MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-389K08
Chromosome	7 (Build37)
Map Location	14,895,483 - 14,896,014
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Lig1, Pla2g4c, LOC666225, Cabp5, LOC666232, Gm767, LOC666243, 9230107M04Rik, EG666256, LOC666267, LOC100042624, LOC100043194, Sult2a1, EG620627, EG434121, EG629203, LOC677512, EG629219
Downstream gene	EG434123, 2810007J24Rik, EG638251, B430211C08Rik, EG194588, LOC666352, EG666312, LOC666365, LOC671978, LOC100042677, LOC100042685, EG666381, LOC100042691, LOC100042702, LOC100042707, LOC100042711, LOC100042714, LOC100042717, LOC100042721, LOC100042728, LOC100042731, LOC100042735, LOC100042739, LOC100042742, LOC235841, EG666407, LOC666337
Link	Open Mouse BAC browser

Click to get alignment info.

name	Lig1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16881 MGI:101789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pla2g4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:232889 MGI:1196403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666225 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666225
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cabp5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29865 MGI:1352746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666232 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins pseudo : _no_value

name	Gm767 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330470 MGI:2685613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 2 Proteins pseudo : _no_value

name	9230107M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77684 MGI:1924934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666256 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666256 MGI:3645416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 3 Proteins pseudo : _no_value

name	LOC666267 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666267
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042624 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100043194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 4 Proteins

name	Sult2a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20859 MGI:98430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG620627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620627 MGI:3645687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG434121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434121 MGI:3645854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 14 Proteins

name	EG629203 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629203 MGI:3645873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins

name	LOC677512 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677512
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG629219 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629219 MGI:3648915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434123 MGI:3645855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	2810007J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76971 MGI:1924221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG638251 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:638251 MGI:3645246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	B430211C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627280 MGI:3612342
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG194588 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194588 MGI:3646231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666352 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666352
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666312 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 8 Proteins

name	LOC666365 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	LOC671978 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC100042677 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	EG666381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666381 MGI:3643193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins

name	LOC100042691 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100042702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042707 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042711 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042714 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042717 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042731 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC100042742 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC235841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:235841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG666407 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666407 MGI:3645947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins

name	LOC666337 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 9 ESTs, 7 Proteins

name	Lig1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892265 GeneID:16881 MGI:101789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligase I, DNA, ATP-dependent transcript_id : NM_010715.2

name	Lig1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892806 GeneID:16881 MGI:101789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ligase I, DNA, ATP-dependent transcript_id : NM_001083188.1

name	Pla2g4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345222 GeneID:232889 MGI:1196403
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phospholipase A2, group IVC (cytosolic, calcium-independent) transcript_id : NM_001004762.2

name	Cabp5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802239 GeneID:29865 MGI:1352746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium binding protein 5 transcript_id : NM_013877.3

name	Gm767 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363657 GeneID:330470 MGI:2685613
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 767, (NCBI) transcript_id : NM_001033418.2

name	9230107M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371706 GeneID:77684 MGI:1924934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9230107M04 gene transcript_id : NM_001080942.2

name	LOC100043194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256466 GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 3 Proteins product : similar to androgen-repressible liver protein SMP-2, transcript variant 3 transcript_id : XM_001479814.1

name	LOC100043194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256464 GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to androgen-repressible liver protein SMP-2, transcript variant 1 transcript_id : XM_001479804.1

name	LOC100043194 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256468 GeneID:100043194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : similar to androgen-repressible liver protein SMP-2, transcript variant 2 transcript_id : XM_001479810.1

name	Sult2a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256075 GeneID:20859 MGI:98430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 transcript_id : XM_001471625.1

name	EG620627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82915970 GeneID:620627 MGI:3645687
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG620627 transcript_id : XM_885022.1

name	EG434121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379450 GeneID:434121 MGI:3645854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 14 Proteins product : predicted gene, EG434121 transcript_id : XM_485863.4

name	EG629203 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256471 GeneID:629203 MGI:3645873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 16 Proteins product : predicted gene, EG629203 transcript_id : XM_894052.3

name	EG629219 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486756 GeneID:629219 MGI:3648915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG629219 transcript_id : NM_001081325.1

name	EG434123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379459 GeneID:434123 MGI:3645855
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : predicted gene, EG434123 transcript_id : XM_485865.4

name	2810007J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801867 GeneID:76971 MGI:1924221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810007J24 gene transcript_id : NM_175250.4

name	EG638251 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256189 GeneID:638251 MGI:3645246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG638251 transcript_id : XM_983034.2

name	B430211C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702339 GeneID:627280 MGI:3612342
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B430211C08 gene transcript_id : NM_001039146.1

name	EG194588 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579822 GeneID:194588 MGI:3646231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG194588 transcript_id : NM_001038676.1

name	EG666312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379457 GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 8 Proteins product : predicted gene, EG666312, transcript variant 2 transcript_id : XM_986100.1

name	EG666312 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256477 GeneID:666312 MGI:3647077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 4 ESTs, 8 Proteins product : predicted gene, EG666312, transcript variant 1 transcript_id : XM_986068.2

name	LOC671978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256195 GeneID:671978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : similar to G protein-binding protein CRFG transcript_id : XM_001478621.1

name	LOC100042677 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256197 GeneID:100042677
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to OBOX4 transcript_id : XM_001478628.1

name	EG666381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256485 GeneID:666381 MGI:3643193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : predicted gene, EG666381 transcript_id : XM_983494.2

name	LOC100042691 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256212 GeneID:100042691
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to OBOX4 transcript_id : XM_001478641.1

name	LOC100042702 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256220 GeneID:100042702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478649.1

name	LOC100042707 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256228 GeneID:100042707
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478653.1

name	LOC100042711 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256230 GeneID:100042711
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478659.1

name	LOC100042714 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256232 GeneID:100042714
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478665.1

name	LOC100042717 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256234 GeneID:100042717
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478673.1

name	LOC100042721 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256236 GeneID:100042721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478688.1

name	LOC100042728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256244 GeneID:100042728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478696.1

name	LOC100042731 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256246 GeneID:100042731
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478707.1

name	LOC100042735 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256248 GeneID:100042735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478714.1

name	LOC100042739 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256250 GeneID:100042739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478722.1

name	LOC100042742 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256252 GeneID:100042742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478731.1

name	LOC235841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256254 GeneID:235841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 transcript_id : XM_001478739.1

name	EG666407 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94379475 GeneID:666407 MGI:3645947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 6 Proteins product : predicted gene, EG666407 transcript_id : XM_983633.1

name	LOC666337 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94379466 GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 7 Proteins product : similar to OBOX3, transcript variant 2 transcript_id : XM_986171.1

name	LOC666337 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256492 GeneID:666337
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 7 Proteins product : similar to OBOX3, transcript variant 1 transcript_id : XM_986137.2

name	Lig1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892807 GeneID:16881 MGI:101789
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003910 - DNA ligase (ATP) activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ligase I, DNA, ATP-dependent protein_id : NP_001076657.1

name	Lig1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892266 GeneID:16881 MGI:101789
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003910 - DNA ligase (ATP) activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IMP]; GO:0006260 - DNA replication [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ligase I, DNA, ATP-dependent protein_id : NP_034845.2

name	Pla2g4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52317152 GeneID:232889 MGI:1196403
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004620 - phospholipase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0009395 - phospholipid catabolism [Evidence IEA] codon_start : 1 note : CPLA2-gamma; egg and early embryo abundant protein product : phospholipase A2, group IVC (cytosolic, calcium-independent) protein_id : NP_001004762.1

name	Cabp5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304943 CCDS:CCDS20831.1 GeneID:29865 MGI:1352746
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : calcium binding protein 5 protein_id : NP_038905.1

name	Gm767 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701923 CCDS:CCDS20832.1 GeneID:330470 MGI:2685613
definition	codon_start : 1 product : bovine seminal plasma protein-like 1 protein_id : NP_001028590.1

name	9230107M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124301182 GeneID:77684 MGI:1924934
definition	codon_start : 1 product : bovine seminal plasma protein-like 2 protein_id : NP_001074411.1

name	LOC100043194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256467 GeneID:100043194
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 isoform 3 protein_id : XP_001479864.1

name	LOC100043194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256465 GeneID:100043194
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 isoform 1 protein_id : XP_001479854.1

name	LOC100043194 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256469 GeneID:100043194
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 isoform 2 protein_id : XP_001479860.1

name	Sult2a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256076 GeneID:20859 MGI:98430
definition	codon_start : 1 product : sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 protein_id : XP_001471675.1

name	EG620627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82915971 GeneID:620627 MGI:3645687
definition	codon_start : 1 product : similar to sulfotransferase:ISOTYPE=a1 protein_id : XP_890115.1

name	EG434121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256470 GeneID:434121 MGI:3645854
definition	codon_start : 1 product : similar to androgen-repressible liver protein SMP-2 protein_id : XP_485863.4

name	EG629203 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256472 GeneID:629203 MGI:3645873
definition	codon_start : 1 product : similar to sulfotransferase:ISOTYPE=a1 protein_id : XP_899145.3

name	EG629219 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486757 GeneID:629219 MGI:3648915
definition	GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA] codon_start : 1 product : predicted gene, EG629219 protein_id : NP_001074794.1

name	EG434123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762917 GeneID:434123 MGI:3645855
definition	codon_start : 1 product : similar to Hoxb-4 homeodomain protein protein_id : XP_485865.1

name	2810007J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202011 CCDS:CCDS20833.1 GeneID:76971 MGI:1924221
definition	GO_function : GO:0004027 - alcohol sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC76971 protein_id : NP_780459.1

name	EG638251 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256190 GeneID:638251 MGI:3645246
definition	codon_start : 1 product : similar to sulfotransferase:ISOTYPE=a1 protein_id : XP_988128.2

name	B430211C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702340 GeneID:627280 MGI:3612342
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC627280 protein_id : NP_001034235.1

name	EG194588 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579823 GeneID:194588 MGI:3646231
definition	codon_start : 1 product : hypothetical protein LOC194588 protein_id : NP_001033765.1

name	EG666312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379456 GeneID:666312 MGI:3647077
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_991162.1

name	EG666312 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379458 GeneID:666312 MGI:3647077
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_991194.1

name	LOC671978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256196 GeneID:671978
definition	codon_start : 1 product : similar to G protein-binding protein CRFG protein_id : XP_001478671.1

name	LOC100042677 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256198 GeneID:100042677
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478678.1

name	EG666381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256486 GeneID:666381 MGI:3643193
definition	codon_start : 1 product : similar to OBOX3 protein_id : XP_988588.2

name	LOC100042691 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256213 GeneID:100042691
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478691.1

name	LOC100042702 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256221 GeneID:100042702
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478699.1

name	LOC100042707 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256229 GeneID:100042707
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478703.1

name	LOC100042711 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256231 GeneID:100042711
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478709.1

name	LOC100042714 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256233 GeneID:100042714
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478715.1

name	LOC100042717 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256235 GeneID:100042717
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478723.1

name	LOC100042721 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256237 GeneID:100042721
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478738.1

name	LOC100042728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256245 GeneID:100042728
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478746.1

name	LOC100042731 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256247 GeneID:100042731
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478757.1

name	LOC100042735 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256249 GeneID:100042735
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478764.1

name	LOC100042739 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256251 GeneID:100042739
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478772.1

name	LOC100042742 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256253 GeneID:100042742
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478781.1

name	LOC235841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256255 GeneID:235841
definition	codon_start : 1 product : similar to OBOX4 protein_id : XP_001478789.1

name	EG666407 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94379476 GeneID:666407 MGI:3645947
definition	codon_start : 1 product : similar to p116Rip protein_id : XP_988727.1

name	LOC666337 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94379465 GeneID:666337
definition	codon_start : 1 product : similar to OBOX3 isoform 1 protein_id : XP_991231.1

name	LOC666337 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94379467 GeneID:666337
definition	codon_start : 1 product : similar to OBOX3 isoform 2 protein_id : XP_991265.1

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 1 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 2 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 3 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 4 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 5 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 6 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 7 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 8 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 9 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 10 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 11 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 12 pseudo : _no_value

name	LOC666225 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666225
definition	number : 13 pseudo : _no_value

name	LOC666267 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666267
definition	number : 1 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 5 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 4 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 3 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 2 pseudo : _no_value

name	LOC100042624 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042624
definition	number : 1 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 4 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 3 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 2 pseudo : _no_value

name	LOC677512 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:677512
definition	number : 1 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 3 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 2 pseudo : _no_value

name	LOC666352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666352
definition	number : 1 pseudo : _no_value

name	LOC666232 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256172 GeneID:666232
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 10 Proteins product : similar to Ac1158 pseudo : _no_value transcript_id : XR_033713.1

name	LOC666243 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256462 GeneID:666243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 2 Proteins product : similar to hCG1787519 pseudo : _no_value transcript_id : XR_034390.1

name	EG666256 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149256173 GeneID:666256 MGI:3645416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 3 Proteins product : predicted gene, EG666256 pseudo : _no_value transcript_id : XR_033718.1

name	LOC666365 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256478 GeneID:666365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to oocyte specific homeobox 3 pseudo : _no_value transcript_id : XR_034428.1

name	LOC100042685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149256205 GeneID:100042685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to OBOX4 pseudo : _no_value transcript_id : XR_033800.1

clone name	MSMg01-389D15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-085M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056A18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079J07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-265B16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469C23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521A20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-072M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-206B24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052N23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-301D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-112N21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-182B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-389K08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-345K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060K08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544I06
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-208K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005N02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-389K08.T7 (MSMg01no389_k08.b1)	MSMg01-389K08.TJ (MSMg01no389_k08.g1)
ACC	AG491851	AG491852
length	746	751
length of high quality (start - end)	217 (105 - 321)	542 (80 - 621)
definition	CHROMAT_FILE: MSMg01no389_k08.b1 PHD_FILE: MSMg01no389_k08.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:33:19 2005	CHROMAT_FILE: MSMg01no389_k08.g1 PHD_FILE: MSMg01no389_k08.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 23:33:19 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	GGGGTTCTTATAATTTGNGGGCGCTAAACGACTCCTATATTCAGACCATC CGCGGAATTCCAGAATTTTTCAACTCCACTGACCTGCACTGCACTCACTT CACTGACACTCAGCTAAGCAACTCAATTCTCAACTCACTCACCTGCCCCT CTCTACTATACTCTCAAGTAGCTGTTCTCCTGAGAGTTTGGAACATCCTG TCATTCTGTCAAATCTTTTTGTAATTGATCACTTTGTCTGCCCTTCAATT AGATCCCATTGTTTGCAATTAAAGGTGTATACTAAAGTGTTGTACCTCAC ACTTTAGCAAGGCTGTAGCCTAATTTGTCCAGACAGCTTTTCTAAGCTCA GGATCAAATGGAGAATTATTATTCTTGTCAAGGCTCAATCTTTTCTATCT GATCTAGGGAGTCCAAGAGCCAATTTACAACCCAAAAAAATGTAATAAAA TCCCGCTGGCCCAATCATTCTGAACTTTGTTTCACCTTTTTCCACCTGCC GTGAATTAGTTCACACACCTCCCACCACAATAATACCCTACTACCACCCA CATGTGCCCCATCCCCCTCTGCATGCTAAACACCACCATCATGATACCCT ACGGGAACAACCCCATCACCCACTTACTCTAACGATTCCCCCCTATCCCC CTTACTCACTTGCGTCCACCTCACCACCCTCCCCCCACATCCCTCACTTT CCCACCTCCTTGGCCTCCCGCCTCTCACACCCTTCGTCCCCCCTCC	NNNCCCGATGATAGTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXACCCCTAACTTGGAGCACTGG AATCTGTTCTTTGCAAACAATGTTATCATTTAGAAAGATGTGCACTACCT ATGTTCTGTCTGTTAAAAAAACCTATCCACCTATAGAAAGTCACCTTGAC AAAACAGTTCTGGTTTGATCAGTCATTCTTTAGTATGTATGCAAGGTGGA TCCTGGCTGAGCCAACATTGCACTGTGGATACGTATCTGTGTTTACGAGC TATTAGACAGAAGGCACTGTACATATGATTGTTGCTTTCAAGCAATATTT GCAAAACATGCAAACTTCTGTATCTGGAAAAATAAAACCAGTTTCTTGTT AAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAATAAAAT ATTTTGAGTTAATGTCCATTACTTTTTATGGTACACTCTTTATGTTTTGT TTTGTTTTGTTTTGTTTTTTTTTAAACTTGCTACAGGATGCATGTGGAGG TCAGAGCACTTTTTTCAGGACTTGGATCCTCCTTCCATCATACTGTTTCT GGGGACTAAGCTCGTATCATCAGGCTTGGCCCCCAGAAACCCCACCCATT AATAAATCTGGTGGGTCTGTTTTTTTAAATTTCCCCAAAACATTTTCTTG TCACCATGGCAAAAAGACTAATTTTTCACACGGGCTATATACAAATAAAA G
quality values	Open. Hide. 7 7 7 7 6 6 8 8 9 9 8 9 9 9 9 13 3 0 3 11 8 8 8 9 15 9 8 8 10 10 10 7 7 8 8 17 23 9 9 9 10 10 6 6 6 6 8 8 10 14 12 12 12 15 10 13 17 19 8 8 11 19 19 23 13 11 10 10 8 8 8 8 8 10 17 14 13 12 12 16 24 30 26 24 30 28 34 34 33 30 30 22 22 19 19 19 18 22 29 29 20 20 20 16 23 26 23 29 29 29 28 22 22 28 32 42 42 42 42 42 42 41 43 43 43 47 42 43 39 39 39 39 39 42 42 47 41 26 27 12 12 12 32 41 59 59 59 68 57 57 48 48 47 47 47 48 48 57 48 48 37 35 28 30 28 35 35 43 44 48 43 32 32 32 32 35 43 43 48 52 38 43 32 43 43 57 57 59 59 59 57 43 44 43 52 52 57 50 59 44 44 32 35 24 38 27 27 13 38 18 23 23 44 44 57 57 57 59 59 57 52 52 57 57 57 57 57 57 57 52 52 52 57 57 57 43 57 35 43 39 45 57 52 43 43 39 43 43 43 44 31 44 44 38 28 43 29 29 22 38 38 52 52 57 57 57 57 57 57 52 52 52 43 44 44 29 29 33 44 44 44 43 43 29 29 29 33 33 44 43 52 52 52 52 59 44 59 35 35 32 35 35 43 27 34 32 12 12 12 32 32 50 43 43 33 41 41 20 15 18 12 12 18 27 34 18 20 18 24 12 13 15 30 30 38 30 21 21 30 35 48 35 27 27 24 24 11 15 24 11 11 12 24 32 25 22 22 12 17 11 11 11 12 11 23 23 30 30 23 23 36 30 36 23 18 18 26 26 18 18 13 16 10 10 10 9 11 12 25 21 32 32 37 36 36 39 37 37 30 28 28 34 34 28 21 13 13 30 26 35 21 16 11 11 9 9 13 15 15 18 22 31 28 28 28 34 34 23 23 23 23 23 12 11 11 24 25 17 19 19 15 12 12 26 25 32 15 15 11 11 12 21 11 12 14 22 16 13 12 11 12 12 9 9 12 28 24 28 33 28 23 23 13 13 10 10 10 11 11 11 11 11 11 13 13 13 15 20 23 23 19 16 9 9 9 12 12 12 11 13 15 9 9 11 10 11 16 9 9 9 9 8 8 8 8 8 10 10 9 11 10 12 9 8 8 9 10 8 10 9 10 8 10 8 8 10 15 11 10 9 11 9 6 6 8 8 8 9 10 9 9 10 10 8 8 8 8 8 10 8 10 10 17 12 11 11 11 11 8 8 8 8 8 8 8 8 8 8 9 10 9 10 9 9 8 9 9 9 10 9 10 10 16 20 13 13 10 12 10 10 10 11 11 11 8 8 8 8 8 8 15 12 12 10 10 10 11 11 11 11 11 9 8 8 8 6 8 6 6 8 6 6 8 8 8 8 13 23 17 12 11 11 8 6 6 6 6 9 12 14 19 16 10 9 8 8 6 6 10 7 10 10 10 11 11 13 10 10 9 10 10 9 9 9 9 9 8 19 8 8 8 12 13 10 9 8 8 7 7 9 9 19 11 10 8 8 8 16 13 14 17 10 10 7 7 8 8 13 16 16 12 10 8 8 10 10 8 7 6 6 8 10 10 9 8 6 6 6 8 8 21 12 11 11 9 9 9 9 10 11 16 17 14 18 15 15	Open. Hide. 0 0 0 3 6 6 7 8 10 10 9 9 9 8 15 22 15 17 15 31 26 39 31 30 30 30 30 39 44 39 39 33 33 36 25 19 10 9 9 8 7 7 7 6 7 8 22 17 24 15 24 28 27 12 12 11 26 26 50 50 50 47 41 27 21 8 6 6 6 6 8 12 11 9 9 12 12 15 15 15 27 30 59 59 59 59 59 59 57 57 53 53 53 53 50 53 50 43 57 47 47 47 47 47 47 68 68 68 68 68 68 68 68 68 68 50 51 50 50 50 51 68 68 68 68 68 68 68 68 57 57 47 59 59 68 48 51 50 50 50 50 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 54 54 57 59 59 59 52 59 59 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 32 32 14 14 14 30 32 47 57 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 50 50 41 41 28 25 15 12 12 13 12 12 12 20 16 23 32 26 37 39 50 50 53 53 57 57 57 59 59 59 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 59 59 47 48 48 48 48 48 48 59 59 57 57 59 59 68 68 68 68 68 57 57 57 57 57 57 54 54 54 59 59 59 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 54 54 57 54 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 59 68 68 68 68 68 68 68 59 59 54 54 54 59 59 57 59 59 59 59 68 59 59 59 59 59 59 59 48 48 48 59 59 48 48 48 43 37 30 30 30 34 34 41 47 47 59 59 59 59 44 44 37 32 32 37 37 37 41 46 46 39 39 30 30 30 39 43 46 46 47 47 47 41 41 32 39 39 41 37 34 28 18 18 13 18 18 34 34 48 41 59 59 34 28 19 18 20 26 28 28 23 23 15 15 10 12 10 14 27 24 31 38 32 30 25 28 22 25 25 28 23 20 25 14 14 14 30 28 35 26 30 26 28 22 28 17 15 10 10 10 16 26 25 28 26 28 18 19 17 22 16 15 15 13 10 8 8 8 8 8 17 10 8 8 8 10 24 27 28 24 25 13 12 13 17 18 12 14 11 14 15 15 16 14 14 22 22 19 13 11 8 8 8 8 8 10 10 10 10 14 14 14 11 12 10 10 10 10 15 21 12 14 10 9 9 9 9 10 10 9 13 12 13 13 11 11 11 14 9 8 8 10 8 8 8 8 8 8 8 10 21 25 15 8 8 8 8 8 10 11 20 21 8 8 8 8 8 8 6 6 8 8 7 6 6 8 8 8 8 6 8 8 8 8 9 9 9 11 9 9

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no389_k08.g1 MSMg01no389_k08.g1 CHROMAT_FILE:
MSMg01no389_k08.g1 PHD_FILE: MSMg01no389_k08.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 23:33:19 2005
         (542 letters)



>mm_chr7_14895283_14896224
          Length = 942

 Score =  963 bits (498), Expect = 0.0
 Identities = 527/542 (97%), Gaps = 10/542 (1%)
 Strand = Plus / Plus

                                                                       
Query: 1   acccctaacttggagcactggaatctgttctttgcaaacaatgttatcatttagaaagat 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 acccctaacttggagcactggaatctgttctttgcaaacaatgttatcatttagaaagat 260

                                                                       
Query: 61  gtgcactacctatgttctgtctgttaaaaaaacctatccacctatagaaagtcaccttga 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gtgcactacctatgttctgtctgttaaaaaaacctatccacctatagaaagtcaccttga 320

                                                                       
Query: 121 caaaacagttctggtttgatcagtcattctttagtatgtatgcaaggtggatcctggctg 180
           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 321 caaaacagttctggtttgatcagtcattctttactatgtatgcaaggtggatcctggctg 380

                                                                       
Query: 181 agccaacattgcactgtggatacgtatctgtgtttacgagctattagacagaaggcactg 240
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 381 agccaacattgcactgtggatgcgtatctgtgtttacgagctattagacagaaggcactg 440

                                                                       
Query: 241 tacatatgattgttgctttcaagcaatatttgcaaaacatgcaaacttctgtatctggaa 300
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 441 tacatatgagtgttgctttcaagcaatatttgcaaaacatgcaaacttctgtatctggaa 500

                                                                       
Query: 301 aaataaaaccagtttcttgttaaaataaataaataaataaataaataaataaataaataa 360
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 501 aaataaaaccagtttcttgttaaaataaataaataaataaataaataaataaataaataa 560

                                                                       
Query: 361 ataaataaaatattttgagttaatgtccattactttttatggtacactctttatgttttg 420
           |        ||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 561 a--------atattttgagtgaatgtccattactttttatggtacactctttatgttttg 612

                                                                       
Query: 421 ttttgttttgttttgtttttttttaaacttgctacaggatgcatgtggaggtcagagcac 480
           ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||
Sbjct: 613 ttttgttttgttttgttttttt--aaacttgctacaggatgcatgtggaggtcagagcac 670

                                                                       
Query: 481 ttttttcaggacttggatcctccttccatcatactgtttctggggactaagctcgtatca 540
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 671 ttttttcaggactcggatcctccttccatcatactgtttctggggactaagctcgtatca 730

             
Query: 541 tc 542
           ||
Sbjct: 731 tc 732


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 44
Number of extensions: 8
Number of successful extensions: 8
Number of sequences better than 10.0: 1
Number of HSP's gapped: 3
Number of HSP's successfully gapped: 1
Length of query: 542
Length of database: 942
Length adjustment: 10
Effective length of query: 532
Effective length of database: 932
Effective search space:   495824
Effective search space used:   495824
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information