MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-466N24
Chromosome	7 (Build37)
Map Location	54,838,306 - 54,838,710
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Sergef, Tph1, Saal1, Saa3, Saa4, LOC100040106, Saa1, Saa2, Hps5, Gtf2h1, EG668838, EG384622, Ldha, Ldhc, Tsg101, Uevld, C86187, LOC384623, ENSMUSG00000056509, Spty2d1, LOC100040174, Tmem86a, Ptpn5, LOC100041710, Mrgpra6, EG668725, Gm660, Mrgpra1, LOC668846, LOC100040217, LOC668727, Mrgpra2, LOC638950, Mrgprc4-ps, LOC677457, EG668729
Downstream gene	Mrgpra3, Mrgprc1-ps, LOC100040314, Mrgprc3-ps, EG435977, EG619792, Mrgprc7-ps, Mrgpra18-ps, EG435978, Mrgprc2-ps, Mrgpra4, Mrgprx1, Mrgprb7-ps, Mrgprb12-ps, EG270335, Mrgprb5, Mrgprb4, Mrgprb13, Mrgprb8, Mrgprb1, Mrgprx2, Mrgprb2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Sergef (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27414 MGI:1351630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tph1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21990 MGI:98796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78935 MGI:1926185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 113 ESTs, 2 Proteins

name	Saa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20210 MGI:98223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saa4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20211 MGI:98224
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040106 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040106
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Saa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20208 MGI:98221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Saa2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20209 MGI:98222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hps5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246694 MGI:2180307
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gtf2h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14884 MGI:1277216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668838 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668838 MGI:3643262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 ESTs, 52 Proteins

name	EG384622 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384622 MGI:3647739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 11 Proteins

name	Ldha (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16828 MGI:96759
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ldhc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16833 MGI:96764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsg101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22088 MGI:106581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uevld (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54122 MGI:1860490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C86187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97402 MGI:2142361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 153 ESTs

name	LOC384623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins pseudo : _no_value

name	ENSMUSG00000056509 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629141 MGI:3642801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Spty2d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101685 MGI:2142062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040174 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tmem86a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67893 MGI:1915143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19259 MGI:97807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041710 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	Mrgpra6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381886 MGI:3033107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668725 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668725 MGI:3644999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm660 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269919 MGI:2685506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins

name	Mrgpra1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233221 MGI:3033095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668846 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC100040217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668727 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 41 Proteins

name	Mrgpra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235712 MGI:3033098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins

name	Mrgprc4-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404257 MGI:3033197
definition	gene_synonym : MrgC4 note : MAS-related GPR, member C4, pseudogene pseudo : _no_value

name	LOC677457 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:677457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins

name	EG668729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668729 MGI:3644993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	Mrgpra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233222 MGI:2684085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprc1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:269921 MGI:3033136
definition	gene_synonym : MrgC1 note : MAS-related GPR, member C1, pseudogene pseudo : _no_value

name	LOC100040314 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Mrgprc3-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404256 MGI:3033196
definition	gene_synonym : MrgC3 note : MAS-related GPR, member C3, pseudogene pseudo : _no_value

name	EG435977 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435977 MGI:3642992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	EG619792 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619792 MGI:3647950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Mrgprc7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404255 MGI:3033141
definition	gene_synonym : MrgC7 note : MAS-related GPR, member C7, pseudogene pseudo : _no_value

name	Mrgpra18-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404262 MGI:3033177
definition	gene_synonym : MrgA18 note : MAS-related GPR, member A18, pseudogene pseudo : _no_value

name	EG435978 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:435978 MGI:3647104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins

name	Mrgprc2-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404254 MGI:3033137
definition	gene_synonym : MrgC2 note : MAS-related GPR, member C2, pseudogene pseudo : _no_value

name	Mrgpra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235854 MGI:3033100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404242 MGI:3033139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb7-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404252 MGI:3033123
definition	gene_synonym : MrgB7 note : MAS-related GPR, member B7, pseudogene pseudo : _no_value

name	Mrgprb12-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404264 MGI:3033192
definition	gene_synonym : MrgB12 note : MAS-related GPR, member B12, pseudogene pseudo : _no_value

name	EG270335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270335 MGI:3644283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein

name	Mrgprb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404239 MGI:3033121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233230 MGI:3033119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:620137 MGI:3033193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins

name	Mrgprb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404240 MGI:3033134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233231 MGI:3033115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243978 MGI:3588270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrgprb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243979 MGI:2441674
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sergef (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305092 GeneID:27414 MGI:1351630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : secretion regulating guanine nucleotide exchange factor transcript_id : NM_013789.1

name	Tph1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49274628 GeneID:21990 MGI:98796
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tryptophan hydroxylase 1 transcript_id : NM_009414.2

name	Saal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380480 GeneID:78935 MGI:1926185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 113 ESTs, 2 Proteins product : serum amyloid A-like 1, transcript variant 1 transcript_id : XM_620495.3

name	Saa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130197 GeneID:20210 MGI:98223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 3 transcript_id : NM_011315.3

name	Saa4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802298 GeneID:20211 MGI:98224
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 4 transcript_id : NM_011316.3

name	Saa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130531 GeneID:20208 MGI:98221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 1 transcript_id : NM_009117.3

name	Saa2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755393 GeneID:20209 MGI:98222
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serum amyloid A 2 transcript_id : NM_011314.1

name	Hps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52546697 GeneID:246694 MGI:2180307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 5 homolog (human) transcript_id : NM_001005248.1

name	Hps5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52546701 GeneID:246694 MGI:2180307
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Hermansky-Pudlak syndrome 5 homolog (human) transcript_id : NM_001005247.1

name	Gtf2h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388290 GeneID:14884 MGI:1277216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : general transcription factor II H, polypeptide 1 transcript_id : NM_008186.3

name	EG668838 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380482 GeneID:668838 MGI:3643262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 82 ESTs, 52 Proteins product : predicted gene, EG668838 transcript_id : XM_001004974.1

name	EG384622 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94380435 GeneID:384622 MGI:3647739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 11 Proteins product : predicted gene, EG384622 transcript_id : XM_357752.4

name	Ldha (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754523 GeneID:16828 MGI:96759
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactate dehydrogenase A transcript_id : NM_010699.1

name	Ldhc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348349 GeneID:16833 MGI:96764
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactate dehydrogenase C transcript_id : NM_013580.3

name	Tsg101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375824 GeneID:22088 MGI:106581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor susceptibility gene 101 transcript_id : NM_021884.3

name	Uevld (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:104294889 GeneID:54122 MGI:1860490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UEV and lactate/malate dehyrogenase domains transcript_id : NM_001040695.1

name	C86187 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257310 GeneID:97402 MGI:2142361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 153 ESTs product : expressed sequence C86187 transcript_id : XM_001477244.1

name	ENSMUSG00000056509 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257312 GeneID:629141 MGI:3642801
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : predicted gene, ENSMUSG00000056509 transcript_id : XM_001477255.1

name	Spty2d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592079 GeneID:101685 MGI:2142062
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae) transcript_id : NM_175318.3

name	LOC100040174 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257260 GeneID:100040174
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040174 transcript_id : XM_001474210.1

name	Tmem86a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803294 GeneID:67893 MGI:1915143
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 86A transcript_id : NM_026436.2

name	Ptpn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305424 GeneID:19259 MGI:97807
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 5 transcript_id : NM_013643.1

name	LOC100041710 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257314 GeneID:100041710
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100041710 transcript_id : XM_001477303.1

name	Mrgpra6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517721 GeneID:381886 MGI:3033107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A6 transcript_id : NM_205821.2

name	EG668725 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257187 GeneID:668725 MGI:3644999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG668725 transcript_id : XM_001471922.1

name	Gm660 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257316 GeneID:269919 MGI:2685506
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins product : gene model 660, (NCBI) transcript_id : XM_195647.6

name	Mrgpra1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346520 GeneID:233221 MGI:3033095
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A1 transcript_id : NM_153095.1

name	LOC668727 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94380441 GeneID:668727
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 41 Proteins product : similar to Mrgpra2 protein transcript_id : XM_001003345.1

name	Mrgpra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802843 GeneID:235712 MGI:3033098
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A2 transcript_id : NM_153101.2

name	LOC638950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257262 GeneID:638950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 37 Proteins product : similar to MRGA G protein-coupled receptor transcript_id : XM_001474357.1

name	LOC677457 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257264 GeneID:677457
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 47 Proteins product : similar to MAS-related GPR, member A4 transcript_id : XM_001474409.1

name	Mrgpra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346466 GeneID:233222 MGI:2684085
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A3 transcript_id : NM_153067.1

name	LOC100040314 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149257266 GeneID:100040314
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to MAS-related GPR, member A4 transcript_id : XM_001474490.1

name	EG435977 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257268 GeneID:435977 MGI:3642992
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : predicted gene, EG435977 transcript_id : XM_488036.4

name	EG435978 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257273 GeneID:435978 MGI:3647104
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 40 Proteins product : predicted gene, EG435978 transcript_id : XM_884240.3

name	Mrgpra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23943788 GeneID:235854 MGI:3033100
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member A4 transcript_id : NM_153524.1

name	Mrgprx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351339 GeneID:404242 MGI:3033139
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member X1 transcript_id : NM_207540.2

name	EG270335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149257319 GeneID:270335 MGI:3644283
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 59 ESTs, 1 Protein product : predicted gene, EG270335, transcript variant 1 transcript_id : XM_194527.7

name	Mrgprb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430531 GeneID:404239 MGI:3033121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B5 transcript_id : NM_207538.1

name	Mrgprb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45429987 GeneID:233230 MGI:3033119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B4 transcript_id : NM_205795.1

name	Mrgprb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82906020 GeneID:620137 MGI:3033193
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 Proteins product : MAS-related GPR, member B13 transcript_id : XM_884524.1

name	Mrgprb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430533 GeneID:404240 MGI:3033134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B8 transcript_id : NM_207539.1

name	Mrgprb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356046 GeneID:233231 MGI:3033115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B1 transcript_id : NM_205810.3

name	Mrgprx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802509 GeneID:243978 MGI:3588270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member X2 transcript_id : NM_001034868.2

name	Mrgprb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801044 GeneID:243979 MGI:2441674
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAS-related GPR, member B2 transcript_id : NM_175531.3

name	Sergef (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305093 CCDS:CCDS21279.1 GeneID:27414 MGI:1351630
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005087 - Ran guanyl-nucleotide exchange factor activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 product : guanine nucleotide exchange factor (RCC1 related) protein_id : NP_038817.1

name	Tph1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678411 CCDS:CCDS21280.1 GeneID:21990 MGI:98796
definition	GO_function : GO:0016597 - amino acid binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004510 - tryptophan 5-monooxygenase activity [Evidence IEA] GO_process : GO:0009072 - aromatic amino acid family metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0042427 - serotonin biosynthesis [Evidence IEA]; GO:0006587 - serotonin biosynthesis from tryptophan [Evidence IEA] codon_start : 1 product : tryptophan hydroxylase 1 protein_id : NP_033440.1

name	Saal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63557363 GeneID:78935 MGI:1926185
definition	codon_start : 1 product : serum amyloid A-like 1 isoform 1 protein_id : XP_620495.1

name	Saa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755396 CCDS:CCDS21282.1 GeneID:20210 MGI:98223
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 product : serum amyloid A 3 protein_id : NP_035445.1

name	Saa4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755398 CCDS:CCDS21283.1 GeneID:20211 MGI:98224
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 product : serum amyloid A 4 protein_id : NP_035446.1

name	Saa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677843 CCDS:CCDS21284.1 GeneID:20208 MGI:98221
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : serum amyloid A 2 product : serum amyloid A 1 protein_id : NP_033143.1

name	Saa2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755394 CCDS:CCDS21285.1 GeneID:20209 MGI:98222
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006953 - acute-phase response [Evidence IEA] codon_start : 1 note : serum amyloid A 1 product : serum amyloid A 2 protein_id : NP_035444.1

name	Hps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52546702 CCDS:CCDS21286.1 GeneID:246694 MGI:2180307
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006996 - organelle organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; ruby eye 2 product : Hermansky-Pudlak syndrome 5 isoform 1 protein_id : NP_001005247.1

name	Hps5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52546698 CCDS:CCDS21286.1 GeneID:246694 MGI:2180307
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006996 - organelle organization and biogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; ruby eye 2 product : Hermansky-Pudlak syndrome 5 isoform 2 protein_id : NP_001005248.1

name	Gtf2h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982313 CCDS:CCDS21287.1 GeneID:14884 MGI:1277216
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : general transcription factor IIH, polypeptide 1 (62kD subunit); general transcription factor II H, polypeptide 1 (62kD subunit) product : general transcription factor II H, polypeptide 1 protein_id : NP_032212.2

name	EG668838 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380483 GeneID:668838 MGI:3643262
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001004974.1

name	EG384622 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94380436 GeneID:384622 MGI:3647739
definition	codon_start : 1 product : similar to interferon-inducible protein 16 protein_id : XP_357752.4

name	Ldha (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754524 CCDS:CCDS21289.1 GeneID:16828 MGI:96759
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004459 - L-lactate dehydrogenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0019642 - anaerobic glycolysis [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA] codon_start : 1 note : lactate dehydrogenase-A product : lactate dehydrogenase 1, A chain protein_id : NP_034829.1

name	Ldhc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305229 CCDS:CCDS21290.1 GeneID:16833 MGI:96764
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0004459 - L-lactate dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0019642 - anaerobic glycolysis [Evidence IEA]; GO:0006096 - glycolysis [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA] codon_start : 1 note : LDH testis subunit; lactate dehydrogenase-X product : lactate dehydrogenase 3, C chain, sperm specific protein_id : NP_038608.1

name	Tsg101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11230780 CCDS:CCDS21291.1 GeneID:22088 MGI:106581
definition	GO_component : GO:0005634 - nucleus [Evidence IC] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0007050 - cell cycle arrest [Evidence IDA]; GO:0030154 - cell differentiation [Evidence IDA]; GO:0030216 - keratinocyte differentiation [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006464 - protein modification [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IDA]; GO:0006810 - transport [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : tumor susceptibility gene 101 protein protein_id : NP_068684.1

name	Uevld (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:104294890 GeneID:54122 MGI:1860490
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0004459 - L-lactate dehydrogenase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006096 - glycolysis [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006100 - tricarboxylic acid cycle intermediate metabolism [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : signaling molecule ATTP protein_id : NP_001035785.1

name	C86187 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257311 GeneID:97402 MGI:2142361
definition	codon_start : 1 product : hypothetical protein LOC97402 protein_id : XP_001477294.1

name	ENSMUSG00000056509 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257313 GeneID:629141 MGI:3642801
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477305.1

name	Spty2d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592080 CCDS:CCDS21293.1 GeneID:101685 MGI:2142062
definition	codon_start : 1 note : P16H6 product : SPT2, Suppressor of Ty, domain containing 1 protein_id : NP_780527.2

name	LOC100040174 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257261 GeneID:100040174
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474260.1

name	Tmem86a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312738 GeneID:67893 MGI:1915143
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67893 protein_id : NP_080712.1

name	Ptpn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305425 CCDS:CCDS21294.1 GeneID:19259 MGI:97807
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : protein tyrosine phosphatase, non-receptor type 5 protein_id : NP_038671.1

name	LOC100041710 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257315 GeneID:100041710
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477353.1

name	Mrgpra6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517722 GeneID:381886 MGI:3033107
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MrgA6 G protein-coupled receptor product : MAS-related GPR, member A6 protein_id : NP_991390.2

name	EG668725 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257188 GeneID:668725 MGI:3644999
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471972.1

name	Gm660 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257317 GeneID:269919 MGI:2685506
definition	codon_start : 1 product : similar to G-protein coupled adenine receptor protein_id : XP_195647.6

name	Mrgpra1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346521 CCDS:CCDS21295.1 GeneID:233221 MGI:3033095
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : RF-amide G protein-coupled receptor product : MAS-related GPR, member A1 protein_id : NP_694735.1

name	LOC668727 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94380442 GeneID:668727
definition	codon_start : 1 product : similar to Mrgpra2 protein protein_id : XP_001003345.1

name	Mrgpra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346531 CCDS:CCDS21296.1 GeneID:235712 MGI:3033098
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Mas-related gene A2; G protein-coupled receptor MrgA2 product : MAS-related GPR, member A2 protein_id : NP_694741.1

name	LOC638950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257263 GeneID:638950
definition	codon_start : 1 product : similar to MRGA G protein-coupled receptor protein_id : XP_001474407.1

name	LOC677457 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257265 GeneID:677457
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_001474459.1

name	Mrgpra3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346467 CCDS:CCDS21297.1 GeneID:233222 MGI:2684085
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor; Mas-related gene A3 product : G protein-coupled receptor MRGA3 protein_id : NP_694707.1

name	LOC100040314 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149257267 GeneID:100040314
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_001474540.1

name	EG435977 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257269 GeneID:435977 MGI:3642992
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_488036.4

name	EG435978 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149257274 GeneID:435978 MGI:3647104
definition	codon_start : 1 product : similar to MAS-related GPR, member A4 protein_id : XP_889333.3

name	Mrgpra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943789 CCDS:CCDS21298.1 GeneID:235854 MGI:3033100
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MrgA4 RF-amide G protein-coupled receptor product : MAS-related GPR, member A4 protein_id : NP_705744.1

name	Mrgprx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430536 CCDS:CCDS21299.1 GeneID:404242 MGI:3033139
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS-related GPR, member C11 protein_id : NP_997423.1

name	EG270335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82906029 GeneID:270335 MGI:3644283
definition	codon_start : 1 product : similar to LOC635138 protein isoform 1 protein_id : XP_194527.5

name	Mrgprb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430532 CCDS:CCDS21300.1 GeneID:404239 MGI:3033121
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS-related GPR, member B5 protein_id : NP_997421.1

name	Mrgprb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45429988 CCDS:CCDS21301.1 GeneID:233230 MGI:3033119
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : MrgB4 G protein-coupled receptor product : MAS-related GPR, member B4 protein_id : NP_991364.1

name	Mrgprb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82906021 GeneID:620137 MGI:3033193
definition	codon_start : 1 product : similar to MRGB8 protein_id : XP_889617.1

name	Mrgprb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430534 CCDS:CCDS21302.1 GeneID:404240 MGI:3033134
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : MAS-related GPR, member B8 protein_id : NP_997422.1

name	Mrgprb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370266 GeneID:233231 MGI:3033115
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MrgB1 G protein-coupled receptor product : MAS-related GPR, member B1 protein_id : NP_991379.2

name	Mrgprx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781696 GeneID:243978 MGI:3588270
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MAS-related GPR, member B10 protein_id : NP_001030040.1

name	Mrgprb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425306 CCDS:CCDS21303.1 GeneID:243979 MGI:2441674
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MAS-related GPR, member B2 protein_id : NP_780740.1

name	LOC100040106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040106
definition	number : 3 pseudo : _no_value

name	LOC100040106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040106
definition	number : 2 pseudo : _no_value

name	LOC100040106 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040106
definition	number : 1 pseudo : _no_value

name	LOC100040217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040217
definition	number : 2 pseudo : _no_value

name	LOC100040217 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040217
definition	number : 1 pseudo : _no_value

name	EG668729 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668729
definition	number : 2 pseudo : _no_value

name	EG668729 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668729
definition	number : 1 pseudo : _no_value

name	EG619792 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619792
definition	number : 2 pseudo : _no_value

name	EG619792 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619792
definition	number : 1 pseudo : _no_value

name	LOC384623 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257309 GeneID:384623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins product : similar to RNA polymerase II transcription factor SIII p18 subunit pseudo : _no_value transcript_id : XR_033136.1

name	LOC668846 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149257318 GeneID:668846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to 1300018J18Rik protein pseudo : _no_value transcript_id : XR_033182.1

clone name	MSMg01-439E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-152N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-134H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-403A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-279K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186E15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062J12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410M11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-466N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-339I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-141I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-450L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412H11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-167K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-408F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-276D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-362E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251L13
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-466N24.T7 (MSMg01no466_n24.b1)	MSMg01-466N24.TJ (MSMg01no466_n24.g1)
ACC	AG550719	AG550720
length	847	778
length of high quality (start - end)	---	417 (81 - 497)
definition	CHROMAT_FILE: MSMg01no466_n24.b1 PHD_FILE: MSMg01no466_n24.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:42:32 2005	CHROMAT_FILE: MSMg01no466_n24.g1 PHD_FILE: MSMg01no466_n24.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:42:33 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	plural
sequence	NNNAAGGCCCCCNNNNNCCCCCCCCAAACAACCCCNANATTCCCCAAACA CCGCGNNAANCACAGCTTTTCCGAAAAAGAGNAANAANNCCCCNANCNNC CNNNCCANNNAANGANAANCGNCNACCNAAANCCCCANCNGNCCNAANNA AACCCCNAANGAAAACCTNNNNCCCNCCCCCGCCNGAAAAGACGGGTTAT CGCGGCGTCCTGTCTTGCTCTCTNAANNNATCCNNNNNAGAGATAAAAGG GGCGTGGCTGCTTGTCTTGGAACAAACAACCCAAANNNNNNNNNNNNNNN NNNNNNNNNNNNNNNAAACCCCTTTTTAAAAACCCCCGGAATAAATCCCC CCCCAAATCCCCAACAAAAAAAACTACCCCCCCCCCNNNAACCCCCCCCC CCCCCCCCAACACNCACANNANCCCCCCCCCACCCNNCTCCCCCCCCCCN CCCNNNCCCNCNNNCNNNNNNCCNCNNCCCCCCCCCCCCACCCCCCCCCC CNCCCCCCCCCCCCCCCCCCCCNCCCCCCCCCCCCCCNCCCCCCNNCCCC CCCACCCCCCCNACCCCCCCCCCCCCCCCCCCCCCCCCCCCCNCCCCCCC CCCCCCCCCCCCCCCCCCCTCCCCCCNNTTTCCCCNCCCCCCCCCCCCCC CCCCACCCCCCCCCTCNCCCCCCCCCCCCCCCCCCCCCCCACCCNCCCCC CCCNCCCCCNCCCCCCCCCCCACCACCCCCCACCCCCCCNCCNACCCCCA CCCCCCACCCCCTTCCCCCCCCCACACCCCCCCACCCCCCATAACCCCCC CCCCNCCCCCCCCCCCCCCCCCTTCCCTTTATATTTTGAGTGGTTGT	NTTTCCCCGATGCTATGGGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTGATGTTCTTCTTTCTTTAC AAAATTGTAATAAAGATAGGAATCATATTAAAAGAAGTGTTTATGACAGA GAAACAGAAGAAAATATTTGTCTTAGTGAGCTATCTGCATTCCTGGACAG ACTTCTCATACCAGAAGTTTTCTGATATTATAGGAAAACAAAGTACACAC CTGCTGCCTTTGTTTAAGCAAGGGCTGCACAATATTTTAAGAATCAAAAA AGAAAAAAAGGAAGGTGGTCTTATATCAAATATAAAAGAAATATAGAGGA AGAAAGGAAGAATTAAACAGGGGTTAAAGAGACTGAATTTTAGTAGAAAT CCAAGATTGATATAATAGGCATTAGGAAATAACTTTTGATCTATTAATTT GGTGTCAAAGTGAAACAGAATAAAATTCAAATAGAATCACCCTGACTAGT ATTCTGTAACCACCAGGTTTTAGGACACCAGGCTTCAGGAAGAATATTTT GAATTAAAAGGAAATTGATTTTATCATCATGGTTAATTTAGTTCCCATAA AATTGCGGGTTGGTTTACTTTGGTCCCCTTTTCAAAACCCCCTGTTATTT ATGGAAAACTTTTTAGGGCAAATAATTTTTAAAAACATGGGTGATTTTTT TGTGTAATCTTCACCTGTTTTACAATGGTTTTATAGGTACTCAAAAAATA AAAGTTGTGGGTTCTCTCCCTCCCCCTG
quality values	Open. Hide. 0 0 0 3 6 6 6 6 9 7 7 3 0 0 0 0 0 3 7 7 9 9 9 9 9 12 9 24 9 9 9 9 7 7 3 0 3 0 3 9 9 8 7 7 7 6 8 6 6 6 15 19 21 23 3 0 0 3 3 0 3 17 21 23 9 11 11 19 17 12 12 8 8 8 9 11 11 15 18 15 3 0 3 3 0 3 3 0 0 3 7 7 3 0 3 0 3 0 0 3 3 0 0 0 3 7 3 0 0 0 3 3 0 3 3 0 3 3 0 3 3 0 3 0 3 21 3 0 3 13 3 0 3 8 8 8 3 0 3 0 3 0 3 3 0 3 3 0 0 3 11 17 15 11 8 3 0 3 3 0 3 16 8 9 9 7 7 3 0 0 0 0 3 8 3 0 3 7 7 8 7 8 11 3 0 3 8 8 9 9 12 10 10 9 9 9 11 6 6 6 6 6 6 6 6 6 8 6 7 8 10 8 6 6 6 8 6 6 6 6 6 6 3 0 3 3 0 0 0 3 9 9 3 0 0 0 0 0 3 6 6 6 6 8 9 9 9 9 9 8 8 6 6 6 6 8 7 8 10 8 9 9 8 8 8 8 8 8 8 8 10 8 8 10 10 9 6 6 6 6 6 6 9 9 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 11 8 10 8 8 8 7 12 10 12 12 10 11 10 10 10 10 11 13 14 10 8 8 6 6 6 6 6 6 6 6 8 10 15 28 25 15 12 10 10 9 9 8 17 12 8 10 6 6 6 10 7 19 19 19 11 11 11 9 8 10 8 10 12 14 13 11 12 13 3 0 0 0 3 8 7 8 8 11 13 18 19 19 16 14 23 22 33 24 16 16 9 9 8 8 6 3 0 3 8 11 3 0 0 3 0 3 12 11 27 23 28 15 15 8 8 8 17 3 0 0 3 7 7 7 7 12 9 9 9 7 17 3 0 3 21 3 0 0 0 3 11 3 0 3 0 0 0 3 0 0 0 0 0 0 3 3 0 3 0 0 3 17 19 13 9 9 9 9 14 10 10 10 10 10 26 27 21 23 21 21 21 19 17 3 0 3 18 19 25 29 24 24 21 39 41 37 37 27 28 27 25 19 16 16 3 0 3 27 27 30 30 19 13 9 9 10 22 19 21 3 0 3 18 19 19 18 3 0 0 3 14 15 25 22 22 8 6 6 10 15 8 8 10 3 0 3 9 13 19 9 9 9 9 9 16 19 23 21 17 19 21 10 10 10 10 10 8 9 9 9 9 24 19 17 3 0 3 17 19 30 30 47 37 37 23 21 12 11 11 23 21 28 30 31 31 31 35 31 41 21 19 8 8 8 15 13 13 13 3 0 0 3 10 6 6 8 7 3 0 3 7 7 7 9 9 19 12 15 21 18 23 23 24 17 12 12 8 6 6 7 7 12 12 18 21 21 19 15 3 0 3 7 7 9 9 24 30 30 30 33 29 24 9 9 9 9 9 17 22 25 21 17 8 8 8 17 3 0 3 11 21 21 24 7 7 3 0 3 7 7 14 3 0 3 23 23 24 23 19 14 17 19 22 12 8 8 6 6 6 8 8 6 6 6 7 10 9 15 12 8 8 3 0 3 3 0 3 11 11 16 16 9 9 9 18 18 23 24 12 11 9 11 8 13 22 19 19 9 8 10 12 9 9 9 9 6 17 8 18 17 19 22 21 21 8 8 6 9 9 9 17 17 10 10 8 8 6 6 13 22 30 22 19 11 9 10 3 0 3 7 7 9 9 9 21 19 23 15 15 9 9 10 14 20 12 12 10 10 10 10 10 11 11 8 8 8 8 10 10 6 6 6 6 11 10 10 10 10 9 9	Open. Hide. 0 3 7 7 13 13 6 8 8 8 10 9 8 8 6 6 7 7 6 8 8 10 23 29 23 17 3 0 3 3 0 3 21 21 18 23 9 6 6 7 7 6 6 6 6 6 10 12 20 15 15 23 23 33 33 33 33 39 37 59 34 29 15 8 6 6 6 6 7 7 8 18 18 11 9 9 14 15 18 23 33 33 33 33 41 53 59 59 59 59 59 59 57 57 57 57 57 42 42 36 42 42 42 48 68 68 68 68 68 68 68 68 68 54 54 46 43 42 32 28 28 28 24 20 20 28 28 28 28 34 41 48 48 59 50 50 50 50 50 46 47 50 57 57 57 57 57 57 50 48 48 38 41 41 57 57 68 57 57 48 48 41 21 19 10 10 10 23 23 57 57 57 68 57 57 57 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 44 43 35 28 36 36 35 28 34 41 59 68 68 68 68 68 68 68 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 31 29 12 11 12 9 12 12 12 12 11 12 12 23 19 34 36 59 59 59 59 59 59 59 59 53 53 57 57 53 53 59 59 59 59 59 59 59 59 59 59 59 68 68 59 59 48 48 46 43 43 37 39 37 43 39 43 43 43 47 47 48 59 59 59 59 54 54 54 54 54 54 54 54 57 57 57 68 68 68 68 68 59 57 57 57 57 57 48 48 48 57 57 57 57 57 57 57 48 48 48 48 50 50 59 59 59 59 59 59 32 28 28 39 39 39 47 47 47 47 50 50 59 50 50 47 59 47 47 47 39 30 27 27 32 32 29 31 20 20 20 28 28 28 28 39 39 47 37 39 31 35 39 39 41 37 37 39 37 37 39 41 40 40 35 31 31 35 39 37 37 33 27 27 22 22 24 34 34 33 33 28 23 19 19 12 16 10 19 19 14 15 10 10 10 14 15 10 10 8 8 8 9 9 10 11 10 11 14 11 11 11 12 13 13 17 21 11 11 9 9 8 10 8 9 8 9 8 8 9 9 8 8 10 9 9 11 16 16 9 11 7 7 6 8 11 8 10 12 17 17 9 9 9 8 8 8 8 8 8 10 10 12 10 10 10 9 12 9 9 9 12 10 11 8 8 8 8 8 8 8 11 11 10 10 10 12 14 14 9 9 9 8 8 9 8 8 8 11 11 17 15 15 10 10 10 13 13 9 9 12 10 11 12 12 15 13 9 8 9 9 10 10 12 14 18 17 18 12 10 10 9 9 9 8 8 6 6 8 8 10 10 8 7 7 7 11 14 13 10 10 10 15 12 11 10 10 6 8 7 8 7 9 9 8 9 8 8 10 12 11 10 10 10 10 12 10 12 15 11 12 10 14 14 14 10 10 9 9 8 8 8 10 8 8 8 8 8 6 6 6 6 6 6 8 11 12 11 11 11 11 11 11 15 17 19 23 15 15 10 10 8 8 8 8 6 8 6 6 8 8 12 12 19 11 11 10 8 8 8 8 8 8 8 8 8 8 8 10 8 8 6 6 8 8 9 13 12 10 9 11 11 8 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no466_n24.g1 MSMg01no466_n24.g1 CHROMAT_FILE:
MSMg01no466_n24.g1 PHD_FILE: MSMg01no466_n24.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:42:33 2005
         (417 letters)



>mm_chr7_54838104_54838910
          Length = 807

 Score =  398 bits (206), Expect = e-115
 Identities = 362/418 (86%), Gaps = 16/418 (3%)
 Strand = Plus / Plus

                                                                       
Query: 3   atgttcttct-ttctttacaaaattgtaataaagataggaatcatattaaaagaagtgtt 61
           |||||||||| ||||||||| |||||||||||||| ||||||  |||| ||| ||| |||
Sbjct: 203 atgttcttctattctttacagaattgtaataaagacaggaattgtattgaaataagggtt 262

                                                                       
Query: 62  tatgacagagaaacagaagaaaata-tttgtcttagtgagctatctgcattcctggacag 120
            |||||  ||| | ||| |||| || |||| ||||||||| | |||| || |||||||||
Sbjct: 263 catgac--agatatagaggaaattattttggcttagtgagttgtctgtatgcctggacag 320

                                                                       
Query: 121 acttctcataccagaagttttctgatattataggaaaacaaagtacacacctgctgcctt 180
           || | ||| |||||||  ||||||||||||||||||||||||| ||| ||||||| ||| 
Sbjct: 321 ac-tgtcagaccagaacatttctgatattataggaaaacaaagaacaaacctgcttcctg 379

                                                                       
Query: 181 tgtttaagcaagggctgcacaatattttaagaatcaaaaaagaaaaaaaggaaggtggtc 240
           || |||||||||||||||||||||||||||||||||||   ||||||  ||| |||||||
Sbjct: 380 tgcttaagcaagggctgcacaatattttaagaatcaaa---gaaaaa--ggatggtggtc 434

                                                                       
Query: 241 ttatatcaaatataaaagaaatatagaggaagaaaggaagaattaaacaggggttaaaga 300
           | ||  ||||||||||||||||||||||||||||||||||||||||||||| || |||||
Sbjct: 435 tcatgccaaatataaaagaaatatagaggaagaaaggaagaattaaacaggagtgaaaga 494

                                                                       
Query: 301 gactgaa-ttttagtagaaatccaagattgatataataggcattaggaaataacttttga 359
             ||||| |||| | ||||||||||| ||||||||| ||||| |||||||||||||||||
Sbjct: 495 --ctgaactttt-gcagaaatccaagcttgatataacaggcagtaggaaataacttttga 551

                                                                     
Query: 360 tctattaatttggtgtcaaagtgaaacagaataaaattcaaatagaatcaccctgact 417
           ||||| ||| |||||||||| ||||||||||| ||||||||||||  |||||||||||
Sbjct: 552 tctatgaatgtggtgtcaaaatgaaacagaatcaaattcaaatag--tcaccctgact 607


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 8
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 417
Length of database: 807
Length adjustment: 9
Effective length of query: 408
Effective length of database: 798
Effective search space:   325584
Effective search space used:   325584
X1: 8 (15.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 8 (16.4 bits)
S2: 8 (16.2 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information