MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-397E11
Chromosome	7 (Build37)
Map Location	148,629,762 - 148,629,977
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Olfr533, Olfr534-ps1, Olfr535, Olfr536, Olfr537-ps1, Olfr1523-ps1, Olfr538, Olfr1553-ps1, Olfr46, Olfr61, Olfr53, Olfr539, GA_x5J8B7W3EKE-4574231-4574913, Olfr45, Olfr541, GA_x5J8B7W3EKE-4522784-4521912, Cyp2e1, Syce1, LOC100043529, BC066028, 1190003J15Rik, Scgb1c1, Odf3, Bet1l, Ric8, Sirt3, Psmd13, LOC100043546, Cox8b, Nlrp6, Athl1, Ifitm5, Ifitm2, Ifitm1, LOC665143, Ifitm3, Ifitm6, B4galnt4, Pkp3, Sigirr, Trp53i5, Ptdss2, Rnh1, LOC546015, Hras1, Lrrc56, 1600016N20Rik, Rassf7, AA673488, Irf7, Mucdhl, Sct, Drd4, Deaf1, Tmem80, Eps8l2, B230206H07Rik, Taldo1, LOC100043585, Pddc1, Cend1, Slc25a22, Lrdd
Downstream gene	Rplp2, Pnpla2, Efcab4a, Cd151, Polr2l, Tspan4, Chid1, Ap2a2, Muc6, LOC100039649, Muc2, Muc5ac, Muc5b, Tollip, EG623757, Brsk2, 2700078K21Rik, Dusp8, LOC100039728, EG668763, LOC100043616, EG665295, LOC100043617, Krtap5-2, LOC100039757, LOC100039767, EG665305, Krtap5-5, EG640223, LOC672428, LOC100039800, LOC100043627, LOC100043629, ENSMUSG00000038442, Krtap5-1, Krtap5-4, LOC270015, 6330512M04Rik, Ctsd, Syt8, Tnni2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr533 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258056 MGI:3030367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr534-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404402 MGI:3030368
definition	note : olfactory receptor 534, pseudogene 1 pseudo : _no_value

name	Olfr535 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258956 MGI:3030369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr536 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258513 MGI:3030370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr537-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258200 MGI:3030371
definition	gene_synonym : MOR253-11P note : olfactory receptor 537, pseudogene 1 pseudo : _no_value

name	Olfr1523-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258174 MGI:3031357
definition	gene_synonym : MOR253-12P note : olfactory receptor 1523, pseudogene 1 pseudo : _no_value

name	Olfr538 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258201 MGI:3030372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1553-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257965 MGI:3031387
definition	gene_synonym : MOR253-13P note : olfactory receptor 1553, pseudogene 1 pseudo : _no_value

name	Olfr46 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18345 MGI:1333824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18362 MGI:1333885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr53 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258962 MGI:1333749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr539 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258963 MGI:3030373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3EKE-4574231-4574913 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257844
definition	note : olfactory receptor GA_x5J8B7W3EKE-4574231-4574913 pseudo : _no_value

name	Olfr45 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18344 MGI:1333826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr541 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258964 MGI:3030375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W3EKE-4522784-4521912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257845
definition	note : olfactory receptor GA_x5J8B7W3EKE-4522784-4521912 pseudo : _no_value

name	Cyp2e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13106 MGI:88607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syce1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74075 MGI:1921325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 4 Proteins

name	LOC100043529 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	BC066028 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407812 MGI:3039601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1190003J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76974 MGI:1916142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scgb1c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338417 MGI:2655401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 2 Proteins

name	Odf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69287 MGI:1916537
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bet1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54399 MGI:1913128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ric8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101489 MGI:2141866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sirt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64384 MGI:1927665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23997 MGI:1345192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043546 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 574 ESTs, 8 Proteins

name	Cox8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12869 MGI:105958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrp6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101613 MGI:2141990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Athl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212974 MGI:2444047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifitm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73835 MGI:1934923
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifitm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80876 MGI:1933382
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifitm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68713 MGI:1915963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665143 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 5 Proteins pseudo : _no_value

name	Ifitm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66141 MGI:1913391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifitm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213002 MGI:2686976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B4galnt4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330671 MGI:2652891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56460 MGI:1891830
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sigirr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24058 MGI:1344402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trp53i5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71345 MGI:1918595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptdss2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27388 MGI:1351664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107702 MGI:1195456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546015 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1252 ESTs, 9 Proteins pseudo : _no_value

name	Hras1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15461 MGI:96224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70552 MGI:1917802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600016N20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72000 MGI:1919250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rassf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66985 MGI:1914235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA673488 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101471 MGI:2141847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54123 MGI:1859212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mucdhl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72040 MGI:1919290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sct (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20287 MGI:99466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Drd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13491 MGI:94926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Deaf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54006 MGI:1858496
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem80 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71448 MGI:1918698
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eps8l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:98845 MGI:2138828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230206H07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320871 MGI:2444929
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taldo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21351 MGI:1274789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043585 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 77 ESTs, 1 Protein

name	Pddc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213350 MGI:2387178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cend1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57754 MGI:1929898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68267 MGI:1915517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrdd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57913 MGI:1889507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rplp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67186 MGI:1914436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpla2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66853 MGI:1914103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcab4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213573 MGI:2446129
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd151 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12476 MGI:1096360
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66491 MGI:1913741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 141 ESTs, 5 Proteins

name	Tspan4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64540 MGI:1928097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chid1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68038 MGI:1915288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11772 MGI:101920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Muc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353328 MGI:2663233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039649 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins

name	Muc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17831 MGI:1339364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Muc5ac (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17833 MGI:104697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Muc5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74180 MGI:1921430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tollip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54473 MGI:1891808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623757 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623757 MGI:3647668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Brsk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75770 MGI:1923020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	2700078K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101513 MGI:1919891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18218 MGI:106626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039728 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	EG668763 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668763 MGI:3645383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 18 Proteins

name	LOC100043616 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	EG665295 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665295 MGI:3648174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100043617 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins

name	Krtap5-2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71623 MGI:1918873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100039767 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG665305 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665305 MGI:3647476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	Krtap5-5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114666 MGI:2149673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG640223 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:640223 MGI:3647126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC672428 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039800 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins pseudo : _no_value

name	LOC100043627 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100043629 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	ENSMUSG00000038442 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436015 MGI:3642866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	Krtap5-1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50774 MGI:1354732
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Krtap5-4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50775 MGI:1354758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC270015 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:270015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 7 Proteins pseudo : _no_value

name	6330512M04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320802 MGI:2444776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctsd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13033 MGI:88562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syt8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55925 MGI:1859867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnni2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21953 MGI:105070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr533 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801395 GeneID:258056 MGI:3030367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 533 transcript_id : NM_001011815.1

name	Olfr535 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129008 GeneID:258956 MGI:3030369
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 535 transcript_id : NM_146954.1

name	Olfr536 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254193 GeneID:258513 MGI:3030370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 536 transcript_id : NM_146520.2

name	Olfr538 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801487 GeneID:258201 MGI:3030372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 538 transcript_id : NM_001011867.1

name	Olfr46 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203806 GeneID:18345 MGI:1333824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 46 transcript_id : NM_146934.1

name	Olfr61 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203810 GeneID:18362 MGI:1333885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 61 transcript_id : NM_146964.1

name	Olfr53 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129006 GeneID:258962 MGI:1333749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 53 transcript_id : NM_146960.1

name	Olfr539 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129000 GeneID:258963 MGI:3030373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 539 transcript_id : NM_146961.1

name	Olfr45 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22203816 GeneID:18344 MGI:1333826
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 45 transcript_id : NM_146963.1

name	Olfr541 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129002 GeneID:258964 MGI:3030375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 541 transcript_id : NM_146962.1

name	Cyp2e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57634519 GeneID:13106 MGI:88607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 2, subfamily e, polypeptide 1 transcript_id : NM_021282.2

name	Syce1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258253 GeneID:74075 MGI:1921325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 4 Proteins product : synaptonemal complex central element protein 1 transcript_id : XM_001472886.1

name	BC066028 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383654 GeneID:407812 MGI:3039601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC066028 transcript_id : NM_001001180.2

name	1190003J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347753 GeneID:76974 MGI:1916142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190003J15 gene transcript_id : NM_029821.2

name	Scgb1c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258264 GeneID:338417 MGI:2655401
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs, 2 Proteins product : secretoglobin, family 1C, member 1 transcript_id : XM_001480591.1

name	Odf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353814 GeneID:69287 MGI:1916537
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : outer dense fiber of sperm tails 3 transcript_id : NM_027019.2

name	Bet1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344115 GeneID:54399 MGI:1913128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : blocked early in transport 1 homolog (S. cerevisiae)-like transcript_id : NM_018742.4

name	Ric8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131149 GeneID:101489 MGI:2141866
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : resistance to inhibitors of cholinesterase 8 homolog (C. elegans) transcript_id : NM_053194.4

name	Sirt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11967962 GeneID:64384 MGI:1927665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S. cerevisiae) transcript_id : NM_022433.1

name	Psmd13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366730 GeneID:23997 MGI:1345192
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 transcript_id : NM_011875.3

name	LOC100043546 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258266 GeneID:100043546
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 574 ESTs, 8 Proteins product : similar to DnaJ-like protein transcript_id : XM_001480612.1

name	Cox8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83921592 GeneID:12869 MGI:105958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase, subunit VIIIb transcript_id : NM_007751.2

name	Nlrp6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487066 GeneID:101613 MGI:2141990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family, pyrin domain containing 6 transcript_id : NM_001081389.1

name	Athl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349537 GeneID:212974 MGI:2444047
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATH1, acid trehalase-like 1 (yeast) transcript_id : NM_145387.3

name	Ifitm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625835 GeneID:73835 MGI:1934923
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon induced transmembrane protein 5 transcript_id : NM_053088.2

name	Ifitm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507625 GeneID:80876 MGI:1933382
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon induced transmembrane protein 2 transcript_id : NM_030694.1

name	Ifitm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254488 GeneID:68713 MGI:1915963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon induced transmembrane protein 1 transcript_id : NM_026820.2

name	Ifitm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365531 GeneID:66141 MGI:1913391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon induced transmembrane protein 3 transcript_id : NM_025378.2

name	Ifitm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75812951 GeneID:213002 MGI:2686976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon induced transmembrane protein 6 transcript_id : NM_001033632.1

name	B4galnt4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58372115 GeneID:330671 MGI:2652891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-1,4-N-acetyl-galactosaminyl transferase 4 transcript_id : NM_177897.3

name	Pkp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790162 GeneID:56460 MGI:1891830
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plakophilin 3 transcript_id : NM_019762.1

name	Sigirr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374281 GeneID:24058 MGI:1344402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single immunoglobulin and toll-interleukin 1 receptor (TIR) domain transcript_id : NM_023059.3

name	Trp53i5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341630 GeneID:71345 MGI:1918595
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transformation related protein 53 inducible protein 5 transcript_id : NM_178381.2

name	Ptdss2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350119 GeneID:27388 MGI:1351664
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylserine synthase 2 transcript_id : NM_013782.3

name	Rnh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981747 GeneID:107702 MGI:1195456
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease/angiogenin inhibitor 1 transcript_id : NM_145135.2

name	Hras1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680270 GeneID:15461 MGI:96224
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Harvey rat sarcoma virus oncogene 1 transcript_id : NM_008284.1

name	Lrrc56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24418879 GeneID:70552 MGI:1917802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 56 transcript_id : NM_153777.1

name	1600016N20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931153 GeneID:72000 MGI:1919250
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1600016N20 gene transcript_id : NM_028050.1

name	Rassf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118403309 GeneID:66985 MGI:1914235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras association (RalGDS/AF-6) domain family 7 transcript_id : NM_025886.3

name	AA673488 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487442 GeneID:101471 MGI:2141847
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA673488 transcript_id : NM_001081118.1

name	Irf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130788 GeneID:54123 MGI:1859212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 7 transcript_id : NM_016850.2

name	Mucdhl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361587 GeneID:72040 MGI:1919290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin and cadherin like transcript_id : NM_028069.2

name	Sct (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755415 GeneID:20287 MGI:99466
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretin transcript_id : NM_011328.1

name	Drd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982851 GeneID:13491 MGI:94926
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dopamine receptor 4 transcript_id : NM_007878.2

name	Deaf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8393247 GeneID:54006 MGI:1858496
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deformed epidermal autoregulatory factor 1 (Drosophila) transcript_id : NM_016874.1

name	Tmem80 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801242 GeneID:71448 MGI:1918698
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 80 transcript_id : NM_027797.2

name	Eps8l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21040232 GeneID:98845 MGI:2138828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EPS8-like 2 transcript_id : NM_133191.2

name	B230206H07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802351 GeneID:320871 MGI:2444929
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230206H07 gene transcript_id : NM_177280.3

name	Taldo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802969 GeneID:21351 MGI:1274789
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transaldolase 1 transcript_id : NM_011528.2

name	LOC100043585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258271 GeneID:100043585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 41 ESTs, 1 Protein product : similar to Ran-interacting protein MOG1, transcript variant 2 transcript_id : XM_001480699.1

name	LOC100043585 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258269 GeneID:100043585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 55 ESTs, 1 Protein product : similar to Ran-interacting protein MOG1, transcript variant 1 transcript_id : XM_001480697.1

name	Pddc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802027 GeneID:213350 MGI:2387178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Parkinson disease 7 domain containing 1 transcript_id : NM_172116.3

name	Cend1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803245 GeneID:57754 MGI:1929898
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell cycle exit and neuronal differentiation 1 transcript_id : NM_021316.3

name	Slc25a22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384143 GeneID:68267 MGI:1915517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, glutamate), member 22 transcript_id : NM_026646.2

name	Lrdd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12083586 GeneID:57913 MGI:1889507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich and death domain containing transcript_id : NM_022654.1

name	Rplp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368803 GeneID:67186 MGI:1914436
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein, large P2 transcript_id : NM_026020.5

name	Pnpla2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351628 GeneID:66853 MGI:1914103
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patatin-like phospholipase domain containing 2 transcript_id : NM_025802.2

name	Efcab4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68534954 GeneID:213573 MGI:2446129
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand calcium binding domain 4A transcript_id : NM_001025103.1

name	Cd151 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387225 GeneID:12476 MGI:1096360
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD151 antigen transcript_id : NM_009842.2

name	Polr2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258256 GeneID:66491 MGI:1913741
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 141 ESTs, 5 Proteins product : polymerase (RNA) II (DNA directed) polypeptide L transcript_id : XM_888022.3

name	Tspan4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54020728 GeneID:64540 MGI:1928097
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 4 transcript_id : NM_053082.2

name	Chid1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352688 GeneID:68038 MGI:1915288
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chitinase domain containing 1 transcript_id : NM_026522.3

name	Ap2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254645 GeneID:11772 MGI:101920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-2, alpha 2 subunit transcript_id : NM_007459.2

name	Muc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32171191 GeneID:353328 MGI:2663233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 6, gastric transcript_id : NM_181729.1

name	LOC100039649 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258258 GeneID:100039649
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 3 Proteins product : similar to secreted gel-forming mucin transcript_id : XM_001473263.1

name	Muc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258274 GeneID:17831 MGI:1339364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : mucin 2 transcript_id : XM_975612.2

name	Muc5ac (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431223 GeneID:17833 MGI:104697
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 5, subtypes A and C, tracheobronchial/gastric transcript_id : NM_010844.1

name	Muc5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956225 GeneID:74180 MGI:1921430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucin 5, subtype B, tracheobronchial transcript_id : NM_028801.1

name	Tollip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359098 GeneID:54473 MGI:1891808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll interacting protein transcript_id : NM_023764.3

name	EG623757 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258276 GeneID:623757 MGI:3647668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG623757 transcript_id : XM_897940.3

name	Brsk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130600 GeneID:75770 MGI:1923020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BR serine/threonine kinase 2 transcript_id : NM_029426.2

name	Brsk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131128 GeneID:75770 MGI:1923020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BR serine/threonine kinase 2 transcript_id : NM_001009930.2

name	Brsk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131126 GeneID:75770 MGI:1923020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BR serine/threonine kinase 2 transcript_id : NM_001009929.2

name	2700078K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130484 GeneID:101513 MGI:1919891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700078K21 gene transcript_id : NM_028308.2

name	Dusp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388432 GeneID:18218 MGI:106626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 8 transcript_id : NM_008748.2

name	LOC100039728 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258278 GeneID:100039728
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to keratin associated protein 5-4 transcript_id : XM_001473390.1

name	EG668763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258300 GeneID:668763 MGI:3645383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG668763, transcript variant 1 transcript_id : XM_001004966.2

name	EG668763 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258298 GeneID:668763 MGI:3645383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 17 Proteins product : predicted gene, EG668763 transcript_id : XM_001480778.1

name	LOC100043616 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258301 GeneID:100043616
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to keratin associated protein 5-5 transcript_id : XM_001480779.1

name	EG665295 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258280 GeneID:665295 MGI:3648174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG665295 transcript_id : XM_975911.2

name	LOC100043617 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258303 GeneID:100043617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to keratin associated protein 5-4 transcript_id : XM_001480781.1

name	Krtap5-2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801685 GeneID:71623 MGI:1918873
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-2 transcript_id : NM_027844.2

name	LOC100039757 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258282 GeneID:100039757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to keratin associated protein 5-4 transcript_id : XM_001473448.1

name	LOC100039767 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258284 GeneID:100039767
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Y25C1A.3 transcript_id : XM_001473462.1

name	EG665305 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258286 GeneID:665305 MGI:3647476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : predicted gene, EG665305 transcript_id : XM_975981.2

name	Krtap5-5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83715995 GeneID:114666 MGI:2149673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-5 transcript_id : NM_001037822.1

name	EG640223 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258288 GeneID:640223 MGI:3647126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG640223 transcript_id : XM_924640.3

name	LOC100043627 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258305 GeneID:100043627
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : hypothetical protein LOC100043627 transcript_id : XM_001480790.1

name	ENSMUSG00000038442 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258290 GeneID:436015 MGI:3642866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, ENSMUSG00000038442 transcript_id : XM_001473558.1

name	Krtap5-1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657282 GeneID:50774 MGI:1354732
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-1 transcript_id : NM_015808.1

name	Krtap5-4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796632 GeneID:50775 MGI:1354758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : keratin associated protein 5-4 transcript_id : NM_015809.2

name	6330512M04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803140 GeneID:320802 MGI:2444776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330512M04 gene transcript_id : NM_177265.3

name	Ctsd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450788 GeneID:13033 MGI:88562
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathepsin D transcript_id : NM_009983.2

name	Syt8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348637 GeneID:55925 MGI:1859867
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin VIII transcript_id : NM_018802.3

name	Tnni2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130404 GeneID:21953 MGI:105070
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : troponin I, skeletal, fast 2 transcript_id : NM_009405.2

name	Olfr533 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801396 CCDS:CCDS21977.1 GeneID:258056 MGI:3030367
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42615403-42616365; olfactory receptor MOR252-3P product : olfactory receptor 533 protein_id : NP_001011815.1

name	Olfr535 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129009 CCDS:CCDS21978.1 GeneID:258956 MGI:3030369
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42641642-42642574; olfactory receptor MOR253-7 product : olfactory receptor 535 protein_id : NP_667165.1

name	Olfr536 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238970 CCDS:CCDS21979.1 GeneID:258513 MGI:3030370
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42653501-42652578; olfactory receptor MOR252-1 product : olfactory receptor 536 protein_id : NP_666731.1

name	Olfr538 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801488 CCDS:CCDS21980.1 GeneID:258201 MGI:3030372
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42723314-42724246; olfactory receptor MOR253-10P product : olfactory receptor 538 protein_id : NP_001011867.1

name	Olfr46 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203807 CCDS:CCDS21981.1 GeneID:18345 MGI:1333824
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-8; GA_x6K02T2PBJ9-42759973-42760905 product : olfactory receptor 46 protein_id : NP_667145.1

name	Olfr61 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203811 GeneID:18362 MGI:1333885
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-1; GA_x6K02T2PBJ9-42783826-42784758 product : olfactory receptor 61 protein_id : NP_667175.1

name	Olfr53 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129007 GeneID:258962 MGI:1333749
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-5; GA_x6K02T2PBJ9-42798103-42799038 product : olfactory receptor 53 protein_id : NP_667171.1

name	Olfr539 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129001 CCDS:CCDS21982.1 GeneID:258963 MGI:3030373
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42813436-42814368; olfactory receptor MOR253-4 product : olfactory receptor 539 protein_id : NP_667172.1

name	Olfr45 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22203817 CCDS:CCDS21983.1 GeneID:18344 MGI:1333826
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR253-2; GA_x6K02T2PBJ9-42837030-42837962 product : olfactory receptor 45 protein_id : NP_667174.1

name	Olfr541 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129003 CCDS:CCDS21984.1 GeneID:258964 MGI:3030375
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PBJ9-42850324-42851256; olfactory receptor MOR253-3 product : olfactory receptor 541 protein_id : NP_667173.1

name	Cyp2e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11276065 CCDS:CCDS21985.1 GeneID:13106 MGI:88607
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016712 - oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen [Evidence IEA]; GO:0050381 - unspecific monooxygenase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome P450, 2e1, ethanol inducible product : cytochrome P450, family 2, subfamily e, polypeptide 1 protein_id : NP_067257.1

name	Syce1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258254 GeneID:74075 MGI:1921325
definition	codon_start : 1 product : synaptonemal complex central element protein 1 protein_id : XP_001472936.1

name	BC066028 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:142383655 GeneID:407812 MGI:3039601
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC407812 protein_id : NP_001001180.2

name	1190003J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626070 CCDS:CCDS21986.1 GeneID:76974 MGI:1916142
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0005179 - hormone activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016918 - retinal binding [Evidence IEA]; GO:0019841 - retinol binding [Evidence IEA]; GO:0005496 - steroid binding [Evidence IEA] GO_process : GO:0006590 - thyroid hormone generation [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : HIU hydrolase protein_id : NP_084097.1

name	Scgb1c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258265 GeneID:338417 MGI:2655401
definition	codon_start : 1 product : similar to RYD5 protein_id : XP_001480641.1

name	Odf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16756270 GeneID:69287 MGI:1916537
definition	GO_component : GO:0001520 - outer dense fiber [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : shippo 1 protein_id : NP_081295.1

name	Bet1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542224 CCDS:CCDS21987.1 GeneID:54399 MGI:1913128
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005484 - SNAP receptor activity [Evidence IDA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : soluble N-ethylmaleimide-sensitive factor attachment protein (SNARE) 15; golgi SNARE product : golgi SNARE, 15 kD protein_id : NP_061212.2

name	Ric8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716495 CCDS:CCDS21988.1 GeneID:101489 MGI:2141866
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0001965 - G-protein alpha-subunit binding [Evidence ISS]; GO:0005096 - GTPase activator activity [Evidence ISS]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008277 - regulation of G-protein coupled receptor protein signaling pathway [Evidence ISS] codon_start : 1 product : synembryn protein_id : NP_444424.1

name	Sirt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967963 CCDS:CCDS21989.1 GeneID:64384 MGI:1927665
definition	GO_component : GO:0005677 - chromatin silencing complex [Evidence IEA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006342 - chromatin silencing [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : silent mating type information regulation 2, (S.cerevisiae, homolog)-like 3 product : sirtuin 3 (silent mating type information regulation 2, homolog) 3 protein_id : NP_071878.1

name	Psmd13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755210 CCDS:CCDS21990.1 GeneID:23997 MGI:1345192
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005838 - proteasome regulatory particle (sensu Eukaryota) [Evidence IDA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence ISS] GO_process : GO:0007127 - meiosis I [Evidence IMP] codon_start : 1 note : 26S proteasome subunit p40.5 product : proteasome 26S non-ATPase subunit 13 protein_id : NP_036005.1

name	LOC100043546 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258267 GeneID:100043546
definition	codon_start : 1 product : similar to DnaJ-like protein protein_id : XP_001480662.1

name	Cox8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680995 CCDS:CCDS21991.1 GeneID:12869 MGI:105958
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : COX VIII-H product : cytochrome c oxidase, subunit VIIIb protein_id : NP_031777.1

name	Nlrp6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487067 GeneID:101613 MGI:2141990
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : PYRIN-containing APAF1-like protein 5; NACHT/LRR/pyrin domain-containing protein 6 product : NACHT, leucine rich repeat and PYD containing 6 protein_id : NP_001074858.1

name	Athl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059095 CCDS:CCDS21992.1 GeneID:212974 MGI:2444047
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : mFLJ00228 protein product : ATH1, acid trehalase-like 1 protein_id : NP_663362.2

name	Ifitm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33504579 CCDS:CCDS21993.1 GeneID:73835 MGI:1934923
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007275 - development [Evidence TAS]; GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 note : fragilis4; haemopoiesis related membrane protein 1 product : interferon induced transmembrane protein 5 protein_id : NP_444318.1

name	Ifitm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507626 CCDS:CCDS21994.1 GeneID:80876 MGI:1933382
definition	codon_start : 1 note : interferon induced transmembrane protein, like; fragilis R; interferon induced transmembrane protein 3-like product : interferon induced transmembrane protein 2 protein_id : NP_109619.1

name	Ifitm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254489 CCDS:CCDS21995.1 GeneID:68713 MGI:1915963
definition	GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IMP]; GO:0001756 - somitogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : fragilis2; interferon induced transmembrane protein 2 like product : interferon induced transmembrane protein 1 protein_id : NP_081096.2

name	Ifitm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539593 CCDS:CCDS21996.1 GeneID:66141 MGI:1913391
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IDA] codon_start : 1 note : fragilis product : interferon induced transmembrane protein 3 protein_id : NP_079654.1

name	Ifitm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75812952 CCDS:CCDS21997.1 GeneID:213002 MGI:2686976
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 note : fragilis 5 product : interferon induced transmembrane protein 6 protein_id : NP_001028804.1

name	B4galnt4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58372116 CCDS:CCDS21998.1 GeneID:330671 MGI:2652891
definition	GO_function : GO:0008376 - acetylgalactosaminyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : beta1,4-N-acetylgalactosaminyltransferase IV protein_id : NP_808565.2

name	Pkp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790163 CCDS:CCDS21999.1 GeneID:56460 MGI:1891830
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0030057 - desmosome [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS]; GO:0005914 - spot adherens junction [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation product : plakophilin 3 protein_id : NP_062736.1

name	Sigirr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625701 GeneID:24058 MGI:1344402
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IMP]; GO:0045079 - negative regulation of chemokine biosynthesis [Evidence IMP]; GO:0001960 - negative regulation of cytokine and chemokine mediated signaling pathway [Evidence IMP]; GO:0043433 - negative regulation of transcription factor activity [Evidence ISS] codon_start : 1 note : single Ig IL-1R-related protein product : single Ig IL-1 receptor related protein protein_id : NP_075546.2

name	Trp53i5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410004 GeneID:71345 MGI:1918595
definition	codon_start : 1 note : tumor protein p53 inducible protein 5 product : Trp53 inducible protein 5 protein_id : NP_848468.1

name	Ptdss2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560497 CCDS:CCDS22001.1 GeneID:27388 MGI:1351664
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003882 - CDP-diacylglycerol-serine O-phosphatidyltransferase activity [Evidence IMP]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006659 - phosphatidylserine biosynthesis [Evidence IMP]; GO:0008654 - phospholipid biosynthesis [Evidence IEA] codon_start : 1 product : phosphatidylserine synthase 2 protein_id : NP_038810.2

name	Rnh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981748 CCDS:CCDS22002.1 GeneID:107702 MGI:1195456
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : ribonuclease/angiogenin inhibitor 1 protein_id : NP_660117.2

name	Hras1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680271 CCDS:CCDS22003.1 GeneID:15461 MGI:96224
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007569 - cell aging [Evidence IDA]; GO:0008283 - cell proliferation [Evidence IPI]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006897 - endocytosis [Evidence IDA]; GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007265 - Ras protein signal transduction [Evidence TAS]; GO:0048169 - regulation of long-term neuronal synaptic plasticity [Evidence IMP]; GO:0007264 - small GTPase mediated signal transduction [Evidence IDA] citation : [PUBMED 8922043] codon_start : 1 exception : mismatches in translation note : H-ras 1 protein; transforming protein P21; c-Ha-ras transgene; c-Ha-ras p21 protein product : Harvey rat sarcoma virus oncogene 1 protein_id : NP_032310.1

name	Lrrc56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24418880 CCDS:CCDS22004.1 GeneID:70552 MGI:1917802
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 56 protein_id : NP_722472.1

name	1600016N20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931154 GeneID:72000 MGI:1919250
definition	codon_start : 1 product : hypothetical protein LOC72000 protein_id : NP_082326.1

name	Rassf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118403310 GeneID:66985 MGI:1914235
definition	GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Ras association (RalGDS/AF-6) domain family 7 protein_id : NP_080162.3

name	AA673488 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487443 GeneID:101471 MGI:2141847
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0019904 - protein domain specific binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006397 - mRNA processing [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : hypothetical protein LOC101471 protein_id : NP_001074587.1

name	Irf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567364 CCDS:CCDS22005.1 GeneID:54123 MGI:1859212
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0016064 - immunoglobulin mediated immune response [Evidence IMP]; GO:0045351 - interferon type I biosynthesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0009615 - response to virus [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : interferon regulatory factor 7 protein_id : NP_058546.1

name	Mucdhl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312502 CCDS:CCDS22006.1 GeneID:72040 MGI:1919290
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS] GO_function : GO:0005509 - calcium ion binding [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA] codon_start : 1 product : mucin and cadherin-like protein_id : NP_082345.1

name	Sct (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755416 GeneID:20287 MGI:99466
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 product : secretin protein_id : NP_035458.1

name	Drd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681223 CCDS:CCDS22007.1 GeneID:13491 MGI:94926
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : dopamine receptor 4 protein_id : NP_031904.1

name	Deaf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8393248 GeneID:54006 MGI:1858496
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 note : suppressin product : deformed epidermal autoregulatory factor 1 protein_id : NP_058570.1

name	Tmem80 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313450 CCDS:CCDS22008.1 GeneID:71448 MGI:1918698
definition	codon_start : 1 product : hypothetical protein LOC71448 protein_id : NP_082073.1

name	Eps8l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21040233 CCDS:CCDS22009.1 GeneID:98845 MGI:2138828
definition	GO_component : GO:0001726 - ruffle [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0016601 - Rac protein signal transduction [Evidence ISS] codon_start : 1 product : epidermal growth factor receptor pathway substrate 8-like protein 2 protein_id : NP_573454.2

name	B230206H07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893355 GeneID:320871 MGI:2444929
definition	codon_start : 1 product : hypothetical protein LOC320871 protein_id : NP_796254.1

name	Taldo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859640 CCDS:CCDS22011.1 GeneID:21351 MGI:1274789
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004801 - transaldolase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006098 - pentose-phosphate shunt [Evidence IEA] codon_start : 1 product : transaldolase 1 protein_id : NP_035658.1

name	LOC100043585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258270 GeneID:100043585
definition	codon_start : 1 product : similar to Ran-interacting protein MOG1 isoform 1 protein_id : XP_001480747.1

name	LOC100043585 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258272 GeneID:100043585
definition	codon_start : 1 product : similar to Ran-interacting protein MOG1 isoform 2 protein_id : XP_001480749.1

name	Pddc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981986 GeneID:213350 MGI:2387178
definition	codon_start : 1 exception : unclassified translation discrepancy product : Parkinson disease 7 domain containing 1 protein_id : NP_742114.2

name	Cend1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946620 CCDS:CCDS22012.1 GeneID:57754 MGI:1929898
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : BM88 antigen protein_id : NP_067291.1

name	Slc25a22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311845 CCDS:CCDS22013.1 GeneID:68267 MGI:1915517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005386 - carrier activity [Evidence ISS]; GO:0005313 - L-glutamate transporter activity [Evidence ISS]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0015813 - glutamate transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 25 (mitochondrial carrier: glutamate), member 22 product : solute carrier family 25 (mitochondrial carrier, glutamate), member 22 protein_id : NP_080922.1

name	Lrdd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12083587 CCDS:CCDS22014.1 GeneID:57913 MGI:1889507
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA] codon_start : 1 note : p53 protein induced, with death domain product : leucine-rich and death domain containing protein_id : NP_073145.1

name	Rplp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745120 GeneID:67186 MGI:1914436
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006414 - translational elongation [Evidence IEA] codon_start : 1 product : ribosomal protein, large P2 protein_id : NP_080296.3

name	Pnpla2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313274 CCDS:CCDS22015.1 GeneID:66853 MGI:1914103
definition	GO_process : GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : desnutrin; triglyceride hydrolase; adipose triglyceride lipase product : transport-secretion protein protein_id : NP_080078.1

name	Efcab4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68534955 CCDS:CCDS22016.1 GeneID:213573 MGI:2446129
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : EF-hand calcium binding domain 4A protein_id : NP_001020274.1

name	Cd151 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753334 CCDS:CCDS22017.1 GeneID:12476 MGI:1096360
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CD151 antigen protein_id : NP_033972.1

name	Polr2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258257 GeneID:66491 MGI:1913741
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : polymerase (RNA) II (DNA directed) polypeptide L protein_id : XP_893115.2 transl_except : (pos:complement(148661965..148661967),aa:OTHER) transl_except : (pos:complement(148661959..148661961),aa:OTHER) transl_except : (pos:complement(148661846..148661848),aa:OTHER) transl_except : (pos:complement(148661759..148661761),aa:OTHER) transl_except : (pos:complement(148661464..148661466),aa:OTHER) transl_except : (pos:complement(148661018..148661020),aa:OTHER) transl_except : (pos:complement(148659278..148659280),aa:OTHER) transl_except : (pos:complement(148659248..148659250),aa:OTHER) transl_except : (pos:complement(148659233..148659235),aa:OTHER) transl_except : (pos:complement(148659218..148659220),aa:OTHER) transl_except : (pos:complement(148659203..148659205),aa:OTHER)

name	Tspan4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716365 CCDS:CCDS22018.1 GeneID:64540 MGI:1928097
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : novel antigen 2; tetraspan TM4SF; transmembrane 4 superfamily member 7 product : tetraspanin 4 protein_id : NP_444312.1

name	Chid1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541939 CCDS:CCDS22019.1 GeneID:68038 MGI:1915288
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA]; GO:0004568 - chitinase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006032 - chitin catabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : chitinase domain containing 1 protein_id : NP_080798.2

name	Ap2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254646 GeneID:11772 MGI:101920
definition	GO_component : GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0030117 - membrane coat [Evidence IDA]; GO:0030141 - secretory granule [Evidence TAS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 exception : mismatches in translation note : adaptor-related protein complex AP-2, alpha 2 subunit; alpha-C adaptin; alpha-adaptin C product : adaptor protein complex AP-2, alpha 2 subunit protein_id : NP_031485.2

name	Muc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32171192 GeneID:353328 MGI:2663233
definition	codon_start : 1 exception : unclassified translation discrepancy note : gastric mucin-like protein product : mucin 6, gastric protein_id : NP_859418.1

name	LOC100039649 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258259 GeneID:100039649
definition	codon_start : 1 product : similar to secreted gel-forming mucin protein_id : XP_001473313.1

name	Muc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258275 GeneID:17831 MGI:1339364
definition	codon_start : 1 product : mucin 2 protein_id : XP_980706.2

name	Muc5ac (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114431224 GeneID:17833 MGI:104697
definition	GO_component : GO:0043205 - fibril [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043206 - fibril organization and biogenesis [Evidence ISS] codon_start : 1 note : gastric mucin product : mucin 5, subtypes A and C, tracheobronchial/gastric protein_id : NP_034974.1

name	Muc5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956226 GeneID:74180 MGI:1921430
definition	codon_start : 1 exception : mismatches in translation function : gel-forming mucin product : mucin 5, subtype B, tracheobronchial protein_id : NP_083077.1

name	Tollip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13591860 CCDS:CCDS22020.1 GeneID:54473 MGI:1891808
definition	GO_component : GO:0045323 - interleukin-1 receptor complex [Evidence ISS]; GO:0045092 - interleukin-18 receptor complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IDA] [Evidence ISS]; GO:0005121 - Toll binding [Evidence ISS] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence ISS] [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 product : toll interacting protein protein_id : NP_076253.1

name	EG623757 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258277 GeneID:623757 MGI:3647668
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903033.2

name	Brsk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57864120 CCDS:CCDS22021.1 GeneID:75770 MGI:1923020
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030010 - establishment of cell polarity [Evidence IGI]; GO:0030182 - neuron differentiation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform alpha is encoded by transcript variant 1 product : brain-selective kinase 2 isoform alpha protein_id : NP_083702.1

name	Brsk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58036485 CCDS:CCDS22022.1 GeneID:75770 MGI:1923020
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030010 - establishment of cell polarity [Evidence IGI]; GO:0030182 - neuron differentiation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform gamma is encoded by transcript variant 3 product : brain-selective kinase 2 isoform gamma protein_id : NP_001009930.1

name	Brsk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58036483 CCDS:CCDS22023.1 GeneID:75770 MGI:1923020
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0030010 - establishment of cell polarity [Evidence IGI]; GO:0030182 - neuron differentiation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform beta is encoded by transcript variant 2 product : brain-selective kinase 2 isoform beta protein_id : NP_001009929.1

name	2700078K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20149310 GeneID:101513 MGI:1919891
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ovary-specific MOB-like protein protein_id : NP_082584.1

name	Dusp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679156 CCDS:CCDS22024.1 GeneID:18218 MGI:106626
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : neuronal tyrosine/threonine phosphatase 1 product : dual specificity phosphatase 8 protein_id : NP_032774.1

name	LOC100039728 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258279 GeneID:100039728
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473440.1

name	EG668763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381480 GeneID:668763 MGI:3645383
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001004966.1

name	EG668763 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258299 GeneID:668763 MGI:3645383
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480828.1

name	LOC100043616 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258302 GeneID:100043616
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480829.1

name	EG665295 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258281 GeneID:665295 MGI:3648174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981005.2

name	LOC100043617 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258304 GeneID:100043617
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480831.1

name	Krtap5-2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386262 GeneID:71623 MGI:1918873
definition	codon_start : 1 exception : mismatches in translation product : keratin associated protein 5-2 protein_id : NP_082120.1

name	LOC100039757 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258283 GeneID:100039757
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473498.1

name	LOC100039767 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258285 GeneID:100039767
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473512.1

name	EG665305 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258287 GeneID:665305 MGI:3647476
definition	codon_start : 1 product : hypothetical protein protein_id : XP_981075.2

name	Krtap5-5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83715996 CCDS:CCDS22026.1 GeneID:114666 MGI:2149673
definition	GO_component : GO:0005882 - intermediate filament [Evidence IEA]; GO:0045095 - keratin filament [Evidence IEA] codon_start : 1 product : keratin associated protein 5-5 protein_id : NP_001032911.1

name	EG640223 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94381468 GeneID:640223 MGI:3647126
definition	codon_start : 1 product : hypothetical protein protein_id : XP_929733.2

name	LOC100043627 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258306 GeneID:100043627
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480840.1

name	ENSMUSG00000038442 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258291 GeneID:436015 MGI:3642866
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473608.1

name	Krtap5-1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657283 GeneID:50774 MGI:1354732
definition	GO_component : GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : keratin-associated protein 5-1 product : keratin associated protein 5-1 protein_id : NP_056623.1

name	Krtap5-4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657285 CCDS:CCDS22027.1 GeneID:50775 MGI:1354758
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0045095 - keratin filament [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : keratin-associated protein 5-4 product : keratin associated protein 5-4 protein_id : NP_056624.1

name	6330512M04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893327 GeneID:320802 MGI:2444776
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC320802 protein_id : NP_796239.1

name	Ctsd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753556 CCDS:CCDS22029.1 GeneID:13033 MGI:88562
definition	GO_component : GO:0005764 - lysosome [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0004192 - cathepsin D activity [Evidence IEA] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] [Evidence IC] codon_start : 1 product : cathepsin D protein_id : NP_034113.1

name	Syt8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980914 CCDS:CCDS22030.1 GeneID:55925 MGI:1859867
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IEA] GO_function : GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : synaptotagmin 8 product : synaptotagmin VIII protein_id : NP_061272.2

name	Tnni2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678391 GeneID:21953 MGI:105070
definition	GO_component : GO:0005861 - troponin complex [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005200 - structural constituent of cytoskeleton [Evidence IEA] GO_process : GO:0006937 - regulation of muscle contraction [Evidence IEA] codon_start : 1 product : troponin I, skeletal, fast 2 protein_id : NP_033431.1

name	LOC100043529 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043529
definition	number : 1 pseudo : _no_value

name	LOC672428 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672428
definition	number : 2 pseudo : _no_value

name	LOC672428 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672428
definition	number : 1 pseudo : _no_value

name	LOC100043629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043629
definition	number : 1 pseudo : _no_value

name	LOC665143 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258255 GeneID:665143
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 5 Proteins product : similar to Nucleotide binding protein-like pseudo : _no_value transcript_id : XR_030951.1

name	LOC546015 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258268 GeneID:546015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1252 ESTs, 9 Proteins product : similar to ribosomal protein S9 pseudo : _no_value transcript_id : XR_034790.1

name	LOC100039800 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258289 GeneID:100039800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to keratin associated protein 5-1 pseudo : _no_value transcript_id : XR_031268.1

name	LOC270015 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258307 GeneID:270015
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 7 Proteins product : similar to ribosomal protein L27a-like pseudo : _no_value transcript_id : XR_034843.1

clone name	MSMg01-528K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448G05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-398I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128M01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-313L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280O08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-185C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-217I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039O06
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-397E11.T7 (MSMg01no397_e11.b1)	MSMg01-397E11.TJ (MSMg01no397_e11.g1)
ACC	AG497656	AG497657
length	760	856
length of high quality (start - end)	244 (77 - 320)	216 (77 - 292)
definition	CHROMAT_FILE: MSMg01no397_e11.b1 PHD_FILE: MSMg01no397_e11.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:09:39 2005	CHROMAT_FILE: MSMg01no397_e11.g1 PHD_FILE: MSMg01no397_e11.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:09:39 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	NCTATCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXATCAGACACCATCC GCGGAATTCTGGGATTCCTTGAGAGGGTATTAAAAGATGCCAGAGCCCCA AGAGAGGTGGAGGCTGCTGCTCCTGGTCCCTGTTGCTGTGGTTCATCAAG TGGTCATGAGCAAAGGAAGAGAAGAAGAAATTGGATATCGTGATAAAGAA GATTGGACTTGCCCCCAAGGAACTCAGTGCCCCTAATCAGCAGGAAGTAG TCTAATGAGTTCTATGCCCCCTTTCCCCTCTAACCTTTTTCTCCCACCCG CTGTTGGGGGGCTGGAAGGGATATATTGTTAGATAGAAAAACCCAGTAAA GTACCCAGAAAGTACAGTTACAGACATCTGTGGCTTCCCATCTATCAGTT TTACAAGGAGTCTTCCAAGCTGCATTTATAATGTCCTTGGTCTTCCTACC TGCTTCATATGTGTGTATGGTGTGTAAGTATACATACATGCATGTTTTAC ATGTGTGTGAACACACTTGTGAGTGTGAATACTTGTGGGTGTCTGTACAT ATGGAGATCCCAGGCTGATGTCAGGAATTGCCCTCCATCACACTTCCGCC TTGTTCACTGAATCAAGGGTTCCTGGTCATTCCCAAAACGTGCCACCGTG GGTTGTTTTTATTTCCCAACTTGCTCTGGGAAAATTCCGCCTTTGGTTTA ACCGGCCGGATTCCCACCCAATCCCCCTGTATTTTTTTGGTTTTCTCGGA ACCTCCTTTT	CTACGATGCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXCTACTGGCTAGCCCGGAGGGGCGG AGCCCGACGGGTGGCCCGCCCGGAAGCGCGCCGGCGGGAAGGCAGCACAG AGCGCGCCTAGACTGGCGGGGAGATCAGCGTGGCAGGTACTCAATGGGAG GCGGGAAGTTTGCTCCAGAGGCGGGACCAAAGCGACTCCTCACCTACCGA GACCCCCTCTGCTTTCCCCATTTGACGGAGGTGGGAATTGGGAATTGTGT TCCTACAGCGCCTACTTTTAATCTTTTCACGGGACCCCCCCCCCCCCACC CCCATACGACTTCTCTGCCCCCCCCTCTTTTCGTTTTACTGCCCCCCCCC CTCCTCCCTTTTCCTTTTCCCCCCCCTCCCCTTCTTCTTTCTGCTCCTTA CCCCTTCTCTCTTTTTTTTCCTTCCTATTCCTTTTCTTTTCCCTTCTCCA CCTCCTCTTTTTCCTCTTCCCCATCTTTTATTCCCGCTCTGCCCTCTCCT TCTTCTTTTCCCTCCCATCCTCCTCCTACCTTTCTTAGCTCCCTTCTCCC ATCTTTCTCTTTTTTTTTCTCCTTTTCTTATCCTTCTCTCCCTCTTCCCT CTTACTCCTCTCTCTTCTTCTTTTTTCTTCTCCTTCGCCTTACCTTCCCC ACTTTTTTTTTCTCTTCTTCCCCCCCCCTTTTCTTTTTCTTTCTTTTTTT TTCCCTTCTTTTTCTCTTCCTCCCTCCTACTTCTACGTCGCTTACCCCCC TCCCCCTCTCTCTTTTTTTTCTTTACTCCGCTCCCCTCTATCTTTATTCT CTTTCG
quality values	Open. Hide. 0 3 6 6 6 10 9 8 8 8 12 12 24 34 41 32 30 28 32 32 32 37 37 37 37 32 17 9 9 9 9 13 11 11 6 6 6 6 6 6 9 9 9 8 8 8 8 8 10 12 21 27 34 23 21 19 28 23 25 33 27 8 6 6 6 6 6 7 9 9 12 11 11 11 13 11 21 18 33 32 37 44 59 59 36 36 36 36 36 36 47 47 47 53 57 59 50 50 48 48 48 50 59 68 68 68 68 68 68 68 68 68 68 68 68 57 46 48 48 48 39 47 37 36 28 27 30 40 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 68 68 68 68 68 57 57 57 68 68 59 59 57 59 57 54 48 57 59 59 68 68 68 68 68 68 68 68 50 50 50 50 57 57 57 57 68 68 68 50 50 50 50 50 68 68 68 68 68 50 50 50 50 50 68 68 68 68 68 68 68 59 59 59 54 54 57 57 57 68 57 57 57 52 52 57 57 59 68 68 68 68 68 57 57 57 50 43 57 59 57 57 68 68 68 68 57 57 57 44 34 26 24 11 11 11 18 24 32 44 48 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 50 50 43 30 24 12 12 10 6 6 6 6 6 6 9 15 16 18 34 41 59 59 59 59 53 53 53 53 53 50 57 57 59 59 57 57 57 57 57 57 57 57 59 68 68 59 43 59 35 35 35 39 39 46 47 59 35 35 35 59 59 59 59 59 59 57 57 57 59 59 59 59 59 59 57 57 57 59 59 59 59 57 44 43 57 59 59 57 57 41 41 41 47 57 57 54 54 57 59 44 44 32 32 32 44 43 43 43 39 39 39 59 59 59 57 57 57 57 43 43 43 57 57 57 57 48 48 48 59 59 59 54 54 54 57 54 54 54 54 46 57 43 43 43 57 48 48 57 47 54 48 48 48 34 32 20 20 20 31 31 43 33 34 25 25 25 40 40 43 43 30 34 18 18 15 28 28 31 34 23 23 28 37 37 37 28 25 25 28 28 30 31 30 31 19 20 14 16 16 13 14 14 15 10 12 9 8 13 8 8 8 15 19 30 20 19 15 10 10 10 23 19 29 29 16 19 9 9 10 12 16 13 13 8 8 8 14 22 22 19 24 10 10 15 17 15 14 9 9 9 11 10 12 15 15 13 15 13 10 14 17 19 16 16 15 14 14 14 10 10 10 9 9 12 13 16 15 16 16 19 19 17 11 11 11 12 12 14 14 15 10 10 8 8 8 8 8 8 8 8 8 9 10 10 11 11 15 18 20 13 10 10 10 8 8 9 9 9 10 10 10 14 15 11 10 8 8 8 12 9 9 10 13 10 10 10 10 8 8 8 8 8 8 10 14 11 14 12 11 10 10 10 12 10 14 10 11 8 8 8 8 10 9 12 12 12 16 17 20 19 23 19 15 17 13 10 10 10 10 10 10 9 10 12 9 9 10 10 10 10 10 9 9 10 10 8 10 8 10 8 6 8 8 8 10 8 8 8 8 15 9 10 12 9 10 10 10 10 14 11 24 13 13 8 8 7 7 10 12 13 10 10 10 10 8 8 8 6 7 7 8 8 10 12 10 10	Open. Hide. 6 6 6 6 8 15 11 10 10 9 9 23 9 9 9 15 9 9 9 12 21 32 27 13 13 3 0 3 27 18 13 19 9 9 9 9 8 8 8 8 8 8 8 19 17 26 24 33 27 23 12 11 11 21 21 50 47 27 27 12 16 11 13 16 17 17 24 17 32 25 16 17 20 24 31 31 59 59 59 57 57 59 53 53 53 57 57 57 59 57 43 43 47 43 43 48 48 48 48 48 48 48 54 54 57 54 54 48 48 43 46 43 41 30 20 17 30 24 30 39 37 37 37 37 42 46 57 54 57 54 54 48 48 48 39 39 37 37 37 57 57 57 48 48 48 48 47 47 47 50 54 57 57 57 59 59 59 59 57 57 47 47 50 50 50 52 52 52 52 37 37 41 46 46 50 50 50 57 57 57 57 52 52 52 52 52 57 59 59 59 57 52 52 43 43 52 52 52 52 57 52 43 43 35 43 35 43 43 48 50 50 50 48 43 43 42 32 32 42 42 31 22 22 24 24 14 26 18 27 27 27 27 30 35 42 42 57 57 59 57 48 48 48 57 59 47 44 37 31 26 18 14 14 14 18 30 36 44 44 68 68 68 68 68 68 68 57 57 54 54 54 54 48 48 43 48 43 43 39 39 35 24 24 28 23 28 27 27 24 11 13 13 13 21 21 26 14 10 10 8 6 6 8 8 11 12 11 8 8 10 12 18 15 14 17 11 16 16 9 9 9 9 9 9 15 12 11 10 10 11 11 8 8 10 10 12 19 10 8 8 8 9 13 15 19 16 12 12 11 10 9 7 10 7 6 6 6 8 6 9 12 10 8 10 8 9 9 13 17 23 25 28 19 17 10 8 8 8 8 9 8 8 6 6 8 11 10 10 10 11 10 10 10 10 15 12 10 9 9 13 12 8 12 8 8 8 8 8 8 8 8 8 8 8 10 13 9 9 9 13 13 18 22 18 18 14 14 18 14 22 21 9 9 10 10 10 16 12 10 8 8 8 7 8 8 11 11 11 11 11 11 12 12 12 11 11 15 12 14 13 13 11 18 18 18 12 15 9 9 9 9 9 13 13 19 15 11 10 15 10 8 8 8 10 8 8 8 7 10 15 15 17 10 13 8 8 8 10 10 10 13 20 18 24 22 24 19 23 11 8 8 8 8 8 12 7 9 9 9 11 11 10 10 10 13 13 16 17 8 8 8 8 8 8 6 6 6 6 8 6 6 10 10 10 15 15 13 8 8 8 10 8 8 8 10 13 15 14 14 14 10 10 10 8 8 8 10 11 10 8 8 10 10 10 8 8 13 13 15 19 15 11 11 8 8 8 8 11 10 8 8 8 8 8 10 11 10 8 8 8 8 8 10 13 13 18 12 9 9 11 11 15 15 15 21 15 15 22 21 11 12 11 16 16 21 19 16 10 9 9 9 9 9 10 9 12 9 10 11 13 12 11 8 8 8 8 8 8 8 10 10 13 10 10 10 15 15 15 13 10 10 9 10 10 8 8 8 8 7 7 6 8 8 12 9 10 12 10 8 8 10 10 11 10 11 8 8 8 6 8 6 6 9 12 12 15 19 14 15 8 8 6 8 8 19 19 28 28 22 21 16 10 10 10 9 9 8 8 8 8 9 8 8 8 8 16 13 10 10 9 10 10 24 22 15 8 8 8 8 13 8 8 7 7 8 8 11 11 16 19 10 9 8 8 8 10 10 13 16 12 11 18 16 21 16 11 12 11 12 10 13 10 8 8 6 6 8 6 9 9 10 10 8 10 8 8 8 8 8 10 10 8 8 9 11 9 12 9 9 10 10 13 15 15 10 13 12 13 15 13 10 10 9 9 14 15 18 15 15 12 13 12 15 11 10 8 11 10 8 8 8 8 10 8 8 7 7 6 6 9 10 8 8 10 8 8 8 8 8 8 8 13 12 10 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no397_e11.g1 MSMg01no397_e11.g1 CHROMAT_FILE:
MSMg01no397_e11.g1 PHD_FILE: MSMg01no397_e11.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:09:39 2005
         (216 letters)



>mm_chr7_148629562_148630177
          Length = 616

 Score =  402 bits (208), Expect = e-117
 Identities = 214/216 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   ctactggctagcccggaggggcggagcccgacgggtggcccgcccggaagcgcgccggcg 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 ctactggctagcccggaggggcggagcccgacgggtggcccgcccggaagcgcgccggcg 357

                                                                       
Query: 61  ggaaggcagcacagagcgcgcctagactggcggggagatcagcgtggcaggtactcaatg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 356 ggaaggcagcacagagcgcgcctagactggcggggagatcagcgtggcaggtactcaatg 297

                                                                       
Query: 121 ggaggcgggaagtttgctccagaggcgggaccaaagcgactcctcacctaccgagacccc 180
           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 296 ggaggcgggaagtttgctccagaggcgggaccaaagcgattcctcacctaccgagacccc 237

                                               
Query: 181 ctctgctttccccatttgacggaggtgggaattggg 216
           ||||||||||||||||||||||||||| ||||||||
Sbjct: 236 ctctgctttccccatttgacggaggtgtgaattggg 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 9
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 216
Length of database: 616
Length adjustment: 9
Effective length of query: 207
Effective length of database: 607
Effective search space:   125649
Effective search space used:   125649
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information