MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-407I10
Chromosome	7 (Build37)
Map Location	48,935,755 - 48,936,238
singlet/doublet	singlet
Overlap gene	Gprc2a-rs5
Upstream gene	LOC100039094, 2900093B09Rik, 4930433I11Rik, EG233164, LOC668555, EG627987, LOC100039269, LOC545955, EG628304, LOC668561, EG434172, LOC100039221, LOC668565, AI987944, EG269902, LOC100039375, EG628359, 2610021A01Rik, 2810426N06Rik, LOC668576, LOC628372
Downstream gene	EG668579, EG628403, EG628422, Gprc2a-rs1, EG628444, EG434174, EG637913, EG434175, LOC100039556, EG637898, Gprc2a-rs2, LOC434177, Vmn2r-ps60, 4933421I07Rik, LOC628503, BC063263, LOC100039449, EG637776, C330019L16Rik, EG434179
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	2900093B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58188 MGI:1914525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930433I11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243944 MGI:2685327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG233164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233164 MGI:3649090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668555 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG627987 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627987 MGI:3647709
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039269 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 7 Proteins

name	LOC545955 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:545955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins pseudo : _no_value

name	EG628304 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628304 MGI:3646160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	LOC668561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG434172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434172 MGI:3648691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC668565 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	AI987944 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233168 MGI:2142079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG269902 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269902 MGI:3703084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039375 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 9 Proteins pseudo : _no_value

name	EG628359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628359 MGI:3643456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2610021A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668572 MGI:1922662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 4 Proteins

name	2810426N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67607 MGI:1914857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 4 Proteins pseudo : _no_value

name	Gprc2a-rs5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75835 MGI:1351350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG668579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668579 MGI:3645134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG628403 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628403 MGI:3647693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 Proteins

name	EG628422 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628422 MGI:3647877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins

name	Gprc2a-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110931 MGI:1351346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 Proteins

name	EG628444 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628444 MGI:3643747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 Proteins

name	EG434174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434174 MGI:3648695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 631 ESTs, 26 Proteins

name	EG637913 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637913 MGI:3647435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 2 Proteins pseudo : _no_value

name	EG434175 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 274 ESTs, 42 Proteins

name	LOC100039556 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 mRNAs, 2798 ESTs, 24 Proteins pseudo : _no_value

name	EG637898 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637898 MGI:3647050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 Proteins

name	Gprc2a-rs2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637873 MGI:1351347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	LOC434177 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434177
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Vmn2r-ps60 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 Proteins

name	4933421I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71162 MGI:1918412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628503 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 219 ESTs, 4 Proteins pseudo : _no_value

name	BC063263 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434178 MGI:3584269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 2 Proteins

name	LOC100039449 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039449
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG637776 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637776 MGI:3645327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	C330019L16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208111 MGI:3036263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434179 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434179 MGI:3648690
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039094 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257200 GeneID:100039094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100039094 transcript_id : XM_001472249.1

name	2900093B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370338 GeneID:58188 MGI:1914525
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900093B09 gene transcript_id : NM_021387.2

name	4930433I11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801797 GeneID:243944 MGI:2685327
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930433I11 gene transcript_id : NM_207248.2

name	EG233164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139948924 GeneID:233164 MGI:3649090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG233164 transcript_id : NM_183166.2

name	LOC100039269 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257211 GeneID:100039269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 2 ESTs, 7 Proteins product : hypothetical protein LOC100039269 transcript_id : XM_001472401.1

name	EG628304 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380357 GeneID:628304 MGI:3646160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : predicted gene, EG628304 transcript_id : XM_001002281.1

name	EG434172 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345369 GeneID:434172 MGI:3648691
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434172 transcript_id : NM_001033782.2

name	AI987944 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130718 GeneID:233168 MGI:2142079
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI987944 transcript_id : NM_183167.3

name	EG269902 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369995 GeneID:269902 MGI:3703084
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG269902 transcript_id : NM_177764.3

name	EG628359 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257209 GeneID:628359 MGI:3643456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG628359 transcript_id : XM_893095.3

name	2810426N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130493405 GeneID:67607 MGI:1914857
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810426N06 gene transcript_id : NM_023363.2

name	Gprc2a-rs5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803327 GeneID:75835 MGI:1351350
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor, family C, group 2, member A, related sequence 5 transcript_id : NM_029460.2

name	EG628403 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257216 GeneID:628403 MGI:3647693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 11 Proteins product : predicted gene, EG628403 transcript_id : XM_893137.2

name	EG628422 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257218 GeneID:628422 MGI:3647877
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins product : predicted gene, EG628422 transcript_id : XM_145558.7

name	Gprc2a-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257220 GeneID:110931 MGI:1351346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 Proteins product : G protein-coupled receptor, family C, group 2, member A, related sequence 1 transcript_id : XM_001002448.2

name	EG628444 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257222 GeneID:628444 MGI:3643747
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 Proteins product : predicted gene, EG628444 transcript_id : XM_893188.2

name	EG434174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257235 GeneID:434174 MGI:3648695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 631 ESTs, 26 Proteins product : predicted gene, EG434174 transcript_id : XM_485920.4

name	EG434175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380406 GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 267 ESTs, 41 Proteins product : predicted gene, EG434175, transcript variant 1 transcript_id : XM_485921.3

name	EG434175 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257236 GeneID:434175 MGI:3648694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 116 ESTs, 17 Proteins product : predicted gene, EG434175, transcript variant 2 transcript_id : XM_900988.3

name	EG637898 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257226 GeneID:637898 MGI:3647050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 Proteins product : predicted gene, EG637898 transcript_id : XM_001002479.2

name	Gprc2a-rs2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257228 GeneID:637873 MGI:1351347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : G protein-coupled receptor, family C, group 2, member A, related sequence 2 transcript_id : XM_001002506.2

name	Vmn2r-ps60 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257230 GeneID:628490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 Proteins product : vomeronasal receptor Vmn2r-ps60 transcript_id : XM_893241.3

name	4933421I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803397 GeneID:71162 MGI:1918412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933421I07 gene transcript_id : NM_027702.2

name	BC063263 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380409 GeneID:434178 MGI:3584269
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 86 ESTs, 2 Proteins product : cDNA sequence BC063263, transcript variant 1 transcript_id : XM_485924.4

name	EG637776 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257246 GeneID:637776 MGI:3645327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG637776 transcript_id : XM_913547.3

name	C330019L16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803517 GeneID:208111 MGI:3036263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330019L16 gene transcript_id : NM_001034857.2

name	EG434179 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56606034 GeneID:434179 MGI:3648690
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434179 transcript_id : NM_001008427.1

name	LOC100039094 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257201 GeneID:100039094
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472299.1

name	2900093B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946730 CCDS:CCDS21160.1 GeneID:58188 MGI:1914525
definition	codon_start : 1 function : expression of this gene product inhibits the growth of E. coli product : hypothetical protein LOC58188 protein_id : NP_067362.1

name	4930433I11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402245 GeneID:243944 MGI:2685327
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC243944 protein_id : NP_997131.1

name	EG233164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139948925 GeneID:233164 MGI:3649090
definition	codon_start : 1 product : hypothetical protein LOC233164 protein_id : NP_898989.2

name	LOC100039269 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257212 GeneID:100039269
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472451.1

name	EG628304 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380358 GeneID:628304 MGI:3646160
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001002281.1

name	EG434172 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702095 GeneID:434172 MGI:3648691
definition	codon_start : 1 product : hypothetical protein LOC434172 protein_id : NP_001028954.1

name	AI987944 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147201 GeneID:233168 MGI:2142079
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC233168 protein_id : NP_898990.1

name	EG269902 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244266 GeneID:269902 MGI:3703084
definition	codon_start : 1 product : hypothetical protein LOC269902 protein_id : NP_808432.1

name	EG628359 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257210 GeneID:628359 MGI:3643456
definition	codon_start : 1 product : similar to EG435970 protein protein_id : XP_898188.3

name	2810426N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789173 GeneID:67607 MGI:1914857
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67607 protein_id : NP_075852.1

name	Gprc2a-rs5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386402 GeneID:75835 MGI:1351350
definition	codon_start : 1 note : calcium sensing receptor, related sequence 5 product : G protein-coupled receptor, family C, group 2, member A, related sequence 5 protein_id : NP_083736.1

name	EG628403 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257217 GeneID:628403 MGI:3647693
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898230.2

name	EG628422 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257219 GeneID:628422 MGI:3647877
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_145558.7

name	Gprc2a-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257221 GeneID:110931 MGI:1351346
definition	codon_start : 1 note : overriding stop codons product : similar to putative pheromone receptor protein_id : XP_001002448.2 transl_except : (pos:complement(49223613..49223615),aa:OTHER)

name	EG628444 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257223 GeneID:628444 MGI:3643747
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_898281.2

name	EG434174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762947 GeneID:434174 MGI:3648695
definition	codon_start : 1 product : similar to high-mobility group box 1 protein_id : XP_485920.1

name	EG434175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82905069 GeneID:434175 MGI:3648694
definition	codon_start : 1 product : similar to cyclin B1 isoform 2 protein_id : XP_906081.1

name	EG434175 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762951 GeneID:434175 MGI:3648694
definition	codon_start : 1 product : similar to cyclin B1 isoform 1 protein_id : XP_485921.1

name	EG637898 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257227 GeneID:637898 MGI:3647050
definition	codon_start : 1 product : similar to putative pheromone receptor protein_id : XP_001002479.2

name	Gprc2a-rs2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257229 GeneID:637873 MGI:1351347
definition	codon_start : 1 product : G protein-coupled receptor, family C, group 2, member A, related sequence 2 protein_id : XP_001002506.2

name	Vmn2r-ps60 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82905313 GeneID:628490
definition	codon_start : 1 product : similar to calcium-sensing receptor related protein 2 protein_id : XP_898334.1

name	4933421I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386252 GeneID:71162 MGI:1918412
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71162 protein_id : NP_081978.1

name	BC063263 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51762957 GeneID:434178 MGI:3584269
definition	codon_start : 1 product : similar to ZNF91L isoform 1 protein_id : XP_485924.1

name	EG637776 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257247 GeneID:637776 MGI:3645327
definition	codon_start : 1 product : hypothetical protein protein_id : XP_918640.3

name	C330019L16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702187 GeneID:208111 MGI:3036263
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC208111 protein_id : NP_001030029.1

name	EG434179 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606035 GeneID:434179 MGI:3648690
definition	codon_start : 1 product : hypothetical protein LOC434179 protein_id : NP_001008427.1

name	LOC668555 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668555
definition	number : 1 pseudo : _no_value

name	LOC668555 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668555
definition	number : 2 pseudo : _no_value

name	LOC668555 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668555
definition	number : 3 pseudo : _no_value

name	EG627987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627987
definition	number : 1 pseudo : _no_value

name	EG627987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627987
definition	number : 2 pseudo : _no_value

name	EG627987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627987
definition	number : 3 pseudo : _no_value

name	LOC668561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668561
definition	number : 1 pseudo : _no_value

name	LOC668561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668561
definition	number : 2 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 1 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 2 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 3 pseudo : _no_value

name	LOC100039221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039221
definition	number : 4 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 3 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 2 pseudo : _no_value

name	LOC628372 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628372
definition	number : 1 pseudo : _no_value

name	EG668579 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668579
definition	number : 2 pseudo : _no_value

name	EG668579 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668579
definition	number : 1 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 4 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 3 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 2 pseudo : _no_value

name	LOC434177 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:434177
definition	number : 1 pseudo : _no_value

name	LOC100039449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039449
definition	number : 1 pseudo : _no_value

name	LOC100039449 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039449
definition	number : 2 pseudo : _no_value

name	LOC545955 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257213 GeneID:545955
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 12 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_030710.1

name	LOC668565 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257208 GeneID:668565
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to protein kinase C binding protein 1 pseudo : _no_value transcript_id : XR_030730.1

name	LOC100039375 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257224 GeneID:100039375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 ESTs, 9 Proteins product : similar to ornithine decarboxylase pseudo : _no_value transcript_id : XR_030737.1

name	2610021A01Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257214 GeneID:668572 MGI:1922662
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs, 4 Proteins product : RIKEN cDNA 2610021A01 gene transcript_id : XR_030795.1

name	LOC668576 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257215 GeneID:668576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 ESTs, 4 Proteins product : similar to Phosphoglycerate dehydrogenase pseudo : _no_value transcript_id : XR_035655.1

name	EG637913 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257225 GeneID:637913 MGI:3647435
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 2 Proteins product : predicted gene, EG637913 pseudo : _no_value transcript_id : XR_002212.2

name	LOC100039556 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257237 GeneID:100039556
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 105 mRNAs, 2798 ESTs, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_030800.1

name	LOC628503 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257242 GeneID:628503
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 219 ESTs, 4 Proteins product : similar to ribosomal protein pseudo : _no_value transcript_id : XR_030821.1

clone name	MSMg01-464J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470J23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-120F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-454O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052D03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318G16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427A03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-467A11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337G20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-463P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302N05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-407I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-443N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506M13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-473P06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-448N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517A17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-325H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144M02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-407I10.T7 (MSMg01no407_i10.b1)	MSMg01-407I10.TJ (MSMg01no407_i10.g1)
ACC	AG505464	AG505465
length	748	753
length of high quality (start - end)	616 (45 - 660)	488 (77 - 564)
definition	CHROMAT_FILE: MSMg01no407_i10.b1 PHD_FILE: MSMg01no407_i10.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:23:11 2005	CHROMAT_FILE: MSMg01no407_i10.g1 PHD_FILE: MSMg01no407_i10.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:23:11 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	CTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGA ATTCTTCGTTCAGCTCTCAGCCCCATCTTTTAAGGGGGTTATATGATTTT CTGGAGTCCACCCTCTTGAGTTCTTTATATATATATATTGGATATAAGTC CCCTATCTGATTTAAGTGGGGTAAAGATCCTTTCCCAATTTGTTGGTGGT CTTTTTGTCTTATTGACGGTGGCTTTTGCCTTGCAGAAGCTTTGCAGTTT CATGAGGTCCCATTTGTCAATCTTCGATCTTACAGCACAAGACATTGCTG TTCTATTCAGGAATTTTTTCCCTGTGCCCATATCTTCGAGACTTTCCCCC ACTTTCTCCTCTATAAGTTTCAGTGTCTTTGGTTTTATGTGAAGTTCCTT GATCCAATTAGATTTGATCTTAGTACAAGGAGAGAGGAATGGGTCGATTC GCATTCTTCTACATGATAACAACCAGTTGTGGCAGCACCATTTGTTGAAA ATGCTGTCTTTCTTTCACTGGATGGTTTTAGCTCCCTTGTCGAAGATCAA GTGACCATAGGTATGTGGGTTCATTTCTGGGTCTTCAATTCTATTCCATT GGTCTACTTGCCTGTCACTATACCAGTAACATGCAGTTTTTATAACAATT GCTCTGTAGTANAGCTTTAGGTCAGGCATGGGGATTTCACCAGAGGTTCT TTTATCCTTGAAAAGAGCTTTTGCTATCCTAAGGTTTTTGGTATTCCN	CGATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXAGAATTCTTATGACTTTGTCGATA TAGGGAATGAAACTTCCTTTAGATTTTCAAAATCCTTCTTTTCAATTCAA AAATTCCTTCAAGTATATTTTCTTGTGTACTTCGTTTCCTCTTTAAAAGG AAACGTGATAATTTTGATATTGTTCATATTGCTTTCCCCATTGATATCCA GTATCCATGATCCTTTGTCCTGTATGGATCACCAGATAATTTGAATATTT TCAGTGTTATGATTTCATATATATCCATAGATAAATTAATCTAAGTATTT CTTACTTTGAACTGGGTTTTCTTGAAGTTCAGATATACTCTTGAGGGAAG AGATGATGCAACTGAGTGAAAAGACACCTGAGTGTCTAGAATGTTGCTAG AGTGACAAGTACTGACTATTTTATACACAGGTGATTTTAGAAGAGGACTG TCACTATTTAAATTTGTGAGCACTTTCTCATCTAGACATGTCTCTTTTTC TATTTTTCTTTCTTTTCCATTTAATTGGTTTGNGNTTTTTTTGGCCTAAA CTTTTTAATTTTCAGACCGATGTAAATTTTTATCTGCTTCCCAATGTTTC TAGTGCTTTTCCTGCTTAAGGGGATGTGCTCCTAAAAACACTATTTTGGA GAAGGCCACTTTAAGGGTTTTTAACACTTTCTTAAAATTGAAAATTAAAA AAA
quality values	Open. Hide. 8 8 8 8 8 10 10 31 43 41 39 39 39 35 32 37 22 23 25 28 28 30 48 50 30 29 28 21 17 10 16 8 8 8 8 13 13 39 47 31 31 31 31 31 31 47 47 44 29 23 22 28 32 33 59 59 59 41 27 16 13 11 13 13 41 29 36 37 37 37 43 43 43 36 42 42 47 57 53 68 68 68 68 68 68 68 68 68 68 68 57 57 57 50 50 53 53 68 68 68 68 68 68 68 68 57 50 50 50 50 48 47 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 51 68 68 68 68 57 59 59 59 59 59 57 57 57 68 68 50 50 50 50 50 50 59 57 57 57 57 57 57 68 68 68 68 68 57 57 57 57 57 57 57 57 57 57 57 57 57 57 59 59 57 57 57 57 52 52 52 57 59 59 68 68 59 57 57 57 57 57 57 59 59 57 57 57 57 57 57 57 57 57 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 62 62 62 62 68 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 62 62 62 62 62 68 62 68 68 68 68 68 68 68 68 68 68 62 62 62 52 52 62 62 52 62 62 62 62 62 62 62 62 68 68 62 62 62 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 68 68 68 59 59 59 68 68 57 68 68 68 68 68 68 59 59 57 57 57 59 59 59 59 59 68 68 68 68 68 57 68 68 68 68 68 68 68 59 59 59 59 59 68 59 59 68 57 57 57 57 57 57 57 68 68 68 68 68 68 59 59 59 59 59 59 57 57 57 52 52 54 57 57 57 68 68 68 68 68 68 68 68 68 68 68 57 59 57 57 59 59 59 59 57 57 59 59 59 59 59 59 59 59 57 57 57 68 68 68 68 68 68 68 68 59 59 57 57 54 54 59 59 59 68 68 68 68 68 59 59 59 54 57 57 59 59 59 68 68 59 59 59 57 57 48 48 48 57 59 59 59 59 59 59 57 48 48 44 43 48 41 40 40 41 43 41 39 32 31 39 41 39 41 42 42 42 48 48 48 50 57 59 48 59 59 59 59 32 32 20 32 28 42 47 59 57 57 57 57 54 57 57 48 48 54 59 59 59 48 43 43 43 44 57 48 48 48 59 59 59 57 57 43 43 50 50 50 43 39 30 30 30 39 37 47 48 48 47 37 37 37 37 37 37 36 32 28 22 25 25 31 33 43 36 36 26 31 12 12 11 12 12 30 31 31 30 30 24 18 18 19 22 29 33 39 36 33 25 25 40 43 43 42 23 34 29 24 22 24 32 32 40 43 37 36 33 33 33 33 30 30 30 23 20 3 0 3 12 12 14 27 23 16 12 11 17 16 16 13 13 16 28 21 11 11 10 12 12 10 8 8 7 8 10 10 10 10 10 10 10 15 10 19 12 16 16 15 19 11 17 15 17 12 16 11 8 8 7 7 7 8 11 17 18 30 35 25 22 22 12 10 10 8 8 8 9 8 8 8 8 8 8 9 9 10 10 10 16 15 15 3 0	Open. Hide. 6 6 6 10 11 10 8 8 8 8 8 9 9 13 15 22 20 30 20 29 34 34 34 39 41 37 37 41 27 23 9 12 11 12 9 12 12 13 9 9 12 12 24 21 37 37 44 53 47 36 36 33 33 33 33 42 25 25 8 8 8 8 8 8 8 8 21 22 33 28 29 32 33 33 36 36 36 36 36 42 53 53 53 59 59 59 59 59 59 59 59 59 57 57 54 48 48 53 54 68 68 68 68 68 68 68 68 68 68 68 68 68 54 54 54 54 54 54 44 44 68 68 68 68 57 51 50 47 47 50 51 57 57 47 47 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 51 51 51 50 50 50 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 59 59 52 43 43 43 43 59 59 68 68 68 68 68 68 68 59 68 68 68 68 59 59 68 59 59 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 54 59 59 68 68 68 68 68 59 59 57 57 57 57 57 57 57 57 57 57 57 57 59 57 57 57 54 54 57 57 57 68 68 68 59 59 68 59 59 48 48 48 48 59 59 68 68 68 68 57 57 59 59 54 59 59 68 68 68 59 59 59 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 47 47 47 59 59 36 28 16 15 12 12 12 15 26 32 34 47 47 48 48 48 53 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 68 68 59 59 59 68 68 68 68 68 68 68 59 59 59 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 57 59 59 68 59 68 59 59 59 59 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 59 59 57 59 59 59 68 68 68 68 68 68 57 57 57 57 54 54 57 57 59 59 59 57 59 54 52 59 57 59 59 57 57 52 59 59 59 59 68 68 68 68 68 68 57 57 57 57 57 57 59 59 59 59 68 59 59 57 59 59 57 57 57 57 57 57 57 57 57 57 57 57 48 43 39 39 41 40 44 43 43 59 44 44 35 42 42 46 43 48 46 46 43 43 43 50 50 54 54 57 57 59 54 57 44 44 36 36 36 43 39 43 48 48 48 48 48 48 48 48 48 48 32 34 23 23 23 31 31 37 28 28 28 41 37 43 43 59 59 59 34 34 23 20 20 34 34 43 41 41 15 19 10 10 10 21 25 28 24 22 22 28 25 25 20 9 9 9 9 9 10 21 3 0 3 0 3 12 13 28 28 17 12 12 11 11 8 8 8 9 13 17 25 41 40 32 25 20 11 11 10 24 18 18 11 11 11 11 12 24 16 10 9 9 9 11 11 10 13 19 10 18 12 12 10 10 10 10 13 12 9 9 6 8 8 8 8 9 9 15 12 11 19 11 11 11 11 11 25 12 10 10 11 8 8 8 8 15 8 8 8 19 10 15 11 11 10 10 10 11 11 11 9 9 9 8 14 7 6 6 6 8 13 11 8 8 9 9 11 15 14 12 10 11 14 12 14 17 16 13 7 6 6 6 8 6 9 10 7 9 8 8 8 9 8 8 10 9 9 10 10 9 9 14 15 9 9 9 9 9 9 13 23 21 16 14 14 18 24 22 20 18 18 15

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no407_i10.g1 MSMg01no407_i10.g1 CHROMAT_FILE:
MSMg01no407_i10.g1 PHD_FILE: MSMg01no407_i10.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:23:11 2005
         (488 letters)



>mm_chr7_48935551_48936438
          Length = 888

 Score =  267 bits (138), Expect = 1e-75
 Identities = 405/510 (79%), Gaps = 48/510 (9%)
 Strand = Plus / Plus

                                                                       
Query: 1   agaattcttatgactttgtcgatataggga--atgaaacttcctttagattttcaaaatc 58
           |||||| ||||||||| || |||||| |||  |  ||| || |||||| ||||||  |||
Sbjct: 205 agaattattatgacttagtggatataaggatca--aaattttctttagtttttcactatc 262

                                                                       
Query: 59  cttcttttcaat--tcaaaaattc-cttcaag-tatattttcttgtgtacttcgtttcct 114
              |||||| ||  ||| |   || ||| ||| | |||||||||||||||||| ||||||
Sbjct: 263 ---cttttccattctcaca---tctctttaagct-tattttcttgtgtacttcttttcct 315

                                                                       
Query: 115 ctttaaaaggaaacgtgataattttgatattgttca-tattgctttccccattgatatcc 173
           ||||||||||||||||||| |||||||| || || | | ||| ||| ||  ||| ||| |
Sbjct: 316 ctttaaaaggaaacgtgatcattttgatgttattaatttttgattttcctgttgttattc 375

                                                                       
Query: 174 agtatccatgatc----ctttgtcctgtatggatcaccagataatttgaatattttcagt 229
           | |||||||||||     ||||||||| ||| | ||||||||| |||||||| |||||||
Sbjct: 376 aatatccatgatcttttgtttgtcctgcatgtaacaccagatattttgaatactttcagt 435

                                                                       
Query: 230 gttatgatttca---tatatatccatagataaattaatctaagtatttcttactttgaac 286
           ||||||||||||   |||| ||  | || ||||||    ||||||    | || ||||||
Sbjct: 436 gttatgatttcagagtatagat--a-ag-taaatt----taagta----tgaccttgaac 483

                                                                       
Query: 287 t---gggttttcttgaagttcagatatactcttgagggaagagatgatgcaactgagtga 343
           |   | ||||||||||||| |||| || |||||||| |||||||||| | ||||||||||
Sbjct: 484 ttcagagttttcttgaagtccagacatgctcttgagagaagagatgaagtaactgagtga 543

                                                                       
Query: 344 aaagacacctgagtgtctagaatgttgctagagtgacaagtactgactattttatacaca 403
           |  ||| |||||||||||||||||||||||||||||||||||||||||||  || || ||
Sbjct: 544 agtgacccctgagtgtctagaatgttgctagagtgacaagtactgactatgctacaccca 603

                                                                       
Query: 404 gg-tgattttagaagaggactgtcactatttaaatttgtgagcactttctcat-ctagac 461
           |  | |||| ||||||| |||||||| ||| ||||||| ||| | ||||| || ||| ||
Sbjct: 604 gcct-atttcagaagagaactgtcaccattaaaatttgggaggaatttct-attctacac 661

                                         
Query: 462 atgtctctttt-tctattt--ttctttctt 488
           ||||   |||| |||||||  |||||||||
Sbjct: 662 atgt---ttttgtctatttctttctttctt 688


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 488
Length of database: 888
Length adjustment: 10
Effective length of query: 478
Effective length of database: 878
Effective search space:   419684
Effective search space used:   419684
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information