MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-026H07
Chromosome	8 (Build37)
Map Location	3,357,309 - 3,470,716
singlet/doublet	doublet
Overlap gene	A430078G23Rik, Arhgef18, Pex11c
Upstream gene	EG664801, EG209786, D630014A15Rik, Insr
Downstream gene	1700019B03Rik, Zfp358, Mcoln1, Pnpla6, C330021F23Rik, 2310057J16Rik, Xab2, Pcp2, Stxbp2, Retn, 1810033B17Rik, LOC664858, Trappc5, Fcer2a, Clec4g, Cd209a, LOC664870, Cd209e, Cd209d, Cd209b, Cd209c, LOC664888, EG384770, EG664905, LOC664915, LOC664922, LOC631071, Cd209f, Cd209g, B130050I23Rik, BC068157, Lrrc8e, Map2k7, LOC100039590, Snapc2, Ctxn1, Timm44, Elavl1, Ccl25, LOC664977, Ppia-ps8_36.1
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG664801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664801 MGI:3645982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	EG209786 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209786 MGI:3643761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins

name	D630014A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319666 MGI:2442502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Insr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16337 MGI:96575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A430078G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319493 MGI:2442135
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102098 MGI:2142567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pex11c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69129 MGI:1920905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700019B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76406 MGI:1923656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein

name	Zfp358 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140482 MGI:2153740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcoln1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94178 MGI:1890498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnpla6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50767 MGI:1354723
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330021F23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546049 MGI:3612471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310057J16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69697 MGI:1916947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xab2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67439 MGI:1914689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18545 MGI:97508
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Stxbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20911 MGI:107370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Retn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57264 MGI:1888506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810033B17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69189 MGI:1916439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Trappc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66682 MGI:1913932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fcer2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14128 MGI:95497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clec4g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75863 MGI:1923113
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd209a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170786 MGI:2157942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664870 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs

name	Cd209e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170780 MGI:2157948
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd209d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170779 MGI:2157947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd209b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69165 MGI:1916415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cd209c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170776 MGI:2157945
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 3 Proteins pseudo : _no_value

name	EG384770 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384770 MGI:3644319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG664905 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:664905 MGI:3647493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC664915 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664915
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC664922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 37 Proteins pseudo : _no_value

name	LOC631071 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 223 ESTs, 4 Proteins

name	Cd209f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69142 MGI:1916392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 3 Proteins

name	Cd209g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70192 MGI:1917442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 4 Proteins

name	B130050I23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213027 MGI:2442167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC068157 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73072 MGI:3605626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc8e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72267 MGI:1919517
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map2k7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26400 MGI:1346871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039590 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	Snapc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102209 MGI:1914861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctxn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330695 MGI:88566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21856 MGI:1343262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elavl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15568 MGI:1100851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20300 MGI:1099448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 7 Proteins pseudo : _no_value

name	Ppia-ps8_36.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606543
definition	note : peptidylprolyl isomerase A pseudogene 8_36.1 pseudo : _no_value

name	EG209786 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258329 GeneID:209786 MGI:3643761
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 Proteins product : predicted gene, EG209786 transcript_id : XM_146175.6

name	D630014A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85701878 GeneID:319666 MGI:2442502
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D630014A15 gene transcript_id : NM_001033381.1

name	Insr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754359 GeneID:16337 MGI:96575
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin receptor transcript_id : NM_010568.1

name	A430078G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377145 GeneID:319493 MGI:2442135
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A430078G23 gene transcript_id : NM_001033378.2

name	Arhgef18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41056260 GeneID:102098 MGI:2142567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : rho/rac guanine nucleotide exchange factor (GEF) 18 transcript_id : NM_133962.3

name	Pex11c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802274 GeneID:69129 MGI:1920905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxisomal biogenesis factor 11c transcript_id : NM_026951.2

name	1700019B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94382996 GeneID:76406 MGI:1923656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs, 1 Protein product : RIKEN cDNA 1700019B03 gene transcript_id : XM_133982.6

name	Zfp358 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922566 GeneID:140482 MGI:2153740
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 358 transcript_id : NM_080461.2

name	Mcoln1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716462 GeneID:94178 MGI:1890498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mucolipin 1 transcript_id : NM_053177.1

name	Pnpla6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657400 GeneID:50767 MGI:1354723
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : patatin-like phospholipase domain containing 6 transcript_id : NM_015801.1

name	C330021F23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802203 GeneID:546049 MGI:3612471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C330021F23 gene transcript_id : NM_001024728.2

name	2310057J16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352970 GeneID:69697 MGI:1916947
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310057J16 gene transcript_id : NM_027171.2

name	Xab2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358043 GeneID:67439 MGI:1914689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : XPA binding protein 2 transcript_id : NM_026156.2

name	Pcp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68299813 GeneID:18545 MGI:97508
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Purkinje cell protein 2 (L7) transcript_id : NM_008790.2

name	Stxbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801810 GeneID:20911 MGI:107370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntaxin binding protein 2 transcript_id : NM_011503.4

name	Retn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21687157 GeneID:57264 MGI:1888506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : resistin transcript_id : NM_022984.3

name	1810033B17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109659833 GeneID:69189 MGI:1916439
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810033B17 gene transcript_id : NM_026985.1

name	LOC664858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94382999 GeneID:664858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical LOC664858 transcript_id : XM_973091.1

name	Trappc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802202 GeneID:66682 MGI:1913932
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 5 transcript_id : NM_025701.3

name	Fcer2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375612 GeneID:14128 MGI:95497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fc receptor, IgE, low affinity II, alpha polypeptide transcript_id : NM_013517.2

name	Clec4g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353398 GeneID:75863 MGI:1923113
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C-type lectin domain family 4, member g transcript_id : NM_029465.2

name	Cd209a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371806 GeneID:170786 MGI:2157942
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209a antigen transcript_id : NM_133238.3

name	LOC664870 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258349 GeneID:664870
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 24 ESTs product : similar to WTAP protein transcript_id : XM_001473582.1

name	Cd209e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475796 GeneID:170780 MGI:2157948
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209e antigen transcript_id : NM_130905.2

name	Cd209d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475791 GeneID:170779 MGI:2157947
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209d antigen transcript_id : NM_130904.2

name	Cd209b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802954 GeneID:69165 MGI:1916415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209b antigen transcript_id : NM_026972.3

name	Cd209b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83699405 GeneID:69165 MGI:1916415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209b antigen transcript_id : NM_001037800.1

name	Cd209c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802778 GeneID:170776 MGI:2157945
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD209c antigen transcript_id : NM_130903.3

name	EG384770 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258331 GeneID:384770 MGI:3644319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG384770 transcript_id : XM_357856.4

name	EG664905 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258332 GeneID:664905 MGI:3647493
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG664905 transcript_id : XM_973357.2

name	LOC631071 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258353 GeneID:631071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 223 ESTs, 4 Proteins product : similar to RIKEN cDNA 2610208M17 gene transcript_id : XM_001473773.1

name	Cd209f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383006 GeneID:69142 MGI:1916392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 3 Proteins product : CD209f antigen, transcript variant 1 transcript_id : XM_284386.5

name	Cd209g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258334 GeneID:70192 MGI:1917442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 4 Proteins product : CD209g antigen transcript_id : XM_284376.6

name	B130050I23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074547 GeneID:213027 MGI:2442167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B130050I23 gene transcript_id : NM_001039578.2

name	BC068157 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402166 GeneID:73072 MGI:3605626
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC068157 transcript_id : NM_207203.1

name	Lrrc8e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51890210 GeneID:72267 MGI:1919517
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 8 family, member E transcript_id : NM_028175.1

name	Map2k7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347550 GeneID:26400 MGI:1346871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 7 transcript_id : NM_011944.2

name	Map2k7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347548 GeneID:26400 MGI:1346871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen activated protein kinase kinase 7 transcript_id : NM_001042557.1

name	LOC100039590 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258336 GeneID:100039590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : similar to transforming growth factor, beta receptor III (betaglycan, 300kDa) transcript_id : XM_001473149.1

name	Snapc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527187 GeneID:102209 MGI:1914861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nuclear RNA activating complex, polypeptide 2 transcript_id : NM_133968.1

name	Ctxn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34304000 GeneID:330695 MGI:88566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cortexin 1 transcript_id : NM_183315.1

name	Timm44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19705562 GeneID:21856 MGI:1343262
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 44 transcript_id : NM_011592.1

name	Elavl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032046 GeneID:15568 MGI:1100851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) transcript_id : NM_010485.3

name	Ccl25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892127 GeneID:20300 MGI:1099448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 25 transcript_id : NM_009138.2

name	EG209786 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258330 GeneID:209786 MGI:3643761
definition	codon_start : 1 product : similar to predicted gene, EG665255 protein_id : XP_146175.6

name	D630014A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701879 GeneID:319666 MGI:2442502
definition	codon_start : 1 product : hypothetical protein LOC319666 protein_id : NP_001028553.1

name	Insr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754360 CCDS:CCDS22059.1 GeneID:16337 MGI:96575
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005006 - epidermal growth factor receptor activity [Evidence IEA]; GO:0043559 - insulin binding [Evidence ISS]; GO:0005009 - insulin receptor activity [Evidence ISS]; GO:0043560 - insulin receptor substrate binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0043548 - phosphoinositide 3-kinase binding [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0051425 - PTB domain binding [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0042169 - SH2 domain binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004714 - transmembrane receptor protein tyrosine kinase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence ISS]; GO:0008286 - insulin receptor signaling pathway [Evidence IMP]; GO:0030238 - male sex determination [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0046777 - protein amino acid autophosphorylation [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0051290 - protein heterotetramerization [Evidence ISS]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation product : insulin receptor protein_id : NP_034698.1

name	A430078G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701883 GeneID:319493 MGI:2442135
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC319493 protein_id : NP_001028550.1

name	Arhgef18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41056261 CCDS:CCDS22060.1 GeneID:102098 MGI:2142567
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence ISS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence ISS]; GO:0008360 - regulation of cell shape [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence ISS] codon_start : 1 product : rho/rac guanine nucleotide exchange factor (GEF) 18 protein_id : NP_598723.3

name	Pex11c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735445 CCDS:CCDS22061.1 GeneID:69129 MGI:1920905
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005778 - peroxisomal membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_process : GO:0016559 - peroxisome fission [Evidence IEA] codon_start : 1 product : peroxisomal biogenesis factor 11c protein_id : NP_081227.1

name	1700019B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916147 GeneID:76406 MGI:1923656
definition	codon_start : 1 product : hypothetical protein LOC76406 protein_id : XP_133982.5

name	Zfp358 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133922567 GeneID:140482 MGI:2153740
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 358 protein_id : NP_536709.2

name	Mcoln1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716463 CCDS:CCDS22063.1 GeneID:94178 MGI:1890498
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence ISS]; GO:0005764 - lysosome [Evidence IEA]; GO:0016020 - membrane [Evidence ISS] [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005261 - cation channel activity [Evidence ISS]; GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0016197 - endosome transport [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : mucolipin 1 protein_id : NP_444407.1

name	Pnpla6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657401 GeneID:50767 MGI:1354723
definition	GO_component : GO:0005624 - membrane fraction [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence ISS] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0009887 - organ morphogenesis [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Swiss cheese; Swiss-cheese product : neuropathy target esterase protein_id : NP_056616.1

name	C330021F23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701558 GeneID:546049 MGI:3612471
definition	codon_start : 1 product : hypothetical protein LOC546049 protein_id : NP_001019899.1

name	2310057J16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:73476383 CCDS:CCDS22064.1 GeneID:69697 MGI:1916947
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC69697 protein_id : NP_081447.1

name	Xab2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385660 CCDS:CCDS22065.1 GeneID:67439 MGI:1914689
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IC] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0001824 - blastocyst development [Evidence IMP]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006396 - RNA processing [Evidence IEA]; GO:0006350 - transcription [Evidence ISS] [Evidence IEA]; GO:0006283 - transcription-coupled nucleotide-excision repair [Evidence ISS] codon_start : 1 product : XPA binding protein 2 protein_id : NP_080432.1

name	Pcp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679225 CCDS:CCDS22066.1 GeneID:18545 MGI:97508
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IPI] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Purkinje cell-specific protein L7 product : Purkinje cell protein 2 protein_id : NP_032816.1

name	Stxbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755688 CCDS:CCDS22067.1 GeneID:20911 MGI:107370
definition	GO_function : GO:0019905 - syntaxin binding [Evidence TAS] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0006904 - vesicle docking during exocytosis [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 note : syntaxin binding protein Munc18-2 product : syntaxin binding protein 2 protein_id : NP_035633.1

name	Retn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12667798 CCDS:CCDS22068.1 GeneID:57264 MGI:1888506
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005179 - hormone activity [Evidence IEA] codon_start : 1 note : found in inflammatory zone 3; adipocyte-specific secretory factor product : resistin protein_id : NP_075360.1

name	1810033B17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109659834 CCDS:CCDS22069.1 GeneID:69189 MGI:1916439
definition	codon_start : 1 product : RIKEN cDNA 1810033B17 protein_id : NP_081261.1

name	LOC664858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258348 GeneID:664858
definition	codon_start : 1 product : hypothetical protein protein_id : XP_978185.2

name	Trappc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541949 CCDS:CCDS22070.1 GeneID:66682 MGI:1913932
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : trafficking protein particle complex 5 protein_id : NP_079977.2

name	Fcer2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305051 CCDS:CCDS22071.1 GeneID:14128 MGI:95497
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0019863 - IgE binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 note : FC epsilon RII; low-affinity IgE receptor product : Fc receptor, IgE, low affinity II, alpha polypeptide protein_id : NP_038545.1

name	Clec4g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037435 CCDS:CCDS22072.1 GeneID:75863 MGI:1923113
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : C-type lectin domain family 4, member g protein_id : NP_083741.1

name	Cd209a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875404 CCDS:CCDS22073.1 GeneID:170786 MGI:2157942
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : CD209a antigen protein_id : NP_573501.1

name	LOC664870 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258350 GeneID:664870
definition	codon_start : 1 product : similar to WTAP protein protein_id : XP_001473632.1

name	Cd209e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777739 CCDS:CCDS22074.1 GeneID:170780 MGI:2157948
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : Cd209e antigen protein_id : NP_570975.1

name	Cd209d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777736 CCDS:CCDS22075.1 GeneID:170779 MGI:2157947
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 product : CD209d antigen protein_id : NP_570974.1

name	Cd209b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699406 CCDS:CCDS22076.1 GeneID:69165 MGI:1916415
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030247 - polysaccharide binding [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0001872 - zymosan binding [Evidence IDA] GO_process : GO:0016045 - detection of bacterium [Evidence IDA]; GO:0001879 - detection of yeast [Evidence IDA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : CD209b antigen isoform b protein_id : NP_001032889.1

name	Cd209b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83699398 CCDS:CCDS22077.1 GeneID:69165 MGI:1916415
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0030247 - polysaccharide binding [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence ISS] [Evidence IEA]; GO:0001872 - zymosan binding [Evidence IDA] GO_process : GO:0016045 - detection of bacterium [Evidence IDA]; GO:0001879 - detection of yeast [Evidence IDA]; GO:0006897 - endocytosis [Evidence IEA]; GO:0006910 - phagocytosis, recognition [Evidence IDA]; GO:0050766 - positive regulation of phagocytosis [Evidence IDA]; GO:0042535 - positive regulation of tumor necrosis factor-alpha biosynthesis [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : CD209b antigen isoform a protein_id : NP_081248.2

name	Cd209c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18777733 CCDS:CCDS22078.1 GeneID:170776 MGI:2157945
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005537 - mannose binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : CD209c antigen protein_id : NP_570973.1

name	EG384770 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38089095 GeneID:384770 MGI:3644319
definition	codon_start : 1 product : similar to Lman2l protein protein_id : XP_357856.1

name	EG664905 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258333 GeneID:664905 MGI:3647493
definition	codon_start : 1 product : similar to SIGNR2 protein_id : XP_978451.2

name	LOC631071 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258354 GeneID:631071
definition	codon_start : 1 product : similar to RIKEN cDNA 2610208M17 gene protein_id : XP_001473823.1

name	Cd209f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82916367 GeneID:69142 MGI:1916392
definition	codon_start : 1 product : CD209f antigen isoform 1 protein_id : XP_284386.3

name	Cd209g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258335 GeneID:70192 MGI:1917442
definition	codon_start : 1 product : CD209g antigen protein_id : XP_284376.6

name	B130050I23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111074548 GeneID:213027 MGI:2442167
definition	codon_start : 1 note : ecotropic viral integration site 5-like product : hypothetical protein LOC213027 protein_id : NP_001034667.2

name	BC068157 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402167 GeneID:73072 MGI:3605626
definition	codon_start : 1 product : hypothetical protein LOC73072 protein_id : NP_997086.1

name	Lrrc8e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51890211 CCDS:CCDS22079.1 GeneID:72267 MGI:1919517
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : leucine rich repeat containing 8 family, member E protein_id : NP_082451.1

name	Map2k7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347549 GeneID:26400 MGI:1346871
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; protein kinase, mitogen activated, kinase 7; MAP kinase kinase 7 product : mitogen activated protein kinase kinase 7 isoform 1 protein_id : NP_001036022.1

name	Map2k7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347551 GeneID:26400 MGI:1346871
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 function : activates JNK group of MAP kinases note : isoform 2 is encoded by transcript variant 2; protein kinase, mitogen activated, kinase 7; MAP kinase kinase 7 product : mitogen activated protein kinase kinase 7 isoform 2 protein_id : NP_036074.2

name	LOC100039590 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258337 GeneID:100039590
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473199.1

name	Snapc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527188 CCDS:CCDS22081.1 GeneID:102209 MGI:1914861
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : small nuclear RNA activating complex, polypeptide 2 protein_id : NP_598729.1

name	Ctxn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304001 GeneID:330695 MGI:88566
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : cortexin product : cortexin 1 protein_id : NP_899138.1

name	Timm44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19705563 CCDS:CCDS22083.1 GeneID:21856 MGI:1343262
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0015450 - protein translocase activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : translocator of inner mitochondrial membrane 44 protein_id : NP_035722.1

name	Elavl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542602 CCDS:CCDS22084.1 GeneID:15568 MGI:1100851
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0048255 - mRNA stabilization [Evidence IMP] codon_start : 1 note : HU-antigen A product : ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) protein_id : NP_034615.2

name	Ccl25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677881 CCDS:CCDS22085.1 GeneID:20300 MGI:1099448
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IDA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0050900 - leukocyte migration [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine A25; small inducible chemokine 25 product : chemokine (C-C motif) ligand 25 protein_id : NP_033164.1

name	EG664801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664801
definition	number : 1 pseudo : _no_value

name	EG664801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664801
definition	number : 2 pseudo : _no_value

name	EG664801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664801
definition	number : 3 pseudo : _no_value

name	EG664801 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664801
definition	number : 4 pseudo : _no_value

name	LOC664915 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:664915
definition	number : 1 pseudo : _no_value

name	LOC664888 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258351 GeneID:664888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 70 ESTs, 3 Proteins product : similar to exportin, tRNA (nuclear export receptor for tRNAs) pseudo : _no_value transcript_id : XR_031349.1

name	LOC664922 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258352 GeneID:664922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 37 Proteins product : similar to rac gtpase pseudo : _no_value transcript_id : XR_031369.1

name	LOC664977 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258338 GeneID:664977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 7 Proteins product : similar to ribosomal protein L32 pseudo : _no_value transcript_id : XR_031087.1

clone name	MSMg01-483C07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494P24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533D22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-389C19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-350J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-321I18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-196I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-320O01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-498B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113F06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C04
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-026H07.b	B6Ng01-026H07.g
ACC	DH857494	DH857495
length	845	110
definition	DH857494\|Mus musculus domesticus DNA, BAC clone: B6Ng01-026H07, 5' end.	DH857495\|Mus musculus domesticus DNA, BAC clone: B6Ng01-026H07, 3' end.
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(3,357,309 - 3,358,153)	(3,470,607 - 3,470,716)
sequence	gaattctctacttctttctccttatcttctatcatctccttactgtccac tgtctgagtctgaataggtgctagactgtatgttgccttgtaaatctatc ccagtgtctgtgtgtccatgactaagtgctttgctctgtatttattgaac tgcaaagaaagagccacaaagggaaggaatgggttttttttaagaagaag ggttgaagtcacctgctccagctgactcatgtaacaaacacaactggaag cagacttatgagcctatgttgaaacctcatttatggtagttatttgtctt ataaggttcttttaacctgttggctatttgataaacaactaagctgaacc atcgaacatgagatgctggaccacattctggtcccttgcagagagccttt gggttctcaagggtgccccttctctccttgttcctttcctctcttctgtt tctcttccttcccttgctcttccttcctttcctcttcctcccctcccctc tgttccctcttgtttccttcccaggggaagatagcagtcagccaaagtca aaacatgtaggacgcacagagagaagaccagaaagagactttggggacta tttgggttctgaggggggaggattcaggatcgtctctggcttggtggggg cagaggcgggatgggagtgggtcaatggtcgggtgcagggagacaggatc atagatagtcccaggtttacagttacggtggttggagatcatgtgcctca caccactattctggaatttgctttcagtacagtattgcctgagtttcata gacaaattcatattttattatgagggaagagggactatgtaagat	tgtcagagactcaaacatggaatttgagttttcagagcctcagttttgta atctgggaaatggtatggagaatagtgatgaatttagaagtagatgtgta tgtgggggta
quality values	Open. Hide. 47 37 50 27 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 18 18 18 18 13 21 12 19 27 20 55 59 61 61 61 61 61 61 61 61 55 44 43 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 37 30 34 35 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 50 61 61 59 61 61 59 59 61 59 61 59 61 59 52 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 59 44 59 59 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 45 61 52 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 55 61 61 55 61 61 55 61 61 61 61 55 61 55 55 61 61 55 55 55 61 61 61 43 61 55 61 55 50 61 61 61 50 55 55 43 61 55 55 49 37 55 50 50 50 61 55 61 55 61 61 61 39 55 61 61 61 50 61 49 47 61 61 61 61 61 53 61 52 52 53 61 35 61 50 61 50 61 47 27 61 31 14 61 50 50 38 61 38 24 50 43 53 53 61 43 52 50 47 12 14 10 15 7 14 61 61 53 61 61 38 61 42 61 29 53 52 50 53 53 40 31 46 47 42 47 34 39 42 27 31 28 30 39 38 52 61 61 28 61 39 61 38 32 42 38 39 17 47 47 47 23 42 33 20 15 32 38 42 33 42 38 47 31 31 40 45 39 34 43 34 43 40 36 50 50 50 53 38 45 47 53 45 45 34 43 17 47 7 42 38 40 43 50 43 43 30 50 38 33 22 20 47 27 30 33 38 47 45 30 28 24 23 28 36 37 45 50 19 32 40 40 52 34 42 26 13 18 33 45 34 17 26 13 15 20 14 24 24 33 17 19 8 26 15 19 26 21 37 32 45 38 15 52 28 32 27 15 17 20 17 28 23 10 10 7 17 13 8 16 22 8 8 46 40 42 23 12 47 20 32 30 36 12 45 20 50 42 20 52 19 50 20 32 10 12 18 32 17 13 12 8 22 21 12	Open. Hide. 12 14 11 22 10 10 19 11 16 13 43 43 39 37 59 61 61 59 61 61 61 59 59 61 59 59 61 59 61 61 61 61 59 59 59 61 61 61 61 61 61 59 61 24 26 20 18 13 24 13 18 27 29 44 61 61 61 61 61 61 59 61 59 59 61 59 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 59 47 55 61 49 47 61 55 61 61 55 55 21 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_3357309_3358153
seq2: B6Ng01-026H07.b_48_892

seq1  GAATTCTCTACTTCTTTCTCCTTATCTTCTATCATCTCCTTACTGTCCAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTACTTCTTTCTCCTTATCTTCTATCATCTCCTTACTGTCCAC  50

seq1  TGTCTGAGTCTGAATAGGTGCTAGACTGTATGTTGCCTTGTAAATCTATC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTGAGTCTGAATAGGTGCTAGACTGTATGTTGCCTTGTAAATCTATC  100

seq1  CCAGTGTCTGTGTGTCCATGACTAAGTGCTTTGCTCTGTATTTATTGAAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTGTCTGTGTGTCCATGACTAAGTGCTTTGCTCTGTATTTATTGAAC  150

seq1  TGCAAAGAAAGAGCCACAAAGGGAAGGAATGGGTTTTTTTTAAGAAGAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAAAGAAAGAGCCACAAAGGGAAGGAATGGGTTTTTTTTAAGAAGAAG  200

seq1  GGTTGAAGTCACCTGCTCCAGCTGACTCATGTAACAAACACAACTGGAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTGAAGTCACCTGCTCCAGCTGACTCATGTAACAAACACAACTGGAAG  250

seq1  CAGACTTATGAGCCTATGTTGAAACCTCATTTATGGTAGTTATTTGTCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACTTATGAGCCTATGTTGAAACCTCATTTATGGTAGTTATTTGTCTT  300

seq1  ATAAGGTTCTTTTAACCTGTTGGCTATTTGATAAACAACTAAGCTGAACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGGTTCTTTTAACCTGTTGGCTATTTGATAAACAACTAAGCTGAACC  350

seq1  ATCGAACATGAGATGCTGGACCACATTCTGGTCCCTTGCAGAGAGCCTTT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCGAACATGAGATGCTGGACCACATTCTGGTCCCTTGCAGAGAGCCTTT  400

seq1  GGGTTCTCAAGGGTGCCCCTTCTCTCCTTGTTCCTTTCCTCTCTTCTGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTCTCAAGGGTGCCCCTTCTCTCCTTGTTCCTTTCCTCTCTTCTGTT  450

seq1  TCTCTTCCTTCCCTTGCTCTTCCTTCCTTTCCTCTTCCTCCCCTCCCCTC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTTCCTTCCCTTGCTCTTCCTTCCTTTCCTCTTCCTCCCCTCCCCTC  500

seq1  TGTTCCCTCTTGTTTCCTTCCCAGGGGAAGATAGCAGTCAGCCAAAGTCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCCCTCTTGTTTCCTTCCCAGGGGAAGATAGCAGTCAGCCAAAGTCA  550

seq1  AAACATGTAGGACGCACAGAGAGAAGACCAGAAAGAGACTTTGGGGACTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACATGTAGGACGCACAGAGAGAAGACCAGAAAGAGACTTTGGGGACTA  600

seq1  TTTGGGTTCTGAGGGGGGAGGATTCAGGATCGTCTCTGGCTTGGTGGGGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGGTTCTGAGGGGGGAGGATTCAGGATCGTCTCTGGCTTGGTGGGGG  650

seq1  CAGAGGCGGGATGGGAGTGGGTCAATGGTCGGGTGCAGGGAGACAGGATC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGGCGGGATGGGAGTGGGTCAATGGTCGGGTGCAGGGAGACAGGATC  700

seq1  ATAGATAGTCCCAGGTTTACAGTTACGGTGGTTGGAGATCATGTGCCTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGATAGTCCCAGGTTTACAGTTACGGTGGTTGGAGATCATGTGCCTCA  750

seq1  CACCACTATTCTGGAATTTGCTTTCAGTACAGTATTGCCTGAGTTTCATA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACTATTCTGGAATTTGCTTTCAGTACAGTATTGCCTGAGTTTCATA  800

seq1  GACAATTCAATATTTTATTATGAGGGAAGAGGGACTATGTAAGAT  845
      ||||| |  ||||||||||||||||||||||||||||||||||||
seq2  GACAAATTCATATTTTATTATGAGGGAAGAGGGACTATGTAAGAT  845

seq1: chr8_3470607_3470716
seq2: B6Ng01-026H07.g_75_184 (reverse)

seq1  TACCCCCACATACACATCTACTTCTAAATTCATCACTATTCTCCATACCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACCCCCACATACACATCTACTTCTAAATTCATCACTATTCTCCATACCA  50

seq1  TTTCCCAGATTACAAAACTGAGGCTCTGAAAACTCAAATTCCATGTTTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCCAGATTACAAAACTGAGGCTCTGAAAACTCAAATTCCATGTTTGA  100

seq1  GTCTCTGACA  110
      ||||||||||
seq2  GTCTCTGACA  110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information