MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-211H21
Chromosome	7 (Build37)
Map Location	92,670,313 - 92,670,604
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100039239, Fah, Zfand6, 2610206C17Rik, EG620480, Olfr291, LOC666276, Olfr290, ENSMUSG00000070600, F830104D24Rik, LOC620641, EG620672, Vmn2r-ps68, EG620697, Vmn2r-ps69, LOC330581, LOC100039339
Downstream gene	Vmn2r70, Vmn2r-ps72, EG233445, Vmn2r-ps74, EG244114, EG620928, EG546980, LOC666382, LOC637652, LOC637667, EG666418, LOC100039471, EG546981, Vmn2r-ps86, Vmn2r76, Olfr310, Olfr309, Olfr308, Olfr307, Olfr306-ps1, Olfr305, Olfr304, Olfr303, Olfr301, Olfr1531-ps1, Olfr300-ps1, Olfr299, Olfr298
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039239 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Fah (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14085 MGI:95482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfand6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65098 MGI:1929510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610206C17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72495 MGI:1919745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	EG620480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620480 MGI:3643981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 204 ESTs, 7 Proteins

name	Olfr291 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258410 MGI:3030125
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666276 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Olfr290 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258411 MGI:3030124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000070600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100009609 MGI:3642776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 Proteins

name	F830104D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233437 MGI:3588220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620641 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620641
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG620672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620672 MGI:3643129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Vmn2r-ps68 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG620697 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620697 MGI:3648297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins

name	Vmn2r-ps69 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins pseudo : _no_value

name	LOC330581 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:330581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	LOC100039339 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Vmn2r70 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins

name	Vmn2r-ps72 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666358
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG233445 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233445 MGI:3646472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins

name	Vmn2r-ps74 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG244114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244114 MGI:3647591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	EG620928 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620928 MGI:3646433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins

name	EG546980 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546980 MGI:3643877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins

name	LOC666382 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC637652 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC637667 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637667
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG666418 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666418 MGI:3642976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100039471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039471
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG546981 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546981 MGI:3648311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	Vmn2r-ps86 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Vmn2r76 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	Olfr310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258222 MGI:3030144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr309 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258196 MGI:3030143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr308 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258614 MGI:3030142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr307 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258610 MGI:3030141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr306-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404377 MGI:3030140
definition	note : olfactory receptor 306, pseudogene 1 pseudo : _no_value

name	Olfr305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258609 MGI:3030139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258089 MGI:3030138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr303 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258612 MGI:3030137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr301 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257958 MGI:3030135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1531-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258090 MGI:3031365
definition	gene_synonym : MOR221-1P note : olfactory receptor 1531, pseudogene 1 pseudo : _no_value

name	Olfr300-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258088 MGI:3030134
definition	gene_synonym : MOR234-4P note : olfactory receptor 300, pseudogene 1 pseudo : _no_value

name	Olfr299 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257929 MGI:3030133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr298 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257905 MGI:3030132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039239 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257543 GeneID:100039239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039239 transcript_id : XM_001472533.1

name	Fah (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227239 GeneID:14085 MGI:95482
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fumarylacetoacetate hydrolase transcript_id : NM_010176.2

name	Zfand6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371149 GeneID:65098 MGI:1929510
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, AN1-type domain 6 transcript_id : NM_022985.4

name	2610206C17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380802 GeneID:72495 MGI:1919745
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : RIKEN cDNA 2610206C17 gene transcript_id : XM_895846.2

name	EG620480 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257541 GeneID:620480 MGI:3643981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 204 ESTs, 7 Proteins product : predicted gene, EG620480 transcript_id : XM_884867.3

name	Olfr291 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238959 GeneID:258410 MGI:3030125
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 291 transcript_id : NM_146415.1

name	Olfr290 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238965 GeneID:258411 MGI:3030124
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 290 transcript_id : NM_146416.1

name	ENSMUSG00000070600 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257545 GeneID:100009609 MGI:3642776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 21 Proteins product : predicted gene, ENSMUSG00000070600 transcript_id : XM_001472549.1

name	F830104D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:76443669 GeneID:233437 MGI:3588220
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA F830104D24 gene transcript_id : NM_001033878.1

name	EG620672 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257547 GeneID:620672 MGI:3643129
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG620672 transcript_id : XM_885064.2

name	EG620697 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257549 GeneID:620697 MGI:3648297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG620697 transcript_id : XM_885089.3

name	LOC330581 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257551 GeneID:330581
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : similar to putative pheromone receptor transcript_id : XM_001472690.1

name	LOC100039339 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257553 GeneID:100039339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001472716.1

name	Vmn2r70 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257555 GeneID:670940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins product : vomeronasal receptor Vmn2r70 transcript_id : XM_001472739.1

name	EG233445 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257557 GeneID:233445 MGI:3646472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins product : predicted gene, EG233445 transcript_id : XM_885248.3

name	EG244114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257559 GeneID:244114 MGI:3647591
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : predicted gene, EG244114 transcript_id : XM_885266.3

name	EG620928 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257561 GeneID:620928 MGI:3646433
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 24 Proteins product : predicted gene, EG620928 transcript_id : XM_885310.3

name	EG546980 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257563 GeneID:546980 MGI:3643877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 Proteins product : predicted gene, EG546980 transcript_id : XM_885336.3

name	EG546981 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257565 GeneID:546981 MGI:3648311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : predicted gene, EG546981 transcript_id : XM_621801.4

name	Vmn2r76 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257567 GeneID:675969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : vomeronasal receptor Vmn2r76 transcript_id : XM_001473024.1

name	Olfr310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372125 GeneID:258222 MGI:3030144
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 310 transcript_id : NM_001011520.1

name	Olfr309 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801493 GeneID:258196 MGI:3030143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 309 transcript_id : NM_001011866.1

name	Olfr308 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239365 GeneID:258614 MGI:3030142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 308 transcript_id : NM_146621.1

name	Olfr307 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239071 GeneID:258610 MGI:3030141
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 307 transcript_id : NM_146617.1

name	Olfr305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112982874 GeneID:258609 MGI:3030139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 305 transcript_id : NM_146616.2

name	Olfr304 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801419 GeneID:258089 MGI:3030138
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 304 transcript_id : NM_001011828.1

name	Olfr303 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239357 GeneID:258612 MGI:3030137
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 303 transcript_id : NM_146619.1

name	Olfr301 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059096 GeneID:257958 MGI:3030135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 301 transcript_id : NM_212436.1

name	Olfr299 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801313 GeneID:257929 MGI:3030133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 299 transcript_id : NM_001011767.1

name	Olfr298 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801289 GeneID:257905 MGI:3030132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 298 transcript_id : NM_001011751.1

name	LOC100039239 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257544 GeneID:100039239
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472583.1

name	Fah (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753814 CCDS:CCDS21418.1 GeneID:14085 MGI:95482
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004334 - fumarylacetoacetase activity [Evidence IEA] [Evidence IMP]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006527 - arginine catabolism [Evidence IMP]; GO:0009072 - aromatic amino acid family metabolism [Evidence IEA]; GO:0006559 - L-phenylalanine catabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006572 - tyrosine catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : fumarylacetoacetate hydrolase protein_id : NP_034306.1

name	Zfand6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15805026 CCDS:CCDS21419.1 GeneID:65098 MGI:1929510
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IPI] codon_start : 1 note : zinc finger, A20 domain containing 3 product : associated with Prkcl1 protein_id : NP_075361.2

name	2610206C17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82906994 GeneID:72495 MGI:1919745
definition	codon_start : 1 product : hypothetical protein LOC72495 protein_id : XP_900939.1

name	EG620480 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257542 GeneID:620480 MGI:3643981
definition	codon_start : 1 product : similar to isolog of yeast sui1 and rice gos2; putative protein_id : XP_889960.3

name	Olfr291 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238960 CCDS:CCDS21420.1 GeneID:258410 MGI:3030125
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-11231385-11230438; olfactory receptor MOR254-2 product : olfactory receptor 291 protein_id : NP_666527.1

name	Olfr290 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238966 CCDS:CCDS21421.1 GeneID:258411 MGI:3030124
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NHDJ-11170115-11169168; olfactory receptor MOR254-1 product : olfactory receptor 290 protein_id : NP_666528.1

name	ENSMUSG00000070600 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257546 GeneID:100009609 MGI:3642776
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001472599.1

name	F830104D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:76443670 CCDS:CCDS21422.1 GeneID:233437 MGI:3588220
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008067 - metabotropic glutamate, GABA-B-like receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007216 - metabotropic glutamate receptor signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : putative pheromone receptor product : pheromone receptor-like protein_id : NP_001029050.1

name	EG620672 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257548 GeneID:620672 MGI:3643129
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_890157.2

name	EG620697 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257550 GeneID:620697 MGI:3648297
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_890182.2

name	LOC330581 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257552 GeneID:330581
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001472740.1

name	LOC100039339 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257554 GeneID:100039339
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001472766.1

name	Vmn2r70 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257556 GeneID:670940
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001472789.1

name	EG233445 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257558 GeneID:233445 MGI:3646472
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_890341.3

name	EG244114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257560 GeneID:244114 MGI:3647591
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_890359.3

name	EG620928 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257562 GeneID:620928 MGI:3646433
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_890403.3

name	EG546980 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257564 GeneID:546980 MGI:3643877
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_890429.3

name	EG546981 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257566 GeneID:546981 MGI:3648311
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_621801.4

name	Vmn2r76 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257568 GeneID:675969
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001473074.1

name	Olfr310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372126 CCDS:CCDS21423.1 GeneID:258222 MGI:3030144
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NHDJ-9838699-9839697; olfactory receptor MOR227-6P product : olfactory receptor 310 protein_id : NP_001011520.1

name	Olfr309 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801494 CCDS:CCDS21424.1 GeneID:258196 MGI:3030143
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9801340-9802266; olfactory receptor MOR251-4P product : olfactory receptor 309 protein_id : NP_001011866.1

name	Olfr308 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239366 CCDS:CCDS21425.1 GeneID:258614 MGI:3030142
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9786435-9787361; olfactory receptor MOR104-1 product : olfactory receptor 308 protein_id : NP_666832.1

name	Olfr307 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239072 CCDS:CCDS21426.1 GeneID:258610 MGI:3030141
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9772012-9772953; olfactory receptor MOR219-1 product : olfactory receptor 307 protein_id : NP_666828.1

name	Olfr305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112982875 CCDS:CCDS21427.1 GeneID:258609 MGI:3030139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9744055-9745014; olfactory receptor MOR219-2 product : olfactory receptor 305 protein_id : NP_666827.2

name	Olfr304 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801420 CCDS:CCDS21428.1 GeneID:258089 MGI:3030138
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9721756-9722757; olfactory receptor MOR219-3P product : olfactory receptor 304 protein_id : NP_001011828.1

name	Olfr303 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239358 CCDS:CCDS21429.1 GeneID:258612 MGI:3030137
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9712819-9713778; olfactory receptor MOR104-2 product : olfactory receptor 303 protein_id : NP_666830.1

name	Olfr301 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059097 GeneID:257958 MGI:3030135
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9693313-9692378; olfactory receptor MOR211-8P product : olfactory receptor 301 protein_id : NP_997601.1

name	Olfr299 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801314 CCDS:CCDS21430.1 GeneID:257929 MGI:3030133
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9643949-9642957; olfactory receptor MOR221-2 product : olfactory receptor 299 protein_id : NP_001011767.1

name	Olfr298 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801290 CCDS:CCDS21431.1 GeneID:257905 MGI:3030132
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NHDJ-9619796-9620794; olfactory receptor MOR219-4 product : olfactory receptor 298 protein_id : NP_001011751.1

name	LOC666276 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666276
definition	number : 1 pseudo : _no_value

name	LOC666276 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666276
definition	number : 2 pseudo : _no_value

name	LOC666276 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666276
definition	number : 3 pseudo : _no_value

name	LOC620641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620641
definition	number : 1 pseudo : _no_value

name	LOC620641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620641
definition	number : 2 pseudo : _no_value

name	LOC620641 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620641
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps68 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620683
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps68 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620683
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps69 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670926
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps69 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670926
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps69 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670926
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps69 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670926
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps69 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670926
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps69 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670926
definition	number : 6 pseudo : _no_value

name	Vmn2r-ps72 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666358
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps74 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666361
definition	number : 1 pseudo : _no_value

name	Vmn2r-ps74 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666361
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps74 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666361
definition	number : 3 pseudo : _no_value

name	Vmn2r-ps74 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666361
definition	number : 4 pseudo : _no_value

name	Vmn2r-ps74 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666361
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps74 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666361
definition	number : 6 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 9 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 8 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 7 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 6 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 5 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 4 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 3 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 2 pseudo : _no_value

name	LOC666382 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666382
definition	number : 1 pseudo : _no_value

name	LOC637652 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637652
definition	number : 1 pseudo : _no_value

name	LOC637667 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637667
definition	number : 6 pseudo : _no_value

name	LOC637667 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637667
definition	number : 5 pseudo : _no_value

name	LOC637667 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637667
definition	number : 4 pseudo : _no_value

name	LOC637667 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637667
definition	number : 3 pseudo : _no_value

name	LOC637667 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637667
definition	number : 2 pseudo : _no_value

name	LOC637667 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637667
definition	number : 1 pseudo : _no_value

name	EG666418 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666418
definition	number : 6 pseudo : _no_value

name	EG666418 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666418
definition	number : 5 pseudo : _no_value

name	EG666418 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666418
definition	number : 4 pseudo : _no_value

name	EG666418 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666418
definition	number : 3 pseudo : _no_value

name	EG666418 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666418
definition	number : 2 pseudo : _no_value

name	EG666418 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666418
definition	number : 1 pseudo : _no_value

name	LOC100039471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039471
definition	number : 1 pseudo : _no_value

name	LOC100039471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039471
definition	number : 2 pseudo : _no_value

name	LOC100039471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039471
definition	number : 3 pseudo : _no_value

name	LOC100039471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039471
definition	number : 4 pseudo : _no_value

name	LOC100039471 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039471
definition	number : 5 pseudo : _no_value

name	Vmn2r-ps86 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621096
definition	number : 2 pseudo : _no_value

name	Vmn2r-ps86 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621096
definition	number : 1 pseudo : _no_value

clone name	MSMg01-433C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412M11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122M22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-538C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-109I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-053O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505D06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-053A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519O09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-331N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326H23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-048E21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-048G23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536M08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-211H21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-303B17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-338M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366D06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-179G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-210B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138L16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-086D03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342H17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178P08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-113F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-311K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280P20
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-211H21.T7 (MSMg01no211_h21.b1)	MSMg01-211H21.TJ (MSMg01no211_h21.g1)
ACC	AG393190	AG393191
length	735	740
length of high quality (start - end)	574 (45 - 618)	292 (77 - 368)
definition	CHROMAT_FILE: MSMg01no211_h21.b1 PHD_FILE: MSMg01no211_h21.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:36:40 2005	CHROMAT_FILE: MSMg01no211_h21.g1 PHD_FILE: MSMg01no211_h21.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:36:40 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	CATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCTGCCCTAAATCTATCTGTCCCTGTGGTGTTTATGTTTGGGAGATTT TTAATGAATTCCTCTGTTTCTTTGTCAATTATGTATATATTTAGACAATT TTTCTGTTGTTGATTTGACTTTGGTATGTGATATCTGCCTAGAAAACCAT CCAGTTTTCTAAAATTTCCAGTTTTATTGAGTATAGACTTTTGTACTAAG ATCTGATGATTTTTTTTAATTTCCTCTGCTTCTCTTATTATATCTCATTT TTCGTTTCTGATTTTGTTAATTTGGATACTGCCTCTGGGACCTTTAGTTA GTTTGTCTAGGGGTTTATCTATGTCGCTGATTCTCTTAAAGAACCAGCTT TTGGTTTTGTTGATCCTTTGCATTTTTCTCTTTGTTTCTATTTGGTACAT TTCCACCCTGTGGTTGACTCTTTTCTTCTGTTTATTTCTCCTGTGTGAGT TTGCTTCTTTTTTGTTCTAGACCTCTCTGGAATGATTTTAAGTTGCTCGC TTGTTTCTTTACCAGGGTACTGTTCATTACCTTTGCTGTTCCTTATCCTC TCCTGACTCCTTCAGCACATTCTGGTCAATGGCTGAGCAAATATCTCTCA AGAGAACCCATATTGCTATGGTTGCATACTTGGGGAAAACACAAGCATAA CCTGCTCCCTTGTCACAACGACCGTGTTATCCATG	ACGATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXACTCTTGCACTTGTGCATAAGGCT TGTTTACTAGTTAGGTACAGTGGAAGCCAGCACCATCTTATAATGGTGAT TGCTCATGGCACAGCTCTCCACACCCATCCTGCAATTAAAAGGTGGGCGT GAGAAGGGAGGGGCTTCTTGAATACCTTGTCTCTCCTTGCTATGACTGAG TGTTTCATGAGAGGGGACAAATGACTGCCAACCCCAGGTGAGTTTCCCAT CTAGCCACTTGTAGTTGTACCACCGGTTCAAGGCTGACTTCTCTCCCAGC TTTTAGACAGGCCATCCTAATTATATGGGCCACACCAGTTTCCTTAGCCT GATCAGATGGATAAAACTGAGGGCTGGAGAGCAAGTGTCTTAAAATGGAG GCATGATTTGAATTCAAGACTTTTTGACTATCTATGGTTCTCCTCCTCTC TACACATACTGATCTTTGTCAAAGGGCTATTGCTAAATCACAATGAGGAA GGGACTTGGGCGTCTTTTTCTCTACTGCAAAAGTAGACATTGAACCAACA GACAGGTTAAGCATGGGAAAGTCTAGGAGGGTGATGAGATTTCCTAAATG GCTTCAACAGACATGCACAGAGGAGATAGGGACTATTGCCTTGGTTCTTG TGATCAGACCCAGACACCGTTCCAGACACATTATTTGTAG
quality values	Open. Hide. 6 6 6 6 7 13 26 39 39 37 37 37 31 31 37 37 33 33 33 37 33 33 39 48 31 33 36 36 36 36 44 53 53 57 57 48 48 48 48 42 29 19 20 20 42 34 68 68 42 42 42 42 43 43 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 57 57 57 57 38 27 13 11 11 11 21 24 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 59 59 57 48 48 48 59 59 59 59 59 43 43 43 48 48 57 59 54 57 57 57 57 57 48 48 48 48 48 48 57 59 59 59 59 48 48 48 48 47 43 47 43 39 39 59 59 59 48 48 48 29 29 21 28 30 34 33 30 24 15 11 10 10 10 10 12 14 15 18 22 32 37 32 32 39 39 47 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 48 48 48 47 50 47 41 59 15 13 8 8 10 19 28 47 47 40 40 43 39 39 32 34 28 32 32 39 47 43 57 57 57 59 48 48 48 43 47 43 54 54 57 57 57 59 59 59 59 59 57 48 48 48 48 48 57 57 57 57 57 59 68 59 59 54 54 54 57 57 48 57 57 57 57 57 57 59 59 59 59 42 42 33 35 42 42 44 42 42 43 57 57 57 57 57 57 68 68 68 68 68 57 57 54 54 54 48 57 48 48 48 57 57 57 57 57 47 48 46 43 43 57 47 42 39 35 35 35 34 36 30 32 43 40 43 43 47 59 59 48 48 48 48 57 59 59 48 48 48 41 41 39 47 47 22 17 8 8 8 12 17 34 41 39 39 43 48 48 48 57 57 48 48 57 57 57 57 57 57 59 59 59 59 48 48 48 48 48 48 48 47 47 42 42 48 57 59 43 43 43 39 37 28 34 30 24 17 13 9 9 9 9 9 9 11 12 12 14 14 24 14 15 19 17 20 16 18 15 21 12 14 21 21 20 20 20 29 15 15 13 19 19 19 10 9 9 9 11 14 23 19 19 20 28 32 32 28 28 28 20 20 30 34 24 18 12 11 11 16 16 21 18 18 18 18 19 26 31 30 28 21 15 13 11 11 11 11 12 17 21 24 26 34 30 30 31 18 18 18 14 13 10 10 9 9 9 9 11 8 8 8 7 10 10 12 8 8 9 9 11 13 12 12 15 14	Open. Hide. 6 6 6 6 8 11 11 9 9 20 17 39 38 39 41 37 37 44 44 44 47 47 50 50 41 41 47 47 53 38 53 53 53 53 47 43 36 32 28 28 34 34 48 42 53 54 54 48 50 53 68 68 68 68 68 68 68 68 68 68 68 42 48 36 36 41 48 44 57 57 50 50 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 57 57 57 52 52 52 57 43 57 52 52 52 52 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 57 57 59 62 68 68 68 68 68 68 68 68 68 57 68 68 68 68 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 68 68 68 57 57 57 57 57 59 59 68 68 68 68 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 57 59 59 59 57 57 57 57 57 68 59 57 59 59 48 47 47 47 43 46 43 48 57 57 57 68 68 68 59 59 59 59 59 59 59 57 57 57 59 57 44 59 43 43 43 59 59 59 59 59 30 30 24 21 21 12 11 9 8 8 8 8 10 11 10 11 11 11 9 9 9 9 9 10 12 12 12 21 28 37 59 59 59 59 59 59 57 48 50 53 53 53 57 59 59 59 57 57 57 68 68 68 68 68 68 54 54 57 57 46 59 43 43 43 43 43 44 39 43 36 37 37 30 30 30 30 30 42 42 42 59 59 59 59 57 57 59 59 59 59 54 54 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 50 50 57 57 57 68 68 68 68 68 68 57 57 57 57 59 59 59 59 59 68 57 57 57 57 59 59 59 54 54 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 68 68 68 68 68 68 57 57 57 57 57 54 54 54 57 57 57 57 57 57 57 57 57 59 59 59 57 57 57 57 50 57 59 59 59 59 54 54 54 57 57 57 54 54 54 57 59 59 59 59 42 28 28 32 32 40 43 43 48 43 43 48 48 48 57 43 43 40 43 39 47 35 35 35 47 37 39 35 37 34 30 23 35 35 39 34 41 41 39 43 39 37 37 32 32 30 37 37 43 43 43 43 30 32 24 30 30 37 37 41 41 35 39 39 39 37 34 34 30 30 18 17 24 30 43 43 41 34 32 23 20 20 28 32 39 48 48 43 43 36 36 37 34 34 34 28 24 24 28 28 32 37 37 41 37 36 37 32 29 29 37 37 40 30 25 12 11 11 21 19 23 30 34 28 24 22 34 30 28 13 15 15 28 26 35 31 18 20 17 18 20 18 18 18 24 24 33 33 39 41 37 37 28 28 20 18

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no211_h21.g1 MSMg01no211_h21.g1 CHROMAT_FILE:
MSMg01no211_h21.g1 PHD_FILE: MSMg01no211_h21.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:36:40 2005
         (292 letters)



>mm_chr7_92670016_92670707
          Length = 692

 Score =  557 bits (288), Expect = e-163
 Identities = 291/292 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   actcttgcacttgtgcataaggcttgtttactagttaggtacagtggaagccagcaccat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 589 actcttgcacttgtgcataaggcttgtttactagttaggtacagtggaagccagcaccat 530

                                                                       
Query: 61  cttataatggtgattgctcatggcacagctctccacacccatcctgcaattaaaaggtgg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 529 cttataatggtgattgctcatggcacagctctccacacccatcctgcaattaataggtgg 470

                                                                       
Query: 121 gcgtgagaagggaggggcttcttgaataccttgtctctccttgctatgactgagtgtttc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 469 gcgtgagaagggaggggcttcttgaataccttgtctctccttgctatgactgagtgtttc 410

                                                                       
Query: 181 atgagaggggacaaatgactgccaaccccaggtgagtttcccatctagccacttgtagtt 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 409 atgagaggggacaaatgactgccaaccccaggtgagtttcccatctagccacttgtagtt 350

                                                               
Query: 241 gtaccaccggttcaaggctgacttctctcccagcttttagacaggccatcct 292
           ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 349 gtaccaccggttcaaggctgacttctctcccagcttttagacaggccatcct 298


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 13
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 292
Length of database: 692
Length adjustment: 9
Effective length of query: 283
Effective length of database: 683
Effective search space:   193289
Effective search space used:   193289
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information