MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-532F01
Chromosome	7 (Build37)
Map Location	36,429,893 - 36,430,095
singlet/doublet	singlet
Overlap gene	Pdcd5
Upstream gene	Kctd15, Chst8, Pepd, Cebpg, Cebpa, Slc7a10, Wdr88, Gpatch1, Rhpn2, C230052I12Rik, Ccdc123, Slc7a9, 2410004F06Rik, Nudt19, Rgs9bp, Ankrd27
Downstream gene	Dpy19l3, zfp507, LOC100043872, EG668988, LOC668507
Link	Open Mouse BAC browser

Click to get alignment info.

name	Kctd15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233107 MGI:2385276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68947 MGI:1916197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pepd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18624 MGI:97542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cebpg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12611 MGI:104982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cebpa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12606 MGI:99480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53896 MGI:1858261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr88 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384605 MGI:2686275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Gpatch1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67471 MGI:1914721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhpn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52428 MGI:1289234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C230052I12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101831 MGI:2142208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72140 MGI:1919390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30962 MGI:1353656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410004F06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71981 MGI:1919231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nudt19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110959 MGI:94203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rgs9bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:243923 MGI:2384418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245886 MGI:2444103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdcd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56330 MGI:1913538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpy19l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:233115 MGI:2443952
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	zfp507 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668501 MGI:1916378
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 123 ESTs, 3 Proteins

name	LOC100043872 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 128 ESTs, 3 Proteins

name	EG668988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668988 MGI:3648375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	LOC668507 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668507
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Kctd15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122736 GeneID:233107 MGI:2385276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 15 transcript_id : NM_146188.1

name	Chst8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982166 GeneID:68947 MGI:1916197
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 transcript_id : NM_175140.3

name	Pepd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679278 GeneID:18624 MGI:97542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidase D transcript_id : NM_008820.1

name	Cebpg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62177114 GeneID:12611 MGI:104982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCAAT/enhancer binding protein (C/EBP), gamma transcript_id : NM_009884.2

name	Cebpa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131886531 GeneID:12606 MGI:99480
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCAAT/enhancer binding protein (C/EBP), alpha transcript_id : NM_007678.3

name	Slc7a10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354184 GeneID:53896 MGI:1858261
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 10 transcript_id : NM_017394.3

name	Wdr88 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256552 GeneID:384605 MGI:2686275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : WD repeat domain 88 transcript_id : XM_001480144.1

name	Gpatch1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385691 GeneID:67471 MGI:1914721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G patch domain containing 1 transcript_id : NM_026181.1

name	Rhpn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365567 GeneID:52428 MGI:1289234
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rhophilin, Rho GTPase binding protein 2 transcript_id : NM_027897.3

name	C230052I12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353107 GeneID:101831 MGI:2142208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C230052I12 gene transcript_id : NM_178643.4

name	Ccdc123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802193 GeneID:72140 MGI:1919390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 123 transcript_id : NM_028120.2

name	Slc7a9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892346 GeneID:30962 MGI:1353656
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 9 transcript_id : NM_021291.2

name	2410004F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:128485848 GeneID:71981 MGI:1919231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410004F06 gene transcript_id : NM_001082581.1

name	2410004F06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130497316 GeneID:71981 MGI:1919231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410004F06 gene transcript_id : NM_028034.2

name	Nudt19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94158949 GeneID:110959 MGI:94203
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 19 transcript_id : NM_033080.2

name	Rgs9bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40556382 GeneID:243923 MGI:2384418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulator of G-protein signalling 9 binding protein transcript_id : NM_145840.2

name	Ankrd27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988392 GeneID:245886 MGI:2444103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 27 (VPS9 domain) transcript_id : NM_145633.3

name	Ankrd27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125988396 GeneID:245886 MGI:2444103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat domain 27 (VPS9 domain) transcript_id : NM_178263.3

name	Pdcd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130647 GeneID:56330 MGI:1913538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death 5 transcript_id : NM_019746.4

name	Dpy19l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341222 GeneID:233115 MGI:2443952
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dpy-19-like 3 (C. elegans) transcript_id : NM_178704.2

name	zfp507 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256556 GeneID:668501 MGI:1916378
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 123 ESTs, 3 Proteins product : zinc finger protein 507 transcript_id : XM_145521.10

name	LOC100043872 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256728 GeneID:100043872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 101 ESTs, 2 Proteins product : similar to Ac2-210, transcript variant 1 transcript_id : XM_001481154.1

name	LOC100043872 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149256730 GeneID:100043872
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 123 ESTs, 2 Proteins product : similar to Ac2-210, transcript variant 2 transcript_id : XM_001481155.1

name	EG668988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149256558 GeneID:668988 MGI:3648375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins product : predicted gene, EG668988 transcript_id : XM_001006666.2

name	Kctd15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122737 CCDS:CCDS21141.1 GeneID:233107 MGI:2385276
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 15 protein_id : NP_666300.1

name	Chst8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982167 CCDS:CCDS21142.1 GeneID:68947 MGI:1916197
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0001537 - N-acetylgalactosamine 4-O-sulfotransferase activity [Evidence IDA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007417 - central nervous system development [Evidence ISS]; GO:0042446 - hormone biosynthesis [Evidence ISS]; GO:0016486 - peptide hormone processing [Evidence TAS]; GO:0030166 - proteoglycan biosynthesis [Evidence IDA] [Evidence ISS] codon_start : 1 exception : mismatches in translation note : N-acetylgalactosamine 4 sulfotransferase; GalNAc4ST-1 product : carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8 protein_id : NP_780349.2

name	Pepd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679279 CCDS:CCDS21143.1 GeneID:18624 MGI:97542
definition	GO_function : GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008235 - metalloexopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004251 - X-Pro dipeptidase activity [Evidence IDA] GO_process : GO:0030574 - collagen catabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : peptidase 4 protein_id : NP_032846.1

name	Cebpg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61966683 CCDS:CCDS21144.1 GeneID:12611 MGI:104982
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence NAS]; GO:0043565 - sequence-specific DNA binding [Evidence ISS] [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0030183 - B cell differentiation [Evidence IEP]; GO:0006338 - chromatin remodeling [Evidence TAS]; GO:0043353 - enucleate erythrocyte differentiation [Evidence IMP]; GO:0006955 - immune response [Evidence IDA]; GO:0001889 - liver development [Evidence ISS]; GO:0042267 - natural killer cell mediated cytotoxicity [Evidence IMP]; GO:0043433 - negative regulation of transcription factor activity [Evidence IDA]; GO:0006337 - nucleosome disassembly [Evidence TAS]; GO:0043388 - positive regulation of DNA binding [Evidence ISS]; GO:0045739 - positive regulation of DNA repair [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence IMP]; GO:0051091 - positive regulation of transcription factor activity [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : G-CSF promoter element 1 binding protein; GPE1-BP (C/EBP gamma) product : CCAAT/enhancer binding protein (C/EBP), gamma protein_id : NP_034014.1

name	Cebpa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86198301 CCDS:CCDS21145.1 GeneID:12606 MGI:99480
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0042803 - protein homodimerization activity [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence NAS] [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS] GO_process : GO:0048469 - cell maturation [Evidence IMP]; GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence NAS]; GO:0001892 - embryonic placenta development [Evidence IGI]; GO:0045444 - fat cell differentiation [Evidence IDA]; GO:0030324 - lung development [Evidence IMP]; GO:0030225 - macrophage differentiation [Evidence IMP]; GO:0007005 - mitochondrion organization and biogenesis [Evidence IMP]; GO:0030099 - myeloid cell differentiation [Evidence IDA]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence NAS] [Evidence IEA] codon_start : 1 note : C/EBP alpha product : CCAAT/enhancer binding protein alpha protein_id : NP_031704.2

name	Slc7a10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980853 CCDS:CCDS21146.1 GeneID:53896 MGI:1858261
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence NAS] [Evidence ISS] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015175 - neutral amino acid transporter activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0015804 - neutral amino acid transport [Evidence IDA] codon_start : 1 exception : mismatches in translation product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 10 protein_id : NP_059090.2

name	Wdr88 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256553 GeneID:384605 MGI:2686275
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001480194.1

name	Gpatch1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385692 CCDS:CCDS21147.1 GeneID:67471 MGI:1914721
definition	codon_start : 1 product : evolutionarily conserved G-patch domain containing protein_id : NP_080457.1

name	Rhpn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980674 CCDS:CCDS21148.1 GeneID:52428 MGI:1289234
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : rhophilin, Rho GTPase binding protein 2 protein_id : NP_082173.2

name	C230052I12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519993 CCDS:CCDS21149.1 GeneID:101831 MGI:2142208
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC101831 protein_id : NP_848758.1

name	Ccdc123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386288 GeneID:72140 MGI:1919390
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : coiled-coil domain containing 123 protein_id : NP_082396.1

name	Slc7a9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11225268 CCDS:CCDS21150.1 GeneID:30962 MGI:1353656
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0015175 - neutral amino acid transporter activity [Evidence ISS]; GO:0042605 - peptide antigen binding [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015804 - neutral amino acid transport [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : b, +AT; b, + amino acid transporter product : glycoprotein-associated amino acid transporter b0,+AT1 protein_id : NP_067266.1

name	2410004F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:128485849 GeneID:71981 MGI:1919231
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC71981 isoform 1 protein_id : NP_001076050.1

name	2410004F06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312598 CCDS:CCDS21151.1 GeneID:71981 MGI:1919231
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC71981 isoform 2 protein_id : NP_082310.1

name	Nudt19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94158950 CCDS:CCDS21152.1 GeneID:110959 MGI:94203
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : androgen regulated gene RP2 product : nudix (nucleoside diphosphate linked moiety X)-type motif 19 protein_id : NP_149071.2

name	Rgs9bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22748609 CCDS:CCDS21153.1 GeneID:243923 MGI:2384418
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS] GO_process : GO:0050908 - detection of light stimulus during visual perception [Evidence IMP] codon_start : 1 note : RGS9-1 anchor; RGS9 anchor protein product : regulator of G protein signaling 9-binding protein protein_id : NP_665839.1

name	Ankrd27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125988393 CCDS:CCDS21154.1 GeneID:245886 MGI:2444103
definition	GO_component : GO:0005769 - early endosome [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS] GO_process : GO:0045022 - early endosome to late endosome transport [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; mFLJ00040 protein product : VPS9-ankyrin repeat-containing protein isoform 1 protein_id : NP_663608.3

name	Ankrd27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46849724 GeneID:245886 MGI:2444103
definition	GO_component : GO:0005769 - early endosome [Evidence ISS] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS] GO_process : GO:0045022 - early endosome to late endosome transport [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; mFLJ00040 protein product : VPS9-ankyrin repeat-containing protein isoform 2 protein_id : NP_839994.1

name	Pdcd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790259 GeneID:56330 MGI:1913538
definition	GO_process : GO:0006915 - apoptosis [Evidence ISS] [Evidence IEA] codon_start : 1 product : programmed cell death 5 protein_id : NP_062720.1

name	Dpy19l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520117 CCDS:CCDS21155.1 GeneID:233115 MGI:2443952
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dpy-19-like 3 protein_id : NP_848819.1

name	zfp507 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256557 GeneID:668501 MGI:1916378
definition	codon_start : 1 product : zinc finger protein 507 protein_id : XP_145521.8

name	LOC100043872 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256729 GeneID:100043872
definition	codon_start : 1 product : similar to Ac2-210 isoform 1 protein_id : XP_001481204.1

name	LOC100043872 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149256731 GeneID:100043872
definition	codon_start : 1 product : similar to Ac2-210 isoform 2 protein_id : XP_001481205.1

name	EG668988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149256559 GeneID:668988 MGI:3648375
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006666.2

name	LOC668507 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668507
definition	number : 1 pseudo : _no_value

clone name	MSMg01-494O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487N23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356M05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-407M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475O04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-213I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-405C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468B03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-455J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-532F01.T7 (MSMg01no532_f01.b1)	MSMg01-532F01.TJ (MSMg01no532_f01.g1)
ACC	AG600504	AG600505
length	1,141	883
length of high quality (start - end)	---	206 (81 - 286)
definition	CHROMAT_FILE: MSMg01no532_f01.b1 PHD_FILE: MSMg01no532_f01.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:09:12 2005	CHROMAT_FILE: MSMg01no532_f01.g1 PHD_FILE: MSMg01no532_f01.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 21:09:12 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TTCTCTCGTCCCTAGTNTCGCTTTTTTATTTCTCTCGTTGTTTCCTAAGG ATTGCGCGGGCGCTCCAAGAGTTGGTTCGCCGTTTTATTTGTACTGCACT ATATTTCGCAGAGTGATCCGGCGGGCAATTACACTTTTGGTATTACCCGA GACCGCGCCCTCAAAACTTCAGTAAATTCTTGCTCTTGCTCTTCTGTCCT TCCCAAAGTAGCCTAGGCGTATGCAAATAGGATGCTGCCGTTCCACCCTT TGTCCTCTGCGCTTGTTCTATGTGCCCACTCTTGACGTAGGTTTACATCT CCCTTTTTTGGCTTCCACATTTTTCACACTCACATAACTTTGCACATAAT CGTTTGCCCCTTTTTAAAAAGAATAGTTACACGGAGGAAACTTCTTTACA ACTGATCGTCTTTTTTTCTATCTGTTTACAAACTTTGGTTCCGTTGAAAC CACATATATTATATCCTTTTTTTCCCTCTCCGCTCTCGTTTTGTTTTTTA TTTTTTTTCCTCCATCGCTCCACCTTTTTTATTTTAATACCATATCATTC TTTTCAGTTCTATTTATATACTCTCTGCTCTTCCCTATATACCACACCAT AAATTCTCTCTTGTGTCTCCATCATAACCCCAGTAGGTAATTATGTAACG CTTCTTCCTTAATTACTCTATCTATAGCCACACTCCTAATATTTATTATA TGCCCATAATCCTCTATTTTATCTTTTGCGCCTAAACGCCAATGATTACC TGTCCATCTTATTGTTGTTTTGGTTTCCGCCACCGTATAGTACCCGGATT CGTATTCCTCACCTGCGCGATATTACTATTATCTATGTCTATCTCAATAT TCGGTCCCTCTTATGTTACACGCCTTATTTGTTTCTCCTCTGTGGACCAT GTGTTGATGCTTATGAGTTTTCTTGTTTTACCCACGCATCTATAATTCAT TTCTTATACTACCGTCTTCTTCTTGCACCTCCCTTCTTATTATTTTCTAG TTATGTTCCCGCTTTCTGATCTCTCTTATACACGCTTCTTTACCTCTTCT CCTCTTCTTTATCCCTTCCTCTTCTATCTCGTCCTATGTCTTCTTTTCGC TGTCTTTTTAATCATTATTCCTTCCCTCTTATTCCAGACCG	TTTTCAATGAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTGAGCCTGCTTGAGCTCCAT AGCTAAACCCTGCCTCCAAAAAGGTTTGAAAGCAGTGTGCCACAGTTCCT ACTTGAGTATTCAGGAAGAAGCGATGCTTGCAGAGTTACAATTTCACAGG ATCTGGTTCTGCCTCTGCCACAGTGTTTCAGAATCTCCATAAGTCTCTGT CGTCCTCCCTAAAGAAAGTCCACTTGTCTGTCTATACTGCCTTAGGGNNN TCCTCCTCTCTTACTTTCCATTTTATTTTTTATGTTTTTTTATTATTTCT ATTTTTTCTTTATTATTTTTTGTTCATATATTTTTGATCTTTATCTACTC CTTATACTATTATACTACACGTCTTACTACCTTTGTGTAATTTTTTTTTG CCTTCTCCTTGTTATATTTTACTCCTTTTTTCTATCTTCCTTTTCTGTTC TTTTATTTTTGTTATTACTTTACTTTCTCTGCCCTCTCTTTTTTTCCTTC GTATCCTTCCTCTCTTTATTTCTTATTTTTATATCTTTCCTCCATTTTCT GTATTTATTTCTCGTCACTTTTTTCTTCTTTTTCCTTCTATTCTTCTTTC TTTTTATATTTTATCTTTAATGCTTTTGTTGTTATTTTATTTAATCTGTT TTCTTTTTATGATTGTTATTTCTGGTTGTTTTCTTATATGACTCACCTCC TTATCTCTTTTTTGTTTCTTTTTTCCTTTTGCACTTTATCATACTATGAT CCTTTATATTATTCTTATTCCTTCTTCTTTTTCGTTTTTATTTATATTCT CTATCACTCTCCTCGATTATCTTTTTCTTTTTC
quality values	Open. Hide. 14 14 14 14 10 8 8 6 6 8 8 8 8 8 8 3 0 3 10 10 10 10 12 14 11 9 8 8 8 8 9 8 8 8 8 8 8 8 8 6 6 6 6 6 8 8 8 8 9 8 8 8 8 8 10 10 8 8 8 8 8 9 8 8 8 8 11 8 8 6 7 10 12 8 9 10 8 8 8 8 10 8 10 8 13 6 6 8 15 12 14 14 12 12 14 16 10 10 13 18 11 8 8 8 8 8 8 8 8 13 15 8 7 6 7 8 8 8 8 10 9 10 8 9 8 8 9 10 8 8 8 8 10 8 10 11 11 11 10 10 8 8 12 13 20 15 6 6 6 13 6 6 8 15 8 9 8 9 8 9 9 12 11 11 9 9 10 9 8 8 10 10 9 9 13 11 6 6 6 10 7 7 6 6 8 9 7 8 8 8 8 10 10 15 14 9 8 8 8 8 8 8 13 8 10 10 14 16 10 10 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 11 10 8 8 8 8 8 10 9 9 10 6 7 8 8 11 12 10 9 9 10 11 10 10 8 12 6 9 10 6 8 8 8 8 10 8 8 8 12 12 9 9 9 9 8 8 10 8 8 8 8 8 8 8 10 6 7 8 8 8 10 6 6 6 6 8 8 8 8 9 8 10 8 6 6 6 6 6 7 11 12 12 12 7 7 6 6 8 8 10 8 8 8 8 8 10 16 14 10 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 12 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 10 10 9 9 8 8 8 8 9 9 9 10 11 11 11 9 9 9 8 8 8 8 8 10 10 8 9 9 9 9 10 13 12 12 10 8 8 8 8 10 7 6 8 8 8 8 8 8 8 8 10 10 12 10 10 8 8 8 10 8 8 8 10 8 10 9 9 10 11 8 8 12 12 11 11 12 10 11 12 12 10 8 8 8 8 8 8 10 12 10 9 9 9 9 10 10 10 8 10 8 8 8 10 11 11 11 13 9 11 8 8 8 8 10 8 8 6 6 6 8 13 8 8 8 8 8 8 8 10 12 10 10 8 8 8 12 10 9 9 10 12 12 10 12 10 10 10 8 8 8 8 6 6 8 6 9 9 17 11 12 12 12 13 11 9 9 8 8 8 8 8 8 8 7 7 8 8 8 8 8 8 8 8 8 6 6 8 8 12 15 22 13 8 6 6 6 8 8 8 8 7 9 10 13 8 8 7 6 8 8 8 8 8 10 8 6 6 8 8 8 8 8 8 10 8 6 6 10 10 8 10 8 6 8 6 6 8 8 9 9 8 6 6 6 6 8 12 10 10 8 8 6 8 10 6 7 8 8 8 8 8 8 10 6 6 6 6 6 6 6 8 6 6 6 6 8 8 8 8 8 8 8 8 6 6 10 10 8 8 7 7 8 10 11 13 11 11 12 12 9 12 11 8 8 8 8 8 8 10 8 8 9 9 9 9 11 10 10 10 8 8 8 8 8 8 12 11 14 11 11 9 8 8 8 8 8 8 8 8 8 7 7 10 8 9 7 8 7 7 7 8 9 8 8 10 10 10 10 13 16 8 8 8 8 10 8 8 8 8 8 8 12 12 11 8 8 8 6 8 8 8 8 8 9 10 8 6 6 8 6 9 9 9 6 6 6 6 8 6 8 8 8 8 6 10 6 6 8 6 8 8 8 8 11 8 8 6 6 10 10 13 13 10 8 8 8 6 6 6 6 6 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 6 8 6 6 8 9 9 10 12 12 8 11 10 10 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 8 10 6 10 6 6 6 8 9 9 9 13 8 12 8 8 8 8 10 9 9 7 8 8 8 8 8 8 8 8 8 11 6 6 6 8 8 8 8 10 10 10 10 8 11 10 10 9 9 10 10 8 8 8 8 8 13 10 8 6 8 8 8 9 8 8 6 6 8 8 8 8 12 16 8 8 8 8 8 12 8 9 9 10 10 8 8 6 6 6 6 9 11 8 8 6 7 6 6 8 8 8 8 8 8 8 8 8 8 10 10 12 10 8 8 8 8 8 8 8 10 9 10 10 12 13 10 10 9 10 10 10 10 10 10 8 8 8 11 11 8 10 6 8 6 6 12 10 10 11 6 6 6 6 6 6 6 6 6 8 8 10 8 9 9 10 10 8 8 8 8 8 10 10 7 7 8 8 10 10 8 10 10 10 11 6 6 6 6 8 12 17 17 10 8 8 8 8 6 6 6 8 8 8 11 9 9 8 8 8 10 10 6 6 6 7 7 9 9 9 14 15 18 20 18 11 10 8 8 8 6 6 6 6 8 8 11 11 8 8 8 8 10 10 10 11 10 9 9 8 8 8 8 8 8 10 10 8 8 8 8 8 8 10 8 7 9 9 10 10 10 10 9 10 11 17 11 8 10 10 12 14 10 15 10 8 8 8 6 6 6 6 6 6	Open. Hide. 9 13 8 8 7 8 8 12 11 11 11 11 15 15 18 20 19 29 34 37 37 39 32 33 33 33 33 33 30 30 25 28 28 25 23 10 10 10 12 11 14 9 13 13 20 24 33 33 37 30 30 39 39 42 42 42 43 43 50 43 43 30 30 20 25 10 10 16 16 20 20 41 36 46 42 43 43 43 50 50 50 50 50 50 57 57 59 57 57 59 57 68 68 68 57 57 57 39 39 39 42 44 57 57 57 59 46 46 44 46 48 48 47 57 42 42 37 37 44 43 48 54 54 54 54 57 57 59 59 57 54 50 50 50 50 57 57 57 57 57 52 52 52 52 52 52 57 57 57 52 52 52 57 50 50 50 50 50 50 50 42 32 33 31 28 43 32 32 43 40 37 37 39 42 44 44 47 47 59 44 57 43 46 43 57 57 57 57 57 57 57 46 57 57 46 46 57 57 47 47 47 47 47 41 43 43 48 59 59 47 43 48 48 48 47 57 43 43 43 43 43 43 47 43 57 48 43 32 32 20 17 17 30 30 38 36 43 36 36 37 37 43 47 37 40 40 59 25 19 8 6 6 13 15 41 47 47 47 47 48 48 48 48 48 48 57 43 43 43 39 39 32 36 33 37 37 37 33 37 37 37 19 17 8 8 9 13 18 16 13 8 8 8 9 11 12 3 0 0 0 3 8 8 6 8 8 8 8 8 10 10 10 8 8 8 8 10 10 12 12 9 10 8 8 8 8 8 10 10 10 8 8 6 6 6 8 8 10 12 9 12 10 10 10 12 10 12 10 11 9 9 11 12 10 10 12 9 9 8 8 8 13 10 8 7 7 8 7 7 8 8 8 8 10 7 6 8 8 8 8 8 8 9 9 10 10 8 8 8 10 12 9 10 10 10 15 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 10 8 8 6 6 8 8 8 8 8 6 6 8 8 12 8 9 9 9 8 8 10 10 8 8 12 15 14 16 11 12 8 8 8 8 8 8 10 10 8 8 6 6 8 8 8 8 8 6 6 6 10 10 8 6 6 6 6 8 8 9 9 9 13 9 9 12 12 10 9 8 8 8 8 8 8 8 8 8 6 6 8 8 10 10 11 10 10 10 10 13 10 8 8 8 8 10 8 8 6 6 10 8 12 11 9 7 10 12 13 8 8 8 9 9 9 9 9 10 10 11 9 9 10 9 15 14 14 11 10 12 10 13 15 18 8 8 8 10 11 12 12 16 13 8 8 8 8 8 10 8 10 10 15 10 10 9 9 10 11 17 13 13 8 8 8 8 11 12 12 15 15 18 15 13 12 12 11 11 13 12 9 9 6 6 8 8 8 10 8 8 8 8 8 8 10 11 11 11 11 10 9 9 10 12 8 8 6 6 8 8 10 10 10 10 12 8 8 6 6 8 8 8 6 6 8 6 8 8 8 8 10 8 10 10 19 21 12 10 11 8 8 8 8 12 6 6 6 8 8 15 9 9 10 8 8 10 11 13 10 9 9 9 9 9 9 18 15 14 13 8 8 8 8 8 8 8 8 8 8 8 8 9 8 8 10 10 9 9 10 10 11 10 8 8 8 8 10 6 6 6 6 8 8 8 8 6 6 6 6 8 8 10 13 10 10 11 11 14 14 8 8 8 8 6 6 8 6 6 8 8 8 8 8 8 8 9 13 13 9 9 8 8 8 8 10 8 8 8 8 10 10 10 11 15 17 17 13 10 10 12 17 18 9 7 7 8 8 8 8 8 8 8 8 8 9 9 9 8 8 6 8 8 8 8 8 8 8 8 10 11 9 8 8 8 8 8 8 8 10 18 18 12 13 8 10 6 6 6 7 7 9 9 9 8 8 8 8 8 8 10 11 9 10 10 11 17 17 15 19 10 10 7 6 8 8 12 10 8 6 6 6 8 8 8 8 6 6 8 8 10 7 9 11 11 16 19 16 19 11 11 11 16 13 13 8 8

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no532_f01.g1 MSMg01no532_f01.g1 CHROMAT_FILE:
MSMg01no532_f01.g1 PHD_FILE: MSMg01no532_f01.g1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 21:09:12 2005
         (206 letters)



>mm_chr7_36429693_36430297
          Length = 605

 Score =  371 bits (192), Expect = e-107
 Identities = 201/204 (98%), Gaps = 1/204 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   tgagcctgcttgagctccatagctaaaccctgcctccaaaaaggtttgaaagcagtgtgc 60
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 403 tgagcctgcttgagctccatagctaaatcctgcctccaaaaaggtttgaaagcagtgtgc 344

                                                                       
Query: 61  cacagttcctacttgagtattcaggaagaagcgatgcttgcagagttacaatttcacagg 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 343 cacagttcctacttgagtattcaggaagaagcgatgcttgcagagttacaatttcacagg 284

                                                                       
Query: 121 atctggttctgcctctgccacagtgtttcagaatctccataagtctctgtcgtcctccct 180
           ||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 283 atctggttctgcccctgccacagtgtttcagaatctccataagtctctg-cgtcctccct 225

                                   
Query: 181 aaagaaagtccacttgtctgtcta 204
           ||||||||||||||||||||||||
Sbjct: 224 aaagaaagtccacttgtctgtcta 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 8
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 206
Length of database: 605
Length adjustment: 8
Effective length of query: 198
Effective length of database: 597
Effective search space:   118206
Effective search space used:   118206
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information