MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-002E10
Chromosome	8 (Build37)
Map Location	22,224,384 - 22,225,416
singlet/doublet	singlet
Overlap gene	Defcr25
Upstream gene	LOC100041654, EG574083, AY761185, Defcr21, LOC100038926, Defcr23, LOC100041688
Downstream gene	LOC626605, LOC634825, LOC100040619, LOC100038927, Defcr22, Defcr-rs7, LOC100041759, LOC672740, EG665969, LOC100041787, Defcr3, Defcr5, LOC100041811, Defcr-rs1, LOC100040668, LOC100041843, LOC100040678, EG665927, LOC100040693, Defcr20, LOC100041890, LOC100041895, EG626682, LOC100040706, EG665956, LOC635093, Defcr26, Defcr17, LOC100041952, Defcr-ps1, AY761184, LOC100040729, Defcr24, LOC100040739, Defb1, Defb50, Defb2, Defb10, Defb9, Defb11, Defb15, Defb35, Defb13, C86695, Ccdc70, Atp7b, Alg11, Nek5
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041654 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	EG574083 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574083 MGI:3646527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AY761185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503556 MGI:3630303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defcr21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66298 MGI:1913548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038926 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defcr23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497114 MGI:3630381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 17 Proteins

name	Defcr25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13236 MGI:3630385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins

name	LOC626605 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 380 ESTs, 7 Proteins pseudo : _no_value

name	LOC634825 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040619 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC100038927 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defcr22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382059 MGI:3639039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defcr-rs7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13226 MGI:102509
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041759 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 17 Proteins

name	LOC672740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	EG665969 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665969 MGI:3644630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	LOC100041787 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 15 Proteins

name	Defcr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13237 MGI:94883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defcr5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13239 MGI:99583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041811 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	Defcr-rs1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13218 MGI:94881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040668 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100041843 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041843
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100040678 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins

name	EG665927 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665927 MGI:3645033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins

name	LOC100040693 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	Defcr20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68009 MGI:1915259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 11 ESTs, 17 Proteins

name	LOC100041895 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 17 Proteins

name	EG626682 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626682 MGI:3646688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	LOC100040706 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins

name	EG665956 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665956 MGI:3648003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins

name	LOC635093 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635093
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Defcr26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626708 MGI:3630390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defcr17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23855 MGI:1345152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 17 Proteins

name	LOC100041952 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 17 Proteins

name	Defcr-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13217 MGI:99593
definition	gene_synonym : Crypi note : defensin-related cryptdin pseudogene 1 pseudo : _no_value

name	AY761184 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382000 MGI:3611585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Defcr24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:503491 MGI:3630383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040739 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040739
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Defb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13214 MGI:1096878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387334 MGI:3055870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13215 MGI:1338754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246085 MGI:2179205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246079 MGI:2179198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246081 MGI:2179197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246082 MGI:2179202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246084 MGI:2179204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246083 MGI:2179203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C86695 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97476 MGI:2142877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67929 MGI:1915179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11979 MGI:103297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alg11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207958 MGI:2142632
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330721 MGI:2142824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041654 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258541 GeneID:100041654
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to beta-defensin 52 transcript_id : XM_001476796.1

name	EG574083 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778874 GeneID:574083 MGI:3646527
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574083 transcript_id : NM_001025353.1

name	AY761185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701433 GeneID:503556 MGI:3630303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY761185 transcript_id : NM_001012640.1

name	Defcr21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365733 GeneID:66298 MGI:1913548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 21 transcript_id : NM_183253.2

name	LOC100038926 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258506 GeneID:100038926
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038926 transcript_id : XM_001471645.1

name	Defcr23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59858578 GeneID:497114 MGI:3630381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 23 transcript_id : NM_001012307.1

name	LOC100041688 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258543 GeneID:100041688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 17 Proteins product : similar to Defcr5 protein transcript_id : XM_001476866.1

name	Defcr25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82916621 GeneID:13236 MGI:3630385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins product : defensin related cryptdin 25 transcript_id : XM_891205.1

name	LOC634825 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258508 GeneID:634825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC634825 transcript_id : XM_001471602.1

name	LOC100038927 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258510 GeneID:100038927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038927 transcript_id : XM_001471603.1

name	Defcr22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373881 GeneID:382059 MGI:3639039
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 22 transcript_id : NM_207658.2

name	Defcr-rs7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681170 GeneID:13226 MGI:102509
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin, related sequence 7 transcript_id : NM_007848.1

name	LOC100041759 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258546 GeneID:100041759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 17 Proteins product : similar to Defcr5 protein transcript_id : XM_001476957.1

name	LOC100041787 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258549 GeneID:100041787
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 15 Proteins product : similar to defensin related cryptdin 26 transcript_id : XM_001476991.1

name	Defcr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13937344 GeneID:13237 MGI:94883
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 3 transcript_id : NM_007850.1

name	Defcr5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680296 GeneID:13239 MGI:99583
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 5 transcript_id : NM_007851.2

name	LOC100041811 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258551 GeneID:100041811
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to Defa1 protein transcript_id : XM_001477034.1

name	Defcr-rs1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113679693 GeneID:13218 MGI:94881
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related sequence cryptdin peptide (paneth cells) transcript_id : NM_007844.2

name	LOC100040668 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258513 GeneID:100040668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to defensin related cryptdin 26 transcript_id : XM_001475047.1

name	LOC100040678 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258515 GeneID:100040678
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001475062.1

name	EG665927 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383146 GeneID:665927 MGI:3645033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins product : predicted gene, EG665927 transcript_id : XM_980383.1

name	LOC100040693 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258517 GeneID:100040693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to defensin related cryptdin 26 transcript_id : XM_001475082.1

name	Defcr20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801303 GeneID:68009 MGI:1915259
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 20 transcript_id : NM_183268.2

name	LOC100041890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258553 GeneID:100041890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 11 ESTs, 6 Proteins product : similar to defensin-related cryptdin 20, transcript variant 1 transcript_id : XM_001477105.1

name	LOC100041890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258555 GeneID:100041890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins product : similar to defensin-related cryptdin 20, transcript variant 2 transcript_id : XM_001477117.1

name	LOC100041895 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258557 GeneID:100041895
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 17 Proteins product : similar to cryptdin-5 transcript_id : XM_001477133.1

name	EG626682 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82916634 GeneID:626682 MGI:3646688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG626682 transcript_id : XM_891293.1

name	LOC100040706 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258519 GeneID:100040706
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 7 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001475107.1

name	EG665956 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383148 GeneID:665956 MGI:3648003
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 5 ESTs, 4 Proteins product : predicted gene, EG665956 transcript_id : XM_980509.1

name	Defcr26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121247276 GeneID:626708 MGI:3630390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin related cryptdin 26 transcript_id : NM_001079933.1

name	Defcr17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383150 GeneID:23855 MGI:1345152
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 41 ESTs, 17 Proteins product : defensin related cryptdin 17 transcript_id : XM_980537.1

name	LOC100041952 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258559 GeneID:100041952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs, 17 Proteins product : similar to cryptdin-5 transcript_id : XM_001477188.1

name	AY761184 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222283 GeneID:382000 MGI:3611585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AY761184 transcript_id : NM_001007582.1

name	LOC100040729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258521 GeneID:100040729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to defensin related cryptdin 26 transcript_id : XM_001475147.1

name	Defcr24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66730566 GeneID:503491 MGI:3630383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : defensin related cryptdin 24 transcript_id : NM_001024225.1

name	Defb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982411 GeneID:13214 MGI:1096878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 1 transcript_id : NM_007843.2

name	Defb50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39979633 GeneID:387334 MGI:3055870
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 50 transcript_id : NM_199067.1

name	Defb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753623 GeneID:13215 MGI:1338754
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 2 transcript_id : NM_010030.1

name	Defb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21327670 GeneID:246085 MGI:2179205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 10 transcript_id : NM_139225.1

name	Defb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361231 GeneID:246079 MGI:2179198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 9 transcript_id : NM_139219.1

name	Defb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361235 GeneID:246081 MGI:2179197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 11 transcript_id : NM_139221.1

name	Defb15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347556 GeneID:246082 MGI:2179202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 15 transcript_id : NM_139222.3

name	Defb35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21218413 GeneID:246084 MGI:2179204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 35 transcript_id : NM_139224.1

name	Defb13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778941 GeneID:246083 MGI:2179203
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 13 transcript_id : NM_139223.3

name	C86695 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157471 GeneID:97476 MGI:2142877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C86695 transcript_id : NM_001081662.1

name	Ccdc70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386013 GeneID:67929 MGI:1915179
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 70 transcript_id : NM_026459.3

name	Atp7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116256506 GeneID:11979 MGI:103297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Cu++ transporting, beta polypeptide transcript_id : NM_007511.2

name	Alg11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351176 GeneID:207958 MGI:2142632
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asparagine-linked glycosylation 11 homolog (yeast, alpha-1,2-mannosyltransferase) transcript_id : NM_183142.2

name	Nek5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803451 GeneID:330721 MGI:2142824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 5 transcript_id : NM_177898.4

name	LOC100041654 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258542 GeneID:100041654
definition	codon_start : 1 product : similar to beta-defensin 52 protein_id : XP_001476846.1

name	EG574083 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778875 GeneID:574083 MGI:3646527
definition	codon_start : 1 note : beta-defensin 52 product : beta-defensin 51 protein_id : NP_001020524.1

name	AY761185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701434 GeneID:503556 MGI:3630303
definition	GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : defensin related cryptdin product : CRS4C-6 protein_id : NP_001012658.1

name	Defcr21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518551 GeneID:66298 MGI:1913548
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : defensin-related cryptdin 21 protein_id : NP_899076.1

name	Defcr23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59858579 GeneID:497114 MGI:3630381
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : defensin-related cryptdin 23 protein_id : NP_001012307.1

name	LOC100038926 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258507 GeneID:100038926
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471695.1

name	LOC100041688 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258544 GeneID:100041688
definition	codon_start : 1 product : similar to Defcr5 protein protein_id : XP_001476916.1

name	Defcr25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916622 GeneID:13236 MGI:3630385
definition	codon_start : 1 product : defensin related cryptdin 2 protein_id : XP_896298.1

name	LOC634825 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258509 GeneID:634825
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471652.1

name	LOC100038927 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258511 GeneID:100038927
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471653.1

name	Defcr22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50263038 GeneID:382059 MGI:3639039
definition	codon_start : 1 exception : unclassified translation discrepancy product : defensin-related cryptdin 22 protein_id : NP_997541.1

name	Defcr-rs7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681171 GeneID:13226 MGI:102509
definition	GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : cryptdin related sequence peptide product : defensin related cryptdin, related sequence 7 protein_id : NP_031874.1

name	LOC100041759 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258547 GeneID:100041759
definition	codon_start : 1 product : similar to Defcr5 protein protein_id : XP_001477007.1

name	LOC100041787 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258550 GeneID:100041787
definition	codon_start : 1 product : similar to defensin related cryptdin 26 protein_id : XP_001477041.1

name	Defcr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13937345 GeneID:13237 MGI:94883
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin related cryptdin 3 protein_id : NP_031876.1

name	Defcr5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680297 CCDS:CCDS22152.1 GeneID:13239 MGI:99583
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin related cryptdin 5 protein_id : NP_031877.2

name	LOC100041811 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258552 GeneID:100041811
definition	codon_start : 1 product : similar to Defa1 protein protein_id : XP_001477084.1

name	Defcr-rs1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113679694 GeneID:13218 MGI:94881
definition	GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : defensin related sequence cryptdin peptide (paneth cells) (MGD\|MGI:94881 GB\|NM_007844, evidence: BLASTN, 98%, match=468); putative product : defensin related sequence cryptdin peptide (paneth cells) protein_id : NP_031870.2

name	LOC100040668 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258514 GeneID:100040668
definition	codon_start : 1 product : similar to defensin related cryptdin 26 protein_id : XP_001475097.1

name	LOC100040678 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258516 GeneID:100040678
definition	codon_start : 1 product : similar to ribosomal protein L21 protein_id : XP_001475112.1

name	EG665927 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383147 GeneID:665927 MGI:3645033
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985477.1

name	LOC100040693 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258518 GeneID:100040693
definition	codon_start : 1 product : similar to defensin related cryptdin 26 protein_id : XP_001475132.1

name	Defcr20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304056 GeneID:68009 MGI:1915259
definition	codon_start : 1 exception : mismatches in translation product : defensin-related cryptdin 20 protein_id : NP_899091.1

name	LOC100041890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258556 GeneID:100041890
definition	codon_start : 1 product : similar to defensin-related cryptdin 20 isoform 2 protein_id : XP_001477167.1

name	LOC100041890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258554 GeneID:100041890
definition	codon_start : 1 product : similar to defensin-related cryptdin 20 isoform 1 protein_id : XP_001477155.1

name	LOC100041895 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258558 GeneID:100041895
definition	codon_start : 1 product : similar to cryptdin-5 protein_id : XP_001477183.1

name	EG626682 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916635 GeneID:626682 MGI:3646688
definition	codon_start : 1 product : similar to defensin-related cryptdin 25 protein_id : XP_896386.1

name	LOC100040706 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258520 GeneID:100040706
definition	codon_start : 1 product : similar to ribosomal protein L21 protein_id : XP_001475157.1

name	EG665956 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383149 GeneID:665956 MGI:3648003
definition	codon_start : 1 product : hypothetical protein protein_id : XP_985603.1

name	Defcr26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121247277 GeneID:626708 MGI:3630390
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : testis defensin product : defensin related cryptdin 26 protein_id : NP_001073402.1

name	Defcr17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383151 GeneID:23855 MGI:1345152
definition	codon_start : 1 product : defensin related cryptdin 17 protein_id : XP_985631.1

name	LOC100041952 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258560 GeneID:100041952
definition	codon_start : 1 product : similar to cryptdin-5 protein_id : XP_001477238.1

name	AY761184 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222284 CCDS:CCDS22156.1 GeneID:382000 MGI:3611585
definition	GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : hypothetical protein LOC382000 protein_id : NP_001007583.1

name	LOC100040729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258522 GeneID:100040729
definition	codon_start : 1 product : similar to defensin related cryptdin 26 protein_id : XP_001475197.1

name	Defcr24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66730567 GeneID:503491 MGI:3630383
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 product : defensin-related cryptdin 24 protein_id : NP_001019396.1

name	Defb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681161 GeneID:13214 MGI:1096878
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0045087 - innate immune response [Evidence IMP]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 1 protein_id : NP_031869.1

name	Defb50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979634 GeneID:387334 MGI:3055870
definition	GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : prostate beta defensin 1; beta-defensin 50 product : defensin beta 50 protein_id : NP_951022.1

name	Defb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753624 GeneID:13215 MGI:1338754
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 2 protein_id : NP_034160.1

name	Defb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21327671 GeneID:246085 MGI:2179205
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 10 protein_id : NP_631971.1

name	Defb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361232 GeneID:246079 MGI:2179198
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 9 protein_id : NP_631965.1

name	Defb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361236 GeneID:246081 MGI:2179197
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 11 protein_id : NP_631967.1

name	Defb15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218418 GeneID:246082 MGI:2179202
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 15 protein_id : NP_631968.1

name	Defb35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218414 GeneID:246084 MGI:2179204
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 35 protein_id : NP_631970.1

name	Defb13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21218412 GeneID:246083 MGI:2179203
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 13 protein_id : NP_631969.1

name	C86695 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157472 GeneID:97476 MGI:2142877
definition	codon_start : 1 product : hypothetical protein LOC97476 protein_id : NP_001075131.1

name	Ccdc70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385954 CCDS:CCDS22167.1 GeneID:67929 MGI:1915179
definition	codon_start : 1 product : coiled-coil domain containing 70 protein_id : NP_080735.1

name	Atp7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116256507 CCDS:CCDS22168.1 GeneID:11979 MGI:103297
definition	GO_component : GO:0005802 - Golgi trans face [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0005770 - late endosome [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence ISS] [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA]; GO:0004008 - copper-exporting ATPase activity [Evidence ISS] [Evidence IDA] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0006878 - copper ion homeostasis [Evidence IMP]; GO:0006825 - copper ion transport [Evidence IDA] [Evidence IMP] [Evidence ISS] [Evidence IEA]; GO:0015680 - intracellular copper ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007595 - lactation [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006882 - zinc ion homeostasis [Evidence IMP] codon_start : 1 note : Wilson protein; toxic milk product : ATPase, Cu++ transporting, beta polypeptide protein_id : NP_031537.2

name	Alg11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147157 GeneID:207958 MGI:2142632
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : asparagine-linked glycosylation 11 homolog (yeast, alpha-1,2-mannosyltransferase) protein_id : NP_898965.1

name	Nek5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559852 GeneID:330721 MGI:2142824
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : NIMA (never in mitosis gene a)-related expressed kinase 5 protein_id : NP_808566.2

name	LOC672740 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672740
definition	number : 1 pseudo : _no_value

name	LOC672740 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:672740
definition	number : 2 pseudo : _no_value

name	LOC100041843 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041843
definition	number : 1 pseudo : _no_value

name	LOC100041843 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041843
definition	number : 2 pseudo : _no_value

name	LOC635093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635093
definition	number : 1 pseudo : _no_value

name	LOC635093 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635093
definition	number : 2 pseudo : _no_value

name	LOC100040739 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040739
definition	number : 1 pseudo : _no_value

name	LOC100040739 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040739
definition	number : 2 pseudo : _no_value

name	LOC626605 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258545 GeneID:626605
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 380 ESTs, 7 Proteins product : similar to ribosomal protein L21 pseudo : _no_value transcript_id : XR_032960.1

name	LOC100040619 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258512 GeneID:100040619
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : hypothetical protein LOC100040619 pseudo : _no_value transcript_id : XR_032031.1

name	EG665969 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149258548 GeneID:665969 MGI:3644630
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : predicted gene, EG665969 pseudo : _no_value transcript_id : XR_001809.2

clone name	MSMg01-085K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480G01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-237B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257B15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-002E10.b	B6Ng01-002E10.g
ACC	DH840348	DH840349
length	1,044	1,192
definition	DH840348\|Mus musculus domesticus DNA, BAC clone: B6Ng01-002E10, 5' end.	DH840349\|Mus musculus domesticus DNA, BAC clone: B6Ng01-002E10, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaacacactaattgacatgcatgtgatgtgtgatcattgccaaca aagagcatctgtcatgaaagagctgggtacaagtgttctgggtgtatcat gtgtatcattgttctcagctgactctcaagcacagctttattgagggaac ttctcaaagaaacagggtcttccacatcagaggcaggaaggcagatgaat aggttacaaaccaggagctttagattaacacccaaactgaggagaatcta ggcattggcaagtatgtgggcatgtggccattggctggatagttgaagag agtgaggagagggtcactgtcagctaaggtgtccaagtattaagaagatg ggaaggagaccatctgggcaacaatttattgagaaatgttcatcaggccc cagcatgtggcctcagtactcatggctgtcttgtcctctgtggtctccat gttcagcagcaccagagcatgtacattaaatgaccctttctgcaggtccc attcaggcgttctcttcttttgcagcctcttgttctacaatagcatatca gatctctcaacgcgctggaggcacaaaaagaatcaggcattaagatttgg ggttggcagcatgtaatagtatgtgatcctatggggatatgtgatacagc atgaatgtgctgtgttggccacaatacagactttcagcaaggacatctca accaacaacacacttcaggggtgttggtcatgtacttgagagccattctg atgtgtcttttaatttctgtgtttccttttgtcaccatgtagacacttta gtatactttgaaaattgattcaattttcctttacacaaagaaaaatttct acttaatacccaagactaattcctgttctataagcattcaaatcagagta ttgggagtactgtgagtattgaaattttcatggatatctttttacagcga acgccctcatgaagaaagatattcaatagagttacttttttctctcgctg tactggttatgattataaaaggaattaaaatagtgttgccagag	gaattctcacctgaggaataccgaatggcagagaagcacttgaaaaaatg ttcaacatccttaatcatcagggaaatgccaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgtggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaactggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgccccaacaggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacctagat gcccctcaacagaggaatggatacagaaaaatgtggtacatctacacaat ggagtactactcagctattaaaaagaattaatttatgaaattcctagcta aatggatggacctggagggcatcatcctgagtgaggtaacacattcacaa agaaactcacacaatatgtattcactgataagtggatattagccccaaac ctaggatacccaagatataagatataatttgctaaacacatgaaactcaa gaagaatgaagactgaagtgtggacactatgcccctccttagatttggga acaaaacacccatgggaaggagttacagagacaaagtttggagctgagat gaaaggatggaccatgtagagactgccatatccagggatctaccccataa tcagcatccaaacgctgacaccattgcatacactagcagattttattgaa aggacccagatgtagctgtctcttgtgagactatgccggggcctagcaaa cacagaagtggatgctcacagtcagctaatggatggatcatagggcctcc caatggaggagctagagaaagtagccaaggagctaaagggatcttgcacc ctataagtggaacaacataatgaactaaccagtaccccgggagctttgaa ctctagctgcaatatatatcagaagagtgcctagccggccatcgctggcg gaaggcccattggactttgcaaccttttatgcccattcaggaaacctcag ggtccaaatggggggagtggtgtgcacggcagatgatgtcgt
quality values	Open. Hide. 47 37 19 33 61 33 11 39 30 33 52 43 61 47 47 53 61 61 61 61 55 43 47 61 55 18 13 21 11 12 7 6 13 14 9 14 22 24 36 37 36 59 59 61 61 59 59 61 61 59 59 61 59 61 59 59 59 61 61 61 61 61 59 61 59 59 59 59 59 43 52 27 35 35 28 30 28 31 52 59 49 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 59 59 59 61 61 61 61 59 59 61 59 59 52 59 59 59 59 49 59 59 61 59 59 59 59 61 59 61 59 61 61 59 61 61 61 61 59 59 61 61 61 61 59 59 59 59 52 59 59 59 59 59 43 61 59 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 59 52 37 34 43 59 59 59 59 59 49 61 59 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 52 59 61 59 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 52 59 59 49 59 52 61 61 61 59 59 59 61 61 61 59 61 59 59 61 59 61 59 52 61 52 61 59 59 59 61 59 59 61 59 61 61 61 61 59 59 59 59 52 59 49 52 45 49 59 59 59 61 61 61 61 61 59 59 59 59 59 59 59 61 61 61 61 61 59 61 61 59 61 59 61 61 59 61 61 59 61 59 44 59 59 59 52 59 59 59 61 61 61 59 49 59 59 52 52 59 61 61 61 61 59 59 59 52 61 59 52 52 59 52 52 61 61 61 61 61 59 61 52 59 59 59 49 39 61 59 61 61 61 61 61 59 61 59 59 59 45 52 59 59 59 59 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 59 61 59 59 61 59 55 59 61 61 61 59 61 61 59 61 61 59 59 59 36 61 59 61 61 61 59 61 59 61 49 52 59 39 45 52 59 59 59 59 59 59 61 61 59 59 59 59 59 59 61 61 61 61 61 59 59 61 59 59 61 61 59 61 61 61 59 59 61 59 59 59 59 59 59 61 61 61 61 55 55 55 55 61 55 52 52 55 55 52 55 52 52 61 61 61 55 55 61 52 55 61 52 55 43 52 52 55 61 61 61 61 32 61 61 55 49 52 49 41 37 41 52 32 49 55 55 52 55 55 61 49 61 39 36 41 17 29 27 55 55 49 55 43 32 38 34 18 47 32 35 50 61 55 61 55 61 43 61 61 61 61 61 61 50 49 50 47 41 37 37 61 55 61 61 47 38 55 50 47 32 55 61 47 55 45 61 50 49 43 26 21 16 8 19 28 61 61 55 24 37 35 43 35 35 36 30 31 35 28 35 41 50 53 53 43 47 43 61 35 53 53 53 61 43 61 47 45 47 31 31 36 42 39 53 28 38 43 45 39 20 47 50 24 40 21 37 40 29 50 52 31 39 61 43 33 52 52 45 43 35 50 38 39 43 43 43 31 14 31 35 23 24 24 27 31 30 39 27 23 31 38 47 42 53 26 28 27 23 13 20 18 35 45 33 28 30 34 34 50 47 38 52 40 38 53 34 45 40 33 24 19 29 22 34 32 29 17 26 9 45 50 24 19 43 30 57 22 18 8 11 10 30 8 37 16 47 32 21 53 52 46 50 18 20 18 24 30 14 30 50 25 35 28 33 28 24 37 17 42 38 28 30 19 45 20 30 23 7 53 39 32 14 57 47 35 36 38 37 23 17 36 38 30 45 35 57 45 32 24 29 21 19 36 36 30 13 36 6 34 47 42 28 17 26 38 16 37 40 24 18 5 8 9 8 12 26 31 30 33 38 37 31 14 31 9 19 8 9 11 14 12 10 19 29 20 40 25 37 29 15 33 39 42 31 26 36 26 22 22 11 6 27 22 26 25 11 27 29 10 22 14 5 34 20 53 14 32 10 10 9 13 24 37 10 33 33 27 29 27 30 38 40 23 53 47 9 11 8 5 10 5 27 17 9 9 22 18 36 30 27 46 51 46 29 19 23 6 5 9 9 6 6 12 4 9 23 5 20 9 14 34 26 24 7 8 36 48 24 7 23 6 16 12 16 19 21 6 29 17 8 29 29 20 28 27 27 9 38 28 43 23 10 5 13 12 14 14 14 8 8 8 11 10 35 11 21 24 13 20 8 9 21 24 5 5 10 5 10 12 29 14 10 23 15 27 29 12 18 46 43 23 9 7 14 7 10 12 15 14 13 18 11 8 7 7	Open. Hide. 61 61 43 47 61 50 43 38 12 55 15 21 12 14 8 25 28 26 36 43 37 55 55 59 59 61 59 61 52 59 52 61 59 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 59 59 38 39 38 24 26 26 22 35 30 59 59 59 52 59 59 61 59 61 61 59 59 61 44 44 59 59 61 61 59 59 59 59 61 61 61 59 55 59 61 59 59 61 59 59 61 61 59 59 61 61 61 61 61 59 61 61 61 61 59 55 59 61 59 61 59 61 61 59 59 61 59 61 61 61 61 61 61 61 52 59 61 59 59 59 59 59 61 59 61 61 59 59 61 61 61 59 61 59 59 59 59 49 61 59 59 59 59 59 59 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 59 59 59 52 59 61 61 59 59 61 61 59 61 55 55 59 61 61 61 59 59 59 61 61 61 61 61 59 59 59 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 61 61 59 59 61 45 52 59 59 52 52 52 36 59 59 59 59 59 61 59 59 61 59 52 59 52 41 52 61 59 59 59 59 59 59 61 61 59 61 59 61 61 61 59 59 59 59 59 59 52 59 52 52 52 52 52 59 49 59 61 61 59 59 61 61 59 45 59 45 52 36 52 61 61 49 61 59 59 59 59 59 59 59 59 59 52 52 61 52 52 59 43 61 59 59 61 59 59 59 59 45 59 61 59 59 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 59 59 52 61 61 59 61 61 61 61 59 59 61 59 61 59 61 52 59 59 59 59 61 59 45 59 59 59 59 59 61 61 59 61 61 59 49 43 39 22 52 52 52 52 49 49 49 43 52 43 49 52 43 37 55 49 55 61 55 61 61 61 61 55 55 61 52 52 61 61 55 61 61 61 61 61 61 52 52 52 52 52 55 61 55 55 61 52 55 52 55 55 61 55 61 55 61 61 43 43 41 43 43 39 50 43 55 61 50 61 61 55 61 55 55 55 49 61 55 47 55 50 50 55 55 61 49 61 61 61 55 61 37 50 49 49 50 50 55 61 61 55 61 61 61 61 61 61 61 61 55 50 47 50 38 37 55 47 39 61 61 50 35 43 43 29 38 43 32 32 43 61 53 61 61 53 47 61 26 31 37 50 43 37 35 47 50 50 28 43 35 43 61 50 61 53 47 61 53 52 45 52 50 53 50 53 47 53 61 61 61 53 53 43 50 31 37 37 47 61 52 61 61 53 61 61 61 46 53 53 53 61 53 34 47 47 50 53 45 34 38 42 38 38 42 47 61 43 50 39 47 47 31 9 46 57 53 45 45 50 31 57 32 53 23 47 50 52 43 53 38 42 36 34 38 36 45 47 39 37 47 26 52 50 52 45 47 50 53 47 45 53 53 46 18 21 57 47 34 53 52 37 32 43 38 43 57 36 24 18 53 53 45 53 17 47 35 28 36 28 45 38 25 16 39 26 20 30 35 27 29 16 15 12 33 24 57 57 45 57 33 39 47 36 30 27 23 33 40 28 24 15 17 11 26 27 53 18 30 32 23 37 35 16 12 15 27 53 38 37 53 30 50 38 23 53 53 40 53 53 52 40 30 52 24 50 42 36 32 8 30 23 29 33 57 52 27 36 36 18 50 31 32 16 31 11 10 29 50 33 20 52 33 24 28 32 38 21 50 27 52 28 34 24 26 21 20 37 46 25 40 29 20 17 32 37 32 29 24 37 20 30 33 37 25 36 36 35 33 14 26 25 26 33 36 27 27 35 20 33 22 16 22 27 13 20 27 41 34 21 18 9 27 14 26 41 40 11 37 44 20 10 6 57 57 33 10 7 25 22 22 47 30 12 39 13 17 33 29 18 10 47 33 31 31 22 20 25 30 29 29 19 30 18 20 24 18 5 11 29 22 33 16 25 20 20 29 20 15 16 48 45 31 24 22 27 28 9 29 20 31 28 23 13 18 17 21 25 33 17 24 22 22 10 7 21 26 17 27 14 21 18 23 13 28 20 20 29 11 16 29 16 28 29 11 14 24 27 28 20 17 20 29 28 20 28 26 13 10 29 18 29 7 7 22 28 23 16 13 15 5 20 9 22 21 8 7 29 14 31 43 31 15 23 24 5 15 23 12 7 18 5 11 11 24 31 19 31 11 11 44 14 11 11 12 11 8 9 25 24 12 28 17 10 13 16 6 10 32 8 6 21 16 29 22 18 18 27 19 33 8 22 13 8 8 10 24 28 15 20 23 30 19 10 6 6 29 31 30 35 20 36 13 32 7 11 8 4 10 6 7 8 4 14 5 6 9 23 23 19 13 8 6 7 15 9 14 9 8 7 9 5 16 9 35 8 10 8 4 5 15 11 13 20 15 11 3 4 6 8 13 10 5 13 6 4 4 4 11 5 5 3 5 5 4 4 17 8 28 23 12 10 15 14 5 2 3 7 20 8 5 9 14 19 5 6 25 32 31 9 16 4 3 21 29 12 4 4 7 6 4 8 6 3 14 14 10 23 9 26 8 13 30 24 6 16 9 10 11 17 4 16 27 25 25 10 3 7 4 8 18 3 3 13 4 16 6 4 4 18 14 4 5 8 10 10 16 3 2 2 3 5 7 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_22224384_22225416
seq2: B6Ng01-002E10.b_46_1089 (reverse)

seq1  CTCTGGCAACACTATTTTAATTCCTTTTATATTCATAA-CAGTAACAGCG  49
      ||||||||||||||||||||||||||||||| |||||| |||| ||||||
seq2  CTCTGGCAACACTATTTTAATTCCTTTTATAATCATAACCAGT-ACAGCG  49

seq1  AGAG--AAAAGTAACTCTAATTGAATATCTTTC-TCATGA-GGCGTTTAC  95
      ||||  |||||||||||| |||||||||||||| |||||| ||||||  |
seq2  AGAGAAAAAAGTAACTCT-ATTGAATATCTTTCTTCATGAGGGCGTTCGC  98

seq1  TGTAAAAAGATATACATGGGAATTTCAATACTCACAGTACT-CCAATACT  144
      ||||||||||||| ||||  ||||||||||||||||||||| ||||||||
seq2  TGTAAAAAGATATCCATGAAAATTTCAATACTCACAGTACTCCCAATACT  148

seq1  CTGA-TTGAATGCTTATAGAACAGG-ATTAGTCTTGGGTATT-AGTAGAA  191
      |||| |||||||||||||||||||| |||||||||||||||| |||||||
seq2  CTGATTTGAATGCTTATAGAACAGGAATTAGTCTTGGGTATTAAGTAGAA  198

seq1  ATTTTTCTTTGTGTAAAGGAAAATTGAATCAA-TTTCAAAGTATACTAAA  240
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  ATTTTTCTTTGTGTAAAGGAAAATTGAATCAATTTTCAAAGTATACTAAA  248

seq1  GTGTCTACATGGTGACAAAAGG-AACACAGAAATT-AAAGACACATCAGA  288
      |||||||||||||||||||||| |||||||||||| ||||||||||||||
seq2  GTGTCTACATGGTGACAAAAGGAAACACAGAAATTAAAAGACACATCAGA  298

seq1  ATGGCTCTCAAGTACATGACCAACACCCCTGAAGTGTGTTGTTGGTTGAG  338
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCTCTCAAGTACATGACCAACACCCCTGAAGTGTGTTGTTGGTTGAG  348

seq1  ATGTCCTTGCTG-AAGTCTGTATTGTGGCCAACACAGCACATTCATGCTG  387
      |||||||||||| |||||||||||||||||||||||||||||||||||||
seq2  ATGTCCTTGCTGAAAGTCTGTATTGTGGCCAACACAGCACATTCATGCTG  398

seq1  TATCACATATCCCCATAGGATCACATACTATTACATGCTGCCAACCCCAA  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCACATATCCCCATAGGATCACATACTATTACATGCTGCCAACCCCAA  448

seq1  ATCTTAATGCCTGATTCTTTTTGTGCCTCCAGCGCGTTGAGAGATCTGAT  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTTAATGCCTGATTCTTTTTGTGCCTCCAGCGCGTTGAGAGATCTGAT  498

seq1  ATGCTATTGTAGAACAAGAGGCTGCAAAAGAAGAGAACGCCTGAATGGGA  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTATTGTAGAACAAGAGGCTGCAAAAGAAGAGAACGCCTGAATGGGA  548

seq1  CCTGCAGAAAGGGTCATTTAATGTACATGCTCTGGTGCTGCTGAACATGG  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGCAGAAAGGGTCATTTAATGTACATGCTCTGGTGCTGCTGAACATGG  598

seq1  AGACCACAGAGGACAAGACAGCCATGAGTACTGAGGCCACATGCTGGGGC  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCACAGAGGACAAGACAGCCATGAGTACTGAGGCCACATGCTGGGGC  648

seq1  CTGATGAACATTTCTCAATAAATTGTTGCCCAGATGGTCTCCTTCCCATC  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATGAACATTTCTCAATAAATTGTTGCCCAGATGGTCTCCTTCCCATC  698

seq1  TTCTTAATACTTGGACACCTTAGCTGACAGTGACCCTCTCCTCACTCTCT  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTAATACTTGGACACCTTAGCTGACAGTGACCCTCTCCTCACTCTCT  748

seq1  TCAACTATCCAGCCAATGGCCACATGCCCACATACTTGCCAATGCCTAGA  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACTATCCAGCCAATGGCCACATGCCCACATACTTGCCAATGCCTAGA  798

seq1  TTCTCCTCAGTTTGGGTGTTAATCTAAAGCTCCTGGTTTGTAACCTATTC  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCCTCAGTTTGGGTGTTAATCTAAAGCTCCTGGTTTGTAACCTATTC  848

seq1  ATCTGCCTTCCTGCCTCTGATGTGGAAGACCCTGTTTCTTTGAGAAGTTC  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGCCTTCCTGCCTCTGATGTGGAAGACCCTGTTTCTTTGAGAAGTTC  898

seq1  CCTCAATAAAGCTGTGCTTGAGAGTCAGCTGAGAACAATGATACACATGA  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAATAAAGCTGTGCTTGAGAGTCAGCTGAGAACAATGATACACATGA  948

seq1  TACACCCAGAACACTTGTACCCAGCTCTTTCATGACAGATGCTCTTTGTT  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACCCAGAACACTTGTACCCAGCTCTTTCATGACAGATGCTCTTTGTT  998

seq1  GGCAATGATCACACATCACATGCATGTCAATTAGTGTGTTGAATTC  1033
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAATGATCACACATCACATGCATGTCAATTAGTGTGTTGAATTC  1044

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information