MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-417M09
Chromosome	7 (Build37)
Map Location	108,575,301 - 108,575,488
singlet/doublet	singlet
Overlap gene	Pde2a
Upstream gene	AU020772, Ucp3, Ucp2, Dnajb13, LOC667112, Chchd8, Mrpl48, LOC100041155, Rab6, LOC100041167, Plekhb1, B930006L02Rik, LOC100041204, Tnfrsf19l, Arhgef17, P2ry6, P2ry2, LOC100049539, EG435996, Fchsd2, EG622673, Atg16l2, Stard10, Centd2
Downstream gene	Art2a, EG630138, Art2b, Clpb, Phox2a, Inppl1, Folr2, Folr1, 3200002M19Rik, F930017I19Rik, 2400001E08Rik, Lrrc51, LOC667222, Numa1, Il18bp, Rnf121, Trpc2, Art5, Art1, Chrna10, Nup98, Frag1, Rhog, Stim1
Link	Open Mouse BAC browser

Click to get alignment info.

name	AU020772 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277939 MGI:2142166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ucp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22229 MGI:1099787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ucp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22228 MGI:109354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69387 MGI:1916637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667112 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667112
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Chchd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68185 MGI:1915435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl48 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52443 MGI:1289321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 1 Protein pseudo : _no_value

name	Rab6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19346 MGI:894313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041167 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Plekhb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27276 MGI:1351469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930006L02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319604 MGI:2442372
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041204 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 mRNAs, 3757 ESTs, 25 Proteins

name	Tnfrsf19l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320100 MGI:2443373
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207212 MGI:2673002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2ry6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233571 MGI:2673874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2ry2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18442 MGI:105107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100049539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100049539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG435996 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435996 MGI:3645951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Fchsd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207278 MGI:2448475
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG622673 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622673 MGI:3643600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 677 ESTs, 6 Proteins

name	Atg16l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73683 MGI:1920933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 56 ESTs, 1 Protein

name	Stard10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56018 MGI:1860093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Centd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Pde2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207728 MGI:2446107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Art2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11871 MGI:107546
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG630138 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630138 MGI:3644555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1180 ESTs, 4 Proteins pseudo : _no_value

name	Art2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11872 MGI:107545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clpb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20480 MGI:1100517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phox2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11859 MGI:106633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Inppl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16332 MGI:1333787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Folr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14276 MGI:95569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Folr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14275 MGI:95568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3200002M19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75430 MGI:1922680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F930017I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:791260 MGI:3707696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2400001E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66508 MGI:1913758
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69358 MGI:1916608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins

name	LOC667222 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667222
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Numa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101706 MGI:2443665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il18bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16068 MGI:1333800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75212 MGI:1922462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trpc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22064 MGI:109527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Art5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11875 MGI:107948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Art1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11870 MGI:107511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrna10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:504186 MGI:3609260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nup98 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269966 MGI:109404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frag1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233575 MGI:2385286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhog (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56212 MGI:1928370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stim1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20866 MGI:107476
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AU020772 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347499 GeneID:277939 MGI:2142166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU020772 transcript_id : NM_001017985.2

name	Ucp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892795 GeneID:22229 MGI:1099787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uncoupling protein 3 (mitochondrial, proton carrier) transcript_id : NM_009464.3

name	Ucp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801756 GeneID:22228 MGI:109354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uncoupling protein 2 (mitochondrial, proton carrier) transcript_id : NM_011671.3

name	Dnajb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29648321 GeneID:69387 MGI:1916637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) related, subfamily B, member 13 transcript_id : NM_153527.2

name	Chchd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948296 GeneID:68185 MGI:1915435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil-helix-coiled-coil-helix domain containing 8 transcript_id : NM_183270.2

name	Mrpl48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38505260 GeneID:52443 MGI:1289321
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L48 transcript_id : NM_198831.1

name	Mrpl48 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38505258 GeneID:52443 MGI:1289321
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L48 transcript_id : NM_026971.2

name	Rab6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801837 GeneID:19346 MGI:894313
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB6, member RAS oncogene family transcript_id : NM_024287.3

name	Plekhb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802374 GeneID:27276 MGI:1351469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family B (evectins) member 1 transcript_id : NM_013746.2

name	B930006L02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592074 GeneID:319604 MGI:2442372
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930006L02 gene transcript_id : NM_178764.3

name	LOC100041204 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257622 GeneID:100041204
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 129 mRNAs, 3757 ESTs, 25 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcript_id : XM_001475962.1

name	Tnfrsf19l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376970 GeneID:320100 MGI:2443373
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor necrosis factor receptor superfamily, member 19-like transcript_id : NM_177073.4

name	Arhgef17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487438 GeneID:207212 MGI:2673002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho guanine nucleotide exchange factor (GEF) 17 transcript_id : NM_001081116.1

name	P2ry6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147202 GeneID:233571 MGI:2673874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrimidinergic receptor P2Y, G-protein coupled, 6 transcript_id : NM_183168.1

name	P2ry2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354330 GeneID:18442 MGI:105107
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2Y, G-protein coupled 2 transcript_id : NM_008773.3

name	LOC100049539 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257608 GeneID:100049539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG667495 transcript_id : XM_001487794.1

name	EG435996 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82907276 GeneID:435996 MGI:3645951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG435996 transcript_id : XM_488060.2

name	Fchsd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39841024 GeneID:207278 MGI:2448475
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCH and double SH3 domains 2 transcript_id : NM_199012.1

name	EG622673 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380859 GeneID:622673 MGI:3643600
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 677 ESTs, 6 Proteins product : predicted gene, EG622673 transcript_id : XM_889462.2

name	Atg16l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257628 GeneID:73683 MGI:1920933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 53 ESTs, 1 Protein product : autophagy related 16 like 2 (S. cerevisiae), transcript variant 2 transcript_id : XM_001476205.1

name	Atg16l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257626 GeneID:73683 MGI:1920933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 56 ESTs, 1 Protein product : autophagy related 16 like 2 (S. cerevisiae), transcript variant 1 transcript_id : XM_001476186.1

name	Stard10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119709812 GeneID:56018 MGI:1860093
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : START domain containing 10 transcript_id : NM_019990.2

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92091594 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_001040111.1

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92091596 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_001040112.1

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92091598 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_027180.3

name	Centd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37655162 GeneID:69710 MGI:1916960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centaurin, delta 2 transcript_id : NM_198096.1

name	Pde2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723648 GeneID:207728 MGI:2446107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 2A, cGMP-stimulated transcript_id : NM_001008548.2

name	Art2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671576 GeneID:11871 MGI:107546
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 2a transcript_id : NM_007490.1

name	Art2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110815850 GeneID:11872 MGI:107545
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 2b transcript_id : NM_019915.2

name	Clpb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130483 GeneID:20480 MGI:1100517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ClpB caseinolytic peptidase B homolog (E. coli) transcript_id : NM_009191.3

name	Phox2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679398 GeneID:11859 MGI:106633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paired-like homeobox 2a transcript_id : NM_008887.1

name	Inppl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859565 GeneID:16332 MGI:1333787
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol polyphosphate phosphatase-like 1 transcript_id : NM_010567.1

name	Folr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679824 GeneID:14276 MGI:95569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folate receptor 2 (fetal) transcript_id : NM_008035.1

name	Folr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982844 GeneID:14275 MGI:95568
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : folate receptor 1 (adult) transcript_id : NM_008034.2

name	3200002M19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803253 GeneID:75430 MGI:1922680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3200002M19 gene transcript_id : NM_027532.2

name	F930017I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157493 GeneID:791260 MGI:3707696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Riken cDNA F930017I19 clone transcript_id : NM_001081679.1

name	2400001E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802197 GeneID:66508 MGI:1913758
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2400001E08 gene transcript_id : NM_025605.2

name	Lrrc51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380867 GeneID:69358 MGI:1916608
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 ESTs, 2 Proteins product : leucine rich repeat containing 51, transcript variant 2 transcript_id : XM_890234.2

name	Numa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29788769 GeneID:101706 MGI:2443665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear mitotic apparatus protein 1 transcript_id : NM_133947.2

name	Il18bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754313 GeneID:16068 MGI:1333800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 18 binding protein transcript_id : NM_010531.1

name	Rnf121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778931 GeneID:75212 MGI:1922462
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 121 transcript_id : NM_029211.2

name	Trpc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755886 GeneID:22064 MGI:109527
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transient receptor potential cation channel, subfamily C, member 2 transcript_id : NM_011644.1

name	Art5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25092604 GeneID:11875 MGI:107948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 5 transcript_id : NM_007491.1

name	Art1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803149 GeneID:11870 MGI:107511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosyltransferase 1 transcript_id : NM_009710.4

name	Chrna10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487260 GeneID:504186 MGI:3609260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 10 transcript_id : NM_001081424.1

name	Nup98 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930412 GeneID:269966 MGI:109404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 98 transcript_id : NM_022979.1

name	Frag1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130185 GeneID:233575 MGI:2385286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FGF receptor activating protein 1 transcript_id : NM_145583.2

name	Rhog (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254552 GeneID:56212 MGI:1928370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ras homolog gene family, member G transcript_id : NM_019566.2

name	Stim1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802100 GeneID:20866 MGI:107476
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : stromal interaction molecule 1 transcript_id : NM_009287.3

name	AU020772 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347500 GeneID:277939 MGI:2142166
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC277939 protein_id : NP_001017985.2

name	Ucp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678495 CCDS:CCDS21497.1 GeneID:22229 MGI:1099787
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IMP] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0017077 - oxidative phosphorylation uncoupler activity [Evidence IMP]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IMP]; GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0000303 - response to superoxide [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : uncoupling protein 3, mitochondrial product : uncoupling protein 3 (mitochondrial, proton carrier) protein_id : NP_033490.1

name	Ucp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543920 CCDS:CCDS21498.1 GeneID:22228 MGI:109354
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : uncoupling protein 2, mitochondrial product : uncoupling protein 2 (mitochondrial, proton carrier) protein_id : NP_035801.2

name	Dnajb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29648322 CCDS:CCDS21499.1 GeneID:69387 MGI:1916637
definition	GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : spermatogenesis apoptosis-related protein protein_id : NP_705755.2

name	Chchd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304060 GeneID:68185 MGI:1915435
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil-helix-coiled-coil-helix domain containing 8 protein_id : NP_899093.1

name	Mrpl48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38505259 GeneID:52443 MGI:1289321
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : mitochondrial ribosomal protein L48 isoform 1 protein_id : NP_081247.2

name	Mrpl48 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38505261 CCDS:CCDS21502.1 GeneID:52443 MGI:1289321
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : mitochondrial ribosomal protein L48 isoform 2 protein_id : NP_942128.1

name	Rab6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195674 CCDS:CCDS21503.1 GeneID:19346 MGI:894313
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA] [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB6A, member RAS oncogene family protein_id : NP_077249.1

name	Plekhb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305379 CCDS:CCDS21504.1 GeneID:27276 MGI:1351469
definition	GO_component : GO:0000139 - Golgi membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : PH domain containing protein in retina 1 product : pleckstrin homology domain containing, family B (evectins) member 1 protein_id : NP_038774.1

name	LOC100041204 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257623 GeneID:100041204
definition	codon_start : 1 product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) protein_id : XP_001476012.1

name	B930006L02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520227 CCDS:CCDS21505.1 GeneID:319604 MGI:2442372
definition	codon_start : 1 product : hypothetical protein LOC319604 protein_id : NP_848879.1

name	Tnfrsf19l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982219 CCDS:CCDS21506.1 GeneID:320100 MGI:2443373
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : tumor necrosis factor receptor superfamily, member 19-like protein_id : NP_796047.2

name	Arhgef17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487439 GeneID:207212 MGI:2673002
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : Rho guanine nucleotide exchange factor (GEF) 17 protein_id : NP_001074585.1

name	P2ry6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147203 CCDS:CCDS21507.1 GeneID:233571 MGI:2673874
definition	GO_function : GO:0019103 - pyrimidine nucleotide binding [Evidence IC]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0045029 - UDP-activated nucleotide receptor activity [Evidence IDA] GO_process : GO:0007165 - signal transduction [Evidence IEA]; GO:0030321 - transepithelial chloride transport [Evidence IDA] codon_start : 1 product : pyrimidinergic receptor P2Y, G-protein coupled, 6 protein_id : NP_898991.1

name	P2ry2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560661 CCDS:CCDS21508.1 GeneID:18442 MGI:105107
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : purinergic receptor P2Y, G-protein coupled 2 protein_id : NP_032799.2

name	LOC100049539 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257609 GeneID:100049539
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487844.1

name	EG435996 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907277 GeneID:435996 MGI:3645951
definition	codon_start : 1 product : similar to ribosomal protein S29 protein_id : XP_488060.2

name	Fchsd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39841025 GeneID:207278 MGI:2448475
definition	GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 note : SH3 multiple domains 3 product : FCH and double SH3 domains 2 protein_id : NP_950177.1

name	EG622673 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907223 GeneID:622673 MGI:3643600
definition	codon_start : 1 product : hypothetical protein protein_id : XP_894555.1

name	Atg16l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257629 GeneID:73683 MGI:1920933
definition	codon_start : 1 product : autophagy related 16 like 2 isoform 2 protein_id : XP_001476255.1

name	Atg16l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257627 GeneID:73683 MGI:1920933
definition	codon_start : 1 product : autophagy related 16 like 2 isoform 1 protein_id : XP_001476236.1

name	Stard10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910482 CCDS:CCDS21509.1 GeneID:56018 MGI:1860093
definition	codon_start : 1 note : serologically defined colon cancer antigen 10; serologically defined colon cancer antigen 28; phosphatidylcholine transfer protein-like product : START domain containing 10 protein_id : NP_064374.1

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92091595 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : centaurin, delta 2 isoform 3 protein_id : NP_001035200.1

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37655161 CCDS:CCDS21510.1 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : centaurin, delta 2 isoform 1 protein_id : NP_081456.2

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92091597 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4 product : centaurin, delta 2 isoform 4 protein_id : NP_001035201.1

name	Centd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37655163 GeneID:69710 MGI:1916960
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : centaurin, delta 2 isoform 2 protein_id : NP_932764.1

name	Pde2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56606121 GeneID:207728 MGI:2446107
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : phosphodiesterase 2A, cGMP-stimulated protein_id : NP_001008548.1

name	Art2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671577 GeneID:11871 MGI:107546
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ADP-ribosyltransferase 2a protein_id : NP_031516.1

name	Art2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110815851 CCDS:CCDS21512.1 GeneID:11872 MGI:107545
definition	GO_component : GO:0019897 - extrinsic to plasma membrane [Evidence TAS]; GO:0016020 - membrane [Evidence TAS] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0018120 - peptidyl-arginine ADP-ribosylation [Evidence IDA]; GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 product : ADP-ribosyltransferase 2b protein_id : NP_064299.2

name	Clpb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677983 CCDS:CCDS21513.1 GeneID:20480 MGI:1100517
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : suppressor of K+ transport defect 3 protein_id : NP_033217.1

name	Phox2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679399 CCDS:CCDS21514.1 GeneID:11859 MGI:106633
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : paired mesoderm homeobox 2a; aristaless homeobox gene homolog product : paired-like homeobox 2a protein_id : NP_032913.1

name	Inppl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859566 CCDS:CCDS21515.1 GeneID:16332 MGI:1333787
definition	codon_start : 1 exception : mismatches in translation product : inositol polyphosphate phosphatase-like 1 protein_id : NP_034697.1

name	Folr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679825 CCDS:CCDS21516.1 GeneID:14276 MGI:95569
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005542 - folic acid binding [Evidence TAS]; GO:0008517 - folic acid transporter activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006620 - posttranslational protein targeting to membrane [Evidence TAS] codon_start : 1 note : folate binding protein 2 product : folate receptor 2 (fetal) protein_id : NP_032061.1

name	Folr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982845 CCDS:CCDS21517.1 GeneID:14275 MGI:95568
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005542 - folic acid binding [Evidence TAS]; GO:0008517 - folic acid transporter activity [Evidence TAS]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence TAS] GO_process : GO:0046655 - folic acid metabolism [Evidence IMP]; GO:0006620 - posttranslational protein targeting to membrane [Evidence TAS] codon_start : 1 note : folate binding protein 1; folate receptor; folate-binding protein 1 product : folate receptor 1 (adult) protein_id : NP_032060.2

name	3200002M19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229109 CCDS:CCDS21518.1 GeneID:75430 MGI:1922680
definition	codon_start : 1 product : hypothetical protein LOC75430 protein_id : NP_081808.2

name	F930017I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157494 GeneID:791260 MGI:3707696
definition	codon_start : 1 note : catechol O-methyltransferase-like product : Riken cDNA F930017I19 clone protein_id : NP_001075148.1

name	2400001E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385060 CCDS:CCDS21519.1 GeneID:66508 MGI:1913758
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC66508 protein_id : NP_079881.1

name	Lrrc51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82907225 GeneID:69358 MGI:1916608
definition	codon_start : 1 product : leucine rich repeat containing 51 isoform 2 protein_id : XP_895327.1

name	Numa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788770 GeneID:101706 MGI:2443665
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0015631 - tubulin binding [Evidence ISS] codon_start : 1 exception : mismatches in translation product : nuclear mitotic apparatus protein 1 protein_id : NP_598708.2

name	Il18bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754314 CCDS:CCDS21522.1 GeneID:16068 MGI:1333800
definition	GO_component : GO:0005576 - extracellular region [Evidence ISS] GO_function : GO:0042007 - interleukin-18 binding [Evidence ISS]; GO:0048019 - receptor antagonist activity [Evidence ISS] GO_process : GO:0042088 - T-helper 1 type immune response [Evidence ISS] codon_start : 1 note : interferon gamma inducing factor binding protein product : interleukin 18 binding protein protein_id : NP_034661.1

name	Rnf121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778932 CCDS:CCDS21523.1 GeneID:75212 MGI:1922462
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 121 protein_id : NP_083487.2

name	Trpc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755887 CCDS:CCDS21524.1 GeneID:22064 MGI:109527
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003684 - damaged DNA binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0015279 - store-operated calcium channel activity [Evidence IDA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0007204 - elevation of cytosolic calcium ion concentration [Evidence IPI]; GO:0006811 - ion transport [Evidence IEA]; GO:0000012 - single strand break repair [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : transient receptor protein 2; transient receptor potential 2-like protein product : transient receptor potential cation channel, subfamily C, member 2 protein_id : NP_035774.1

name	Art5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25092605 CCDS:CCDS21525.1 GeneID:11875 MGI:107948
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IEA]; GO:0003953 - NAD+ nucleosidase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation function : NAD glycohydrolysis product : ADP-ribosyltransferase 5 precursor protein_id : NP_031517.1

name	Art1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21687250 CCDS:CCDS21526.1 GeneID:11870 MGI:107511
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0003956 - NAD(P)+-protein-arginine ADP-ribosyltransferase activity [Evidence IEA]; GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 product : ADP-ribosyltransferase 1 protein_id : NP_033840.2

name	Chrna10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487261 GeneID:504186 MGI:3609260
definition	codon_start : 1 product : cholinergic receptor, nicotinic, alpha polypeptide 10 protein_id : NP_001074893.1

name	Nup98 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930413 CCDS:CCDS21528.1 GeneID:269966 MGI:109404
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005487 - nucleocytoplasmic transporter activity [Evidence IEA]; GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006913 - nucleocytoplasmic transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nucleoporin 98 protein_id : NP_075355.1

name	Frag1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704172 GeneID:233575 MGI:2385286
definition	GO_component : GO:0005634 - nucleus [Evidence IMP] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0042770 - DNA damage response, signal transduction [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IMP] codon_start : 1 product : FGF receptor activating protein 1 protein_id : NP_663558.1

name	Rhog (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9625037 CCDS:CCDS21529.1 GeneID:56212 MGI:1928370
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence ISS]; GO:0016601 - Rac protein signal transduction [Evidence ISS]; GO:0000074 - regulation of progression through cell cycle [Evidence ISS]; GO:0007266 - Rho protein signal transduction [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : aplysia ras-related homolog G (RhoG); ras homolog G (RhoG) product : ras homolog gene family, member G protein_id : NP_062512.1

name	Stim1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981983 CCDS:CCDS21530.1 GeneID:20866 MGI:107476
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence ISS] [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0032237 - activation of store-operated calcium channel activity [Evidence ISS]; GO:0006816 - calcium ion transport [Evidence IEA]; GO:0005513 - detection of calcium ion [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0051924 - regulation of calcium ion transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : stromal interaction molecule 1 protein_id : NP_033313.2

name	LOC667112 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667112
definition	number : 1 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 5 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 4 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 3 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 2 pseudo : _no_value

name	LOC667222 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667222
definition	number : 1 pseudo : _no_value

name	LOC100041155 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257618 GeneID:100041155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 33 ESTs, 1 Protein product : similar to RIKEN cDNA 2310005N03 pseudo : _no_value transcript_id : XR_032447.1

name	LOC100041167 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257619 GeneID:100041167
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to cytochrome c oxidase subunit IV pseudo : _no_value transcript_id : XR_032453.1

name	EG630138 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149257610 GeneID:630138 MGI:3644555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 1180 ESTs, 4 Proteins product : predicted gene, EG630138 pseudo : _no_value transcript_id : XR_001600.2

clone name	MSMg01-529A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110P09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063L10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-484E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-129E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312H15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397D04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072L08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-417M09.T7 (MSMg01no417_m09.b1)	MSMg01-417M09.TJ (MSMg01no417_m09.g1)
ACC	AG513275	AG513276
length	1,128	777
length of high quality (start - end)	---	190 (127 - 316)
definition	CHROMAT_FILE: MSMg01no417_m09.b1 PHD_FILE: MSMg01no417_m09.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:36:46 2005	CHROMAT_FILE: MSMg01no417_m09.g1 PHD_FILE: MSMg01no417_m09.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 18:36:46 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	CCATCAAAAAATTTGNGGGCACGCAAAAAGAGACCCAACGAATACAAAAG AAGAGATGGCCGCGGAAANNCCATTATTTCCACAACAAAGAACCGGCGCA TGAAACTCCACAGCACGATCCTACCTGTTTCCCTCGCCTCGCCTGATTTG CCTAGCGCCCTTATCGCGCGTCACTCACCTATCTACTCCACCAGCACATT TCCCTCTATTCGCCTATCACAATAACTCGTCTCTCACCGAGCCATCTTTC GCGGCATGACCCATCCTCCTGCTTACGCTCTGCTTCCTACACCCACTTTC CCATACACCCATGCCTCATCAGTATGCTTTTACTAGACTGTATCGTCACG GTCTTCTCACACCCACCCACCTCTCTCTCGTCATCACTGTACAGTGCCCT TCATAGGCACAAACATTTTTTTTTCCGAATCCTCACTCCGCTTACTCGTT TTATTACTGCTCCCGCCCTCTTACTACCTATTCCTTTTATACGCATCATA TTTTGTCACCCACCTGTGATGCACGTCTTCACCACCCATATCATCCCCCT TTCCTTCACATTTTTTCTACAATCCTTCTATATGCACGCCGATTTTTATA AACCTTTTCCCGTTTACATTCCCTCACCACTACTCATTTTATCTCCTCCG CCACTCTTCTGGGCTCTATAATGCTTATATTTTCTTCGACTCTACAAAGC TTTTACCCCTATCCTCTACTTAAATATACTCGCATCCCCTATTCTCTTTC ACTCTCCTTTATGTTCTTACCCTTCCTTTCACATTCAACTCTATCTCTGT AGCGCCTCGATCTATCCACTTACTCTTTTCACCACCTATAAATCTCGTAT TAATCTAGATCAACACACCTACCTACACGCCCNTATATTGCCTCTCACTT ATATTCGCCTTTTATAGACTCCTTCTGTACTTATTAATTCGCGCTAAATC ACGATTTCTCTATTTATTTCCTCCTTCCCCTATACCTTACCGCATTTTAT CCCTCTACTATTTATCTCGCGCTCTTCACCCTCCACACGATTTCTTCGCC TCTCTCCCAGCGCATCATATTCACTCTAATATTTATTACACTCGAGCAAT GTAACCATATCTACGCTTGTCTATTTCG	TCGATGCTGTGTGTAGGCCGGGGGGCCGCCTGTTTCAAAACATGTAGGTG AACTATAGATGTACCAGCAGAATTCGGTGAGGGCTCATATAGAGGCTAGC TGCTGTCACTGTAGAACACCCACACTCACCTACACTTTTAGACCACGGCT AGGAGCCCAGAGAGCGTCAGTGTGTGGGAAAGACAGGAGGCGGTGGGTGT GGTGAGAGGCACAGATGCTCTGTGGGCAGAAGGAGGTGTCTGATGGACAT AAGACCACCTTTCTAGGCTGCACCTGCCTGGTCTGAGGCCAACCCCCAGA GGGTACATTGGAAGTATTTTTCTCTGATGAAGGGGTTAAACTCGTGGCCA CACCCACATCTTCTTGAGTCATTACGGGAATTGTAGTTCGGCGTGACCTT GTACTACTTTCACTTGCCCTCATCTCTTTTTAGTCAAATCTACACCCTGT TGCTTAGGCTGGTATTTGTCCCGTCCCTTTATTTTCCTCCTTTTATCTCG CTACTTTCTCTTTTGTTCCCTTTTTGCTCTCTTCCCTCGCTTTCGCCCGC CCTGTTTCCCTTTCCCTCCTTCCCCTTTCCCTTTCCCTCTTTTTCCTCCT CCTTCCTTTCCCCTTTCCTCCCCACCTTTCCCCCTTTTTCCTTCTCTTTC CCTCCTCCTCTTTTTTTTCTCCCCTTTTCCTCCCCCCCCCCTTTCCCCTT CTCCTCTTTTTTTTCCTTCCTTCTTTTCTCCCTTTCCCTTTCTTTCTCTG CCCCTTCTTCTCCTCCTCTCCTCCTCG
quality values	Open. Hide. 8 8 7 7 10 10 14 26 30 33 27 25 13 13 3 0 3 6 8 6 6 8 8 8 15 13 12 15 6 6 6 6 8 7 7 7 7 6 6 6 6 6 6 8 6 7 6 6 6 6 6 8 8 8 8 6 6 6 6 6 10 10 22 22 17 12 12 3 0 0 3 11 11 17 8 8 7 7 7 7 6 6 7 8 8 8 11 7 7 6 6 6 7 10 10 10 9 8 8 8 8 6 6 7 15 17 17 12 10 15 10 6 8 6 6 8 8 10 19 19 11 8 8 8 13 10 15 13 11 8 8 8 9 12 14 9 12 12 11 11 9 9 10 10 10 6 6 6 7 12 13 12 11 8 8 8 10 11 18 15 21 11 8 8 8 8 8 8 8 8 8 8 8 9 12 12 16 14 15 11 6 6 6 11 15 9 9 8 8 6 6 7 8 6 6 6 7 10 12 17 16 18 17 21 21 13 12 12 24 15 15 12 10 11 8 8 8 9 8 9 8 9 9 10 10 10 11 8 8 8 8 8 8 8 10 10 8 10 13 10 8 8 8 8 8 8 10 8 8 6 6 6 8 8 8 8 6 6 6 6 11 8 6 6 8 8 10 10 11 10 10 8 8 8 8 8 10 10 9 8 8 8 8 8 8 10 8 8 8 8 10 10 10 8 10 8 9 13 10 10 8 6 6 8 8 9 10 6 8 7 7 8 6 12 11 11 11 12 12 12 10 10 10 10 15 15 11 11 6 6 6 6 6 10 8 8 6 6 8 8 9 8 8 8 8 8 8 10 8 10 8 8 8 15 13 10 8 8 8 8 8 8 8 8 8 8 6 8 8 8 9 12 10 10 11 11 9 9 8 8 8 8 8 8 6 8 10 10 9 8 8 10 8 8 8 8 15 13 14 14 12 12 7 6 8 8 9 9 9 14 13 9 8 8 8 7 8 10 14 14 23 12 11 10 10 9 8 8 8 8 15 9 16 10 11 8 8 8 8 8 8 10 9 11 10 9 9 13 12 9 10 9 8 8 6 6 6 6 8 8 6 6 8 8 8 8 10 10 8 8 10 10 10 10 10 8 8 11 8 8 8 8 10 10 17 18 12 8 8 8 10 8 8 9 9 8 8 8 8 10 10 13 15 15 10 10 12 15 14 12 8 6 6 10 10 12 8 8 6 6 8 6 8 8 8 8 8 8 8 8 12 10 8 8 8 8 6 6 8 8 8 8 8 8 8 12 10 15 11 10 10 13 10 10 8 8 8 9 12 10 10 9 10 10 8 10 8 8 8 10 11 14 10 10 10 10 10 9 10 9 9 9 9 9 9 9 9 8 8 8 8 8 8 10 6 7 6 7 8 6 10 8 8 8 8 8 9 12 13 10 8 6 6 6 6 9 9 9 10 12 15 18 18 14 14 12 10 10 10 8 6 6 8 8 10 10 10 8 10 8 8 8 8 8 8 8 6 6 8 6 6 6 6 6 8 9 10 8 8 11 9 9 9 9 13 13 12 10 9 8 8 8 8 10 11 11 10 10 11 12 14 17 9 8 8 6 6 6 6 11 12 9 9 10 8 8 8 8 8 10 10 10 10 11 10 10 13 16 14 8 8 6 6 6 6 10 6 7 7 7 6 6 8 8 10 10 8 10 9 10 8 7 7 12 10 12 9 16 10 9 9 9 11 11 11 13 10 10 8 7 6 6 8 6 6 6 6 6 8 7 7 7 10 12 19 11 10 9 9 8 7 7 9 12 11 16 14 17 9 10 9 8 13 8 10 8 8 8 8 8 8 8 8 9 10 8 8 8 13 10 10 10 9 8 8 8 13 9 9 9 8 8 6 6 8 8 6 6 6 10 15 12 12 9 9 15 15 17 10 8 6 6 8 6 8 12 6 6 6 6 10 7 7 11 8 6 6 6 8 8 8 9 9 10 8 8 6 8 8 6 6 6 10 10 10 9 9 8 8 8 8 8 10 8 8 8 10 13 10 10 10 3 0 3 8 8 8 13 13 12 13 12 14 14 14 10 11 8 8 8 8 9 10 8 6 6 6 8 6 9 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 6 6 6 8 8 8 6 6 6 11 10 9 7 10 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 11 8 8 6 6 7 7 6 11 6 6 6 7 7 8 7 9 7 7 14 14 14 11 12 11 6 6 6 6 6 10 10 7 6 6 6 6 6 6 8 8 8 9 13 15 17 9 9 9 9 7 7 6 8 9 7 10 6 8 8 10 10 8 8 8 8 8 8 9 9 13 9 9 9 11 9 10 10 13 13 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 8 7 10 6 9 8 8 8 8 8 8 8 10 10 8 10 9 8 8 8 8 8 8 9 9 10 12 12 15 10 10 11 11 10 10 10 11 11 8 8 8 9 9 10 10 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 10 10 10 9 9 7 8 8 8 8 8 10 9 9	Open. Hide. 6 6 6 6 8 9 9 9 9 13 11 8 8 8 10 8 9 10 12 12 9 9 9 9 9 10 19 17 19 13 9 9 6 7 7 6 6 6 9 9 9 9 10 6 6 6 6 12 17 21 10 10 10 10 13 10 10 9 9 9 9 7 7 6 6 8 8 8 8 10 11 12 19 19 15 17 23 23 19 19 9 9 9 9 19 18 18 18 24 34 28 28 28 37 37 30 30 14 14 14 30 30 57 59 33 24 19 18 18 23 30 25 19 16 11 16 16 20 23 18 9 9 9 9 11 26 15 23 23 37 32 32 31 18 18 31 35 30 30 14 14 14 26 23 32 29 29 35 35 37 39 32 32 18 18 17 27 17 24 31 29 37 37 43 47 44 40 23 20 20 30 30 41 41 41 41 41 43 32 34 27 37 37 28 28 22 28 23 25 25 24 24 20 23 20 25 25 32 36 32 37 37 35 35 39 39 39 44 39 41 41 32 30 30 37 43 48 54 57 43 42 30 28 24 24 20 23 23 21 21 15 15 18 24 24 28 28 33 37 43 48 46 46 39 39 23 21 11 11 11 12 11 11 15 28 24 26 17 24 30 41 41 59 43 39 39 35 37 33 47 35 47 40 40 40 43 33 33 34 25 25 28 28 26 26 14 15 15 18 28 23 23 15 28 28 31 23 33 33 37 43 39 30 26 15 13 13 15 28 32 34 23 10 8 6 6 10 8 9 8 8 8 7 10 10 22 16 24 22 28 28 32 28 28 28 30 37 30 30 28 28 34 31 32 28 18 15 15 13 13 13 19 21 32 28 16 13 8 8 8 8 8 10 21 22 13 13 12 18 18 20 16 19 10 10 10 10 13 15 24 32 37 32 28 17 14 12 21 15 11 11 14 19 15 22 12 12 12 27 17 16 11 11 11 12 12 12 17 11 11 11 12 12 19 15 8 8 8 10 6 6 8 8 8 11 11 16 30 19 18 12 11 10 9 9 9 9 11 12 24 16 15 11 11 12 20 15 13 9 8 8 8 9 9 11 9 10 10 17 15 10 10 12 11 11 7 12 9 6 8 8 8 8 10 10 8 8 8 8 8 8 8 11 8 11 12 11 11 11 9 9 9 9 10 9 8 8 7 6 8 8 10 10 10 13 11 12 11 11 14 10 8 8 8 8 8 8 8 8 8 17 13 11 10 11 8 8 6 6 10 12 15 10 9 10 6 8 6 6 8 6 10 10 10 13 11 10 10 10 14 10 10 9 9 9 10 10 15 10 11 19 19 17 19 10 10 9 10 10 13 13 15 18 21 28 33 29 29 28 28 22 20 18 14 11 10 8 8 8 10 19 19 12 9 9 10 8 12 9 10 10 15 19 19 16 12 11 11 19 14 15 15 8 8 8 10 15 19 19 16 15 18 8 9 9 9 15 17 25 22 17 15 13 14 15 14 13 14 10 12 12 12 9 9 9 9 8 19 8 8 8 8 13 8 8 10 10 8 8 8 8 8 8 11 11 12 12 8 7 7 13 24 32 20 18 17 25 13 8 8 8 8 8 8 11 18 23 32 30 22 14 14 14 14 14 11 15 9 9 9 9 9 9 11 10 17 15 18 22 23 21 9 8 10 8 8 8 8 8 8 11 11 15 10 10 14 12 12 10 9 9 11 11 11 11 15 18 19 14 11 12 14 13 10 10 8 8 9 9 9 9 10 11 9 9 10 15 19 13 12 8 8 8 8 8 8 19 13 8 10 10 10 12 8 8 7 7

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no417_m09.g1 MSMg01no417_m09.g1 CHROMAT_FILE:
MSMg01no417_m09.g1 PHD_FILE: MSMg01no417_m09.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 18:36:46 2005
         (190 letters)



>mm_chr7_108575101_108575690
          Length = 590

 Score =  356 bits (184), Expect = e-103
 Identities = 187/188 (99%)
 Strand = Plus / Plus

                                                                       
Query: 1   cacctacacttttagaccacggctaggagcccagagagcgtcagtgtgtgggaaagacag 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 201 cacctacacttttagaccacggctaggagcccagagagcgtcagtgtgtgggaaagacag 260

                                                                       
Query: 61  gaggcggtgggtgtggtgagaggcacagatgctctgtgggcagaaggaggtgtctgatgg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 261 gaggcggtgggtgtggtgagaggcacagatgctctgtgggcagaaggaggtgtctgatgg 320

                                                                       
Query: 121 acataagaccacctttctaggctgcacctgcctggtctgaggccaacccccagagggtac 180
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 321 acataagaccacctttctaggctgcacctgcctggtctgaggccaacccccagaaggtac 380

                   
Query: 181 attggaag 188
           ||||||||
Sbjct: 381 attggaag 388


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 190
Length of database: 590
Length adjustment: 8
Effective length of query: 182
Effective length of database: 582
Effective search space:   105924
Effective search space used:   105924
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information