Evidence ISS]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : interferon regulatory factor 2 binding protein 1 protein_id : NP_848872.2

name	Foxa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679831 CCDS:CCDS20886.1 GeneID:15377 MGI:1347477
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IMP] GO_process : GO:0001678 - cell glucose homeostasis [Evidence IMP]; GO:0009267 - cellular response to starvation [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : hepatocyte nuclear factor 3 gamma (winged helix transcription factor) product : forkhead box A3 protein_id : NP_032286.1

name	Sympk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256563 GeneID:68188 MGI:1915438
definition	codon_start : 1 product : symplekin protein_id : XP_485873.2

name	Rshl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752583 CCDS:CCDS20887.1 GeneID:83434 MGI:1927643
definition	GO_component : GO:0005929 - cilium [Evidence ISS] codon_start : 1 exception : mismatches in translation product : radial spokehead-like 1 protein_id : NP_112545.1

name	Dmwd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044425 CCDS:CCDS20888.1 GeneID:13401 MGI:94907
definition	codon_start : 1 exception : mismatches in translation note : dystrophia myotonica linked gene, N9 product : dystrophia myotonica-containing WD repeat motif protein_id : NP_034188.1

name	Dmpk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14192945 GeneID:13400 MGI:94906
definition	GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0042802 - identical protein binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] [Evidence ISS]; GO:0008016 - regulation of heart contraction [Evidence IDA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence ISS] citation : [PUBMED 1302022] citation : [PUBMED 8499920] codon_start : 1 note : dystrophia myotonica kinase, B15 product : dystrophia myotonica-protein kinase protein_id : NP_115794.1

name	Six5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73532776 CCDS:CCDS20889.1 GeneID:20475 MGI:106220
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : sine oculis-related homeobox 5 homolog protein_id : NP_035513.1

name	EG243866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379513 GeneID:243866 MGI:3647482
definition	codon_start : 1 product : similar to hCG1645909 protein_id : XP_485874.4

name	Fbxo46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425304 CCDS:CCDS20890.1 GeneID:243867 MGI:2444918
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : F-box only protein 34-like product : F-box protein 46 protein_id : NP_780739.1

name	Qpctl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560195 CCDS:CCDS20891.1 GeneID:67369 MGI:1914619
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : glutaminyl-peptide cyclotransferase-like protein_id : NP_080387.2

name	Snrpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037145 CCDS:CCDS20892.1 GeneID:107686 MGI:98345
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : small nuclear ribonucleoprotein D2 protein_id : NP_081219.1

name	Gipr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249103 GeneID:381853 MGI:1352753
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016519 - gastric inhibitory peptide receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence TAS] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence TAS] codon_start : 1 note : glucose-dependent insulinotropic polypeptide receptor product : gastric inhibitory polypeptide receptor protein_id : NP_001074284.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904015 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 isoform 3 protein_id : XP_900863.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904019 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 isoform 4 protein_id : XP_900878.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256569 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 protein_id : XP_001480345.1

name	Eml2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82904017 GeneID:72205 MGI:1919455
definition	codon_start : 1 product : echinoderm microtubule associated protein like 2 isoform 1 protein_id : XP_133217.5

name	Gpr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316758 CCDS:CCDS20893.1 GeneID:319197 MGI:2441992
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR4 product : G protein-coupled receptor 4 protein_id : NP_783599.1

name	Opa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625722 CCDS:CCDS20894.1 GeneID:403187 MGI:2686271
definition	codon_start : 1 product : OPA3 protein protein_id : NP_997408.2

name	Vasp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469093 GeneID:22323 MGI:109268
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030175 - filopodium [Evidence IDA]; GO:0005925 - focal adhesion [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IGI]; GO:0007411 - axon guidance [Evidence IGI]; GO:0001843 - neural tube closure [Evidence IGI] codon_start : 1 exception : mismatches in translation product : vasodilator-stimulated phosphoprotein protein_id : NP_033525.1

name	C79127 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244132 CCDS:CCDS20895.1 GeneID:232941 MGI:2142330
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC232941 protein_id : NP_808359.1

name	Rtn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305449 CCDS:CCDS20896.1 GeneID:20167 MGI:107612
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] codon_start : 1 note : isoform B is encoded by transcript variant B; NSP-like 1 product : reticulon 2 isoform B protein_id : NP_038676.1

name	Rtn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778920 GeneID:20167 MGI:107612
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] [Evidence ND] codon_start : 1 note : isoform C is encoded by transcript variant C; NSP-like 1 product : reticulon 2 isoform C protein_id : NP_001020535.1

name	Fosb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679827 CCDS:CCDS20897.1 GeneID:14282 MGI:95575
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : FBJ osteosarcoma oncogene B protein_id : NP_032062.1

name	D830036C21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379515 GeneID:330479 MGI:2685688
definition	codon_start : 1 product : hypothetical protein protein_id : XP_992438.1

name	Ercc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679679 CCDS:CCDS20898.1 GeneID:13870 MGI:95412
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0000109 - nucleotide-excision repair complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : excision repair 1 product : excision repair cross-complementing rodent repair deficiency, complementation group 1 protein_id : NP_031974.1

name	LOC384560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384560
definition	number : 1 pseudo : _no_value

name	LOC384560 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384560
definition	number : 2 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 4 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 3 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 2 pseudo : _no_value

name	LOC666831 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666831
definition	number : 1 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 1 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 2 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 3 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 4 pseudo : _no_value

name	LOC666863 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666863
definition	number : 5 pseudo : _no_value

name	LOC671132 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256297 GeneID:671132
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 22 Proteins product : hypothetical LOC671132 pseudo : _no_value transcript_id : XR_033994.1

name	Psg-ps1 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872155 GeneID:232919 MGI:1347253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy specific glycoprotein pseudogene 1 pseudo : _no_value transcript_id : NR_002857.1

name	LOC666767 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256302 GeneID:666767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 10 Proteins product : similar to 2410004N11Rik protein pseudo : _no_value transcript_id : XR_034001.1

name	LOC671190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256303 GeneID:671190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 15 Proteins product : similar to eukaryotic translation elongation factor 1 alpha 1 pseudo : _no_value transcript_id : XR_034015.1

name	LOC546936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256304 GeneID:546936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 21 Proteins product : similar to myotubularin related protein 2 pseudo : _no_value transcript_id : XR_034021.1

clone name	MSMg01-505H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-198M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377L01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-273C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277F15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-345I19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-510L11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-137M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-492F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-168C11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505H03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346L06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-065K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-086P04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-177O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291B02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-173G06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090M03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-458E06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-479B22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-150B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472C18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-397J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-087E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-492B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-204F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-144J18.T7 (MSMg01no144_j18.b1)	MSMg01-144J18.TJ (MSMg01no144_j18.g1)
ACC	AG348636	AG348637
length	737	737
length of high quality (start - end)	249 (73 - 321)	345 (73 - 417)
definition	CHROMAT_FILE: MSMg01no144_j18.b1 PHD_FILE: MSMg01no144_j18.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:05:29 2005	CHROMAT_FILE: MSMg01no144_j18.g1 PHD_FILE: MSMg01no144_j18.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 19:05:29 2005
singlet/doublet	singlet	---
BLAST hit	plural	no hit data
sequence	XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTTCAGAGAAGGGCGGAATT CCAGAAGGTGTTCTCAGAGGACTACACTTGCCAAAAGGACCTGTGTCCTT TGTCCATCACTATGGAGACACTGGCCTTCCTGTGAAGCCTAATAAGGCCA TCCAAACAGCTAGTTAGGGGCCTGGGATCCCAGATTGTCCTCTCCAGCAA TGCATTCCTGGGTGAGTCTCTGTGGAAGATGTCCAGGGTAACTATCATAA CTGTGGCTCCTGACAGTGCACTGGATGTTGACACAAGTTAGACAGCCTTG TACCGTGTCAGCTCCAACAGGATTTCATAGCCAAGCAAAAACAAAAATAT TTCTAAGTTTCACAGAGATTTCCATCCAGGCCTCATAGTGCTCTGTGTGG GGACTCCACAGCCCCCTCTGCTAGAGCTTATGCTACCTCCACAGAGGGAG TCTATATTAGGGATATAGGCATGGTGAGAGTCCCAAGGGTCAATGCTGAG TCTCACATTCTTGGGCTGAGTTTTTCCAGCACATGATAGGTAACTCTGCA TGAAAAAAAAGGTGAAGGGTTCCGACCTAATGGCGTTAGTACAGACCATG TGTGCCCTTGCACAAGTGCTCAAATACCAATGTGACGAAAAATGCAGTGC AGGAGATAGCAGGTACCATCAATTCCTACCAGTCGACTTATTTTGTACCA TAATCCTCCCCCACACTTTGAACTCCATAAAAGTCCG	AATGAAGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXCTTATAGAGGAGCTAAGATCAGTTCCTA GCACATCCATGGCTGCTTATAACTGTTTGTCACTCCCATTTCAGAGGACC CAATGCCACTTTCTGACCTGTGTTGGCCAATTTCTGACCTGTGTTGGTAT AAGGCATGCTGTTATGCACAGATATCATGTTGCTAATATAACGATATATA AAAAATATTATAATAAAGCCACCAGTCACCTTTGTATCACAAATCATATC TACAAGGTCCTCACCTGTGGAGTATATGGCATTCCATGTGAAGGAAGAGT GTCGTTTTCTCTCAAGCCTGCCTGCCTGACTCTCATACCCTCCATTCTTC TGAGGCTCATAGCCCCCCCCCCGCGGTCCTGTGCTTCACGCCAGTCACCA TGGAACTCCTGGGAAGGTTGGCACATGTTATGATGGTCTAGCCTGGGTAG AGCTGAATTCCAGCCTTGCTCATTGTCTCATGTAAGATTTCTAAACAGAC ATCAAGCCCTGAGGGCAGGCTGTGTGCGCTTCTAAGGGAAGTTCATTGCC CATTCTTCTTACATTTGATCTCTATCACCTCTTCCATAATCTCTGTCTTT TACCGTGCTGCTCCTATCCTTCTACTGGCAGCTCTTCTTACCTTCTCTTC ATCACTTCCCTGCTTGCTTGTTATTTTCTCTTCCTTA
quality values	Open. Hide. 6 6 6 6 21 22 29 23 19 10 10 14 26 24 48 48 48 38 57 53 53 48 30 30 31 31 22 21 22 10 10 10 13 10 9 6 7 7 6 8 6 9 10 19 18 30 31 31 33 33 31 31 31 31 31 31 21 21 9 9 9 9 9 9 9 16 16 22 22 17 12 12 10 22 22 47 50 50 57 36 36 37 50 37 47 57 57 57 57 53 53 53 53 68 68 68 68 68 68 68 68 68 51 51 50 50 50 51 53 53 50 54 54 54 54 57 50 57 44 42 35 36 30 36 44 57 57 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 50 50 50 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 46 46 38 46 46 46 57 57 57 50 50 50 50 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 59 59 57 57 57 57 57 57 68 57 57 57 59 59 59 59 57 57 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 57 57 57 57 59 57 57 59 59 59 68 57 57 57 57 57 57 59 59 59 59 57 48 48 48 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 57 48 48 48 57 57 59 59 59 57 48 48 48 48 41 41 32 32 18 19 11 11 11 11 11 17 12 11 11 11 25 25 41 41 41 41 48 47 47 46 46 46 48 48 57 47 47 46 48 48 57 59 57 57 57 57 57 68 68 59 48 43 43 43 43 43 35 37 32 37 37 43 59 59 59 54 57 57 57 57 57 59 59 59 48 48 48 59 59 48 48 48 57 57 57 59 59 59 47 39 32 32 28 33 32 39 39 28 24 12 8 6 6 9 9 9 11 11 8 8 8 15 23 59 41 40 40 40 48 48 48 59 59 59 59 59 59 59 39 32 28 23 23 23 37 41 43 46 46 46 57 57 59 59 59 59 59 43 40 28 28 18 19 13 24 24 42 39 39 39 30 24 21 15 13 15 15 30 30 43 39 37 37 39 37 43 34 36 32 32 35 43 27 28 20 20 23 28 28 36 35 35 35 35 35 39 39 39 39 36 37 34 28 17 14 15 15 26 30 33 33 39 43 39 39 37 37 24 21 16 12 12 16 27 36 39 39 39 39 35 35 30 37 31 30 19 26 26 13 13 19 18 23 15 17 15 15 15 22 19 24 20 20 15 23 23 15 8 8 6 6 8 6 10 17 26 26 30 16 9 9 10 8 8 8 8 15 13 15 15 15 16 14 19 19 27 22 25 35 25 19 12 10 10 10 14 13 14 14 11 10 8 8 10 10 9 12 15 11 11 11 11 11 10 20 19 15 10 10 10 9 12 12 12 15 9 10 11 15 12 15 21 21 28 17 12 9 9 9 9 9 13 10 9 9 9 9 15 16 11 12 11 11 11 11 10 10 10 10 11 11 15 13 8 8 8 8 8 6 6 8 8 8 7 7 8 9 15 15 15 12 15 10 10 9 9 10 10 10 10 11 9 9 9 9 13 9 13 12 10 10 8 8 8 8 8 8 9 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 7	Open. Hide. 7 7 6 6 6 8 8 19 13 9 9 12 14 17 19 19 22 41 41 30 32 32 28 32 39 39 37 23 23 9 9 9 6 6 6 6 6 10 13 10 14 13 13 24 23 22 10 12 15 36 21 36 33 44 39 37 33 25 21 15 10 10 8 9 8 9 9 13 21 28 33 33 50 50 50 53 53 57 57 57 57 53 53 53 53 53 53 53 53 47 42 42 42 42 42 42 51 68 68 68 68 51 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 51 51 51 50 50 50 50 50 50 50 50 50 50 50 50 50 50 68 68 68 68 68 68 51 51 51 51 51 51 68 68 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 59 59 59 68 57 57 57 57 62 57 57 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 59 59 68 68 68 57 57 57 57 59 57 57 59 38 32 32 12 12 12 12 18 32 44 57 57 68 57 57 57 57 57 59 57 57 57 54 54 54 57 57 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 59 54 54 59 59 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 14 9 7 9 6 8 22 26 27 26 14 12 10 11 15 22 37 37 37 37 59 59 59 59 47 50 50 50 50 50 59 59 59 59 59 48 48 48 57 43 43 39 37 30 37 37 39 47 37 59 47 47 40 39 37 37 32 22 22 22 18 18 23 24 37 39 33 33 36 36 33 39 36 36 28 25 28 37 43 35 35 35 37 37 32 30 30 32 37 37 35 39 34 43 36 32 31 37 37 37 26 24 17 13 13 19 30 39 36 36 39 37 39 39 35 35 32 37 36 36 19 22 15 24 19 40 33 42 42 42 42 30 29 12 10 10 11 10 12 14 12 12 10 14 14 18 18 28 32 23 22 11 11 11 12 12 15 15 28 18 23 11 13 7 9 8 10 11 9 9 9 13 13 12 11 12 11 9 9 9 10 11 13 13 8 8 10 8 10 11 18 21 23 33 19 24 17 14 10 10 10 10 10 15 23 28 24 21 15 13 15 10 10 9 9 9 10 10 13 11 9 9 9 9 8 8 8 10 9 8 8 8 9 10 10 9 9 10 11 21 18 8 6 6 6 8 8 9 13 10 11 10 8 8 8 8 8 8 10 10 8 8 8 8 8 10 6 6 8 8 8 10 12 15 10 8 9 8 12 8 8 8 10 11 11 11 9 14 10 8 8 8 8 7 7 12 8 8 8 8 8 8 8 11 9 9 9 10 11 10 11 11 17 14 21 21 21 15 16 15 16 12 11 11 12 13 11

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no144_j18.b1 MSMg01no144_j18.b1 CHROMAT_FILE:
MSMg01no144_j18.b1 PHD_FILE: MSMg01no144_j18.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 19:05:29 2005
         (249 letters)



>mm_chr7_18933561_18934209
          Length = 649

 Score =  482 bits (249), Expect = e-140
 Identities = 249/249 (100%)
 Strand = Plus / Plus

                                                                       
Query: 1   tacacttgccaaaaggacctgtgtcctttgtccatcactatggagacactggccttcctg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 tacacttgccaaaaggacctgtgtcctttgtccatcactatggagacactggccttcctg 260

                                                                       
Query: 61  tgaagcctaataaggccatccaaacagctagttaggggcctgggatcccagattgtcctc 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 tgaagcctaataaggccatccaaacagctagttaggggcctgggatcccagattgtcctc 320

                                                                       
Query: 121 tccagcaatgcattcctgggtgagtctctgtggaagatgtccagggtaactatcataact 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 321 tccagcaatgcattcctgggtgagtctctgtggaagatgtccagggtaactatcataact 380

                                                                       
Query: 181 gtggctcctgacagtgcactggatgttgacacaagttagacagccttgtaccgtgtcagc 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 381 gtggctcctgacagtgcactggatgttgacacaagttagacagccttgtaccgtgtcagc 440

                    
Query: 241 tccaacagg 249
           |||||||||
Sbjct: 441 tccaacagg 449


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 12
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 249
Length of database: 649
Length adjustment: 9
Effective length of query: 240
Effective length of database: 640
Effective search space:   153600
Effective search space used:   153600
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information