MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-046O19
Chromosome	8 (Build37)
Map Location	74,100,112 - 74,100,659
singlet/doublet	singlet
Overlap gene	Slc27a1
Upstream gene	Ell, Isyna1, Ssbp4, Lrrc25, Gdf15, Pgpep1, Lsm4, Jund1, 2410018E23Rik, LOC100041434, Pde4c, Rab3a, BC051227, Ifi30, Pik3r2, LOC100041971, Mast3, Il12rb1, Arrdc2, Kcnn1, LOC100042011, Ccdc124, Slc5a5, Rpl18a, Snora68, Mtap1s, LOC100042057, LOC665858, LOC384645, LOC100041583, EG621377, 2410004L22Rik, Myo9b, 2010315L10Rik, Ocel1, Nr2f6, Ushbp1, 5430437P03Rik, Ankrd41, Abhd8, Mrpl34, 1500034J01Rik, Tmem16h, Gtpbp3, Plvap, LOC665928, Bst2, 1110012M11Rik, BC033932, Txnl6
Downstream gene	Pgls, Bcnp1, Glt25d1, Unc13a, Jak3, Insl3, B3gnt3, LOC100042289, Fcho1, EG665991, LOC665996, LOC385024, LOC675190, Zfp709, LOC670453, Zfp617, BC049349, Cyp4f18, LOC666033, Olfr372, Olfr373, Olfr374, Tpm4, Rab8a, Hsh2d, Cib3, 2510049I19Rik, Ap1m1, LOC384840, LOC100042405, Klf2, Eps15l1, Calr3, LOC100042421, 1700030K09Rik, Cherp, Slc35e1, Crsp7, LOC100042439, 9130011J15Rik, Tmem38a
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ell (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13716 MGI:109377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Isyna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71780 MGI:1919030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76900 MGI:1924150
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211228 MGI:2445284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdf15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23886 MGI:1346047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgpep1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66522 MGI:1913772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50783 MGI:1354692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jund1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16478 MGI:96648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410018E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637079 MGI:1916991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	LOC100041434 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	Pde4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110385 MGI:99556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19339 MGI:97843
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC051227 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234384 MGI:2681846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifi30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65972 MGI:2137648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3r2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18709 MGI:1098772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Mast3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546071 MGI:2683541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 57 ESTs, 17 Proteins

name	Il12rb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16161 MGI:104579
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arrdc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70807 MGI:1918057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kcnn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84036 MGI:1933993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042011 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Ccdc124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234388 MGI:1916403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc5a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114479 MGI:2149330
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl18a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76808 MGI:1924058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snora68 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104370 MGI:2148181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtap1s (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270058 MGI:2443304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST pseudo : _no_value

name	LOC665858 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	LOC384645 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	LOC100041583 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041583
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG621377 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621377 MGI:3648141
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	2410004L22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76478 MGI:1923728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myo9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17925 MGI:106624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010315L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67023 MGI:1914273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ocel1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77090 MGI:1924340
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr2f6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13864 MGI:1352453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ushbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234395 MGI:1922920
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5430437P03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68251 MGI:1915501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankrd41 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234396 MGI:1918775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 11 ESTs, 1 Protein

name	Abhd8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64296 MGI:1918946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94065 MGI:2137227
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500034J01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66498 MGI:1913748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 147 ESTs, 3 Proteins

name	Tmem16h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382014 MGI:2687327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 209 ESTs, 9 Proteins

name	Gtpbp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70359 MGI:1917609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plvap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84094 MGI:1890497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665928 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 37 ESTs, 37 Proteins pseudo : _no_value

name	Bst2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69550 MGI:1916800
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110012M11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73711 MGI:1920961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC033932 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434325 MGI:3525074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Txnl6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234404 MGI:1924446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc27a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26457 MGI:1347098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pgls (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66171 MGI:1913421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcnp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:100037278 MGI:3686743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein

name	Glt25d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234407 MGI:1924348
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Unc13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382018 MGI:3051532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jak3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16453 MGI:99928
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Insl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16336 MGI:108427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B3gnt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72297 MGI:2152535
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042289 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 226 ESTs, 21 Proteins pseudo : _no_value

name	Fcho1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74015 MGI:1921265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665991 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665991 MGI:3645671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC665996 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665996
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC385024 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC675190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Zfp709 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236193 MGI:2384299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670453 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs pseudo : _no_value

name	Zfp617 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170938 MGI:2684459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC049349 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234413 MGI:3583954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 ESTs

name	Cyp4f18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72054 MGI:1919304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 20 Proteins pseudo : _no_value

name	Olfr372 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404315 MGI:3030206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr373 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258532 MGI:3030207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr374 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258335 MGI:3030208
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tpm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:326618 MGI:2449202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17274 MGI:96960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsh2d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209488 MGI:2676364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cib3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234421 MGI:2685953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins

name	2510049I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67922 MGI:1915172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1m1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11767 MGI:102776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 844 ESTs, 1 Protein pseudo : _no_value

name	LOC100042405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 908 ESTs, 10 Proteins

name	Klf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16598 MGI:1342772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eps15l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13859 MGI:104582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73316 MGI:1920566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 22 Proteins

name	1700030K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72254 MGI:1919504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cherp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27967 MGI:106417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270066 MGI:2142403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crsp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70625 MGI:1917875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042439 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	9130011J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66818 MGI:1914068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem38a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74166 MGI:1921416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ell (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124358952 GeneID:13716 MGI:109377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : elongation factor RNA polymerase II transcript_id : NM_007924.2

name	Isyna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963756 GeneID:71780 MGI:1919030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myo-inositol 1-phosphate synthase A1 transcript_id : NM_023627.1

name	Ssbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526995 GeneID:76900 MGI:1924150
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : single stranded DNA binding protein 4 transcript_id : NM_133772.1

name	Lrrc25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347603 GeneID:211228 MGI:2445284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 25 transcript_id : NM_153074.3

name	Gdf15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753967 GeneID:23886 MGI:1346047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth differentiation factor 15 transcript_id : NM_011819.1

name	Pgpep1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373774 GeneID:66522 MGI:1913772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyroglutamyl-peptidase I transcript_id : NM_023217.3

name	Lsm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376589 GeneID:50783 MGI:1354692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_015816.2

name	Jund1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41352710 GeneID:16478 MGI:96648
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Jun proto-oncogene related gene d1 transcript_id : NM_010592.3

name	2410018E23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258879 GeneID:637079 MGI:1916991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : RIKEN cDNA 2410018E23 gene transcript_id : XM_979362.2

name	LOC100041434 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258881 GeneID:100041434
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : similar to mucin 2 precursor transcript_id : XM_001476374.1

name	Pde4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130951 GeneID:110385 MGI:99556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphodiesterase 4C, cAMP specific transcript_id : NM_201607.2

name	Rab3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346487 GeneID:19339 MGI:97843
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB3A, member RAS oncogene family transcript_id : NM_009001.4

name	BC051227 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130711 GeneID:234384 MGI:2681846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC051227 transcript_id : NM_183170.2

name	Ifi30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628656 GeneID:65972 MGI:2137648
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon gamma inducible protein 30 transcript_id : NM_023065.3

name	Pik3r2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679320 GeneID:18709 MGI:1098772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta) transcript_id : NM_008841.1

name	LOC100041971 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258896 GeneID:100041971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100041971 transcript_id : XM_001477714.1

name	Mast3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383614 GeneID:546071 MGI:2683541
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 52 ESTs, 17 Proteins product : microtubule associated serine/threonine kinase 3, transcript variant 2 transcript_id : XM_888290.2

name	Il12rb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680398 GeneID:16161 MGI:104579
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 12 receptor, beta 1 transcript_id : NM_008353.1

name	Arrdc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037218 GeneID:70807 MGI:1918057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin domain containing 2 transcript_id : NM_027560.1

name	Kcnn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14161695 GeneID:84036 MGI:1933993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 transcript_id : NM_032397.1

name	LOC100042011 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258898 GeneID:100042011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042011 transcript_id : XM_001477857.1

name	Ccdc124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893353 GeneID:234388 MGI:1916403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 124 transcript_id : NM_026964.3

name	Slc5a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17298677 GeneID:114479 MGI:2149330
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 5 (sodium iodide symporter), member 5 transcript_id : NM_053248.1

name	Rpl18a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803580 GeneID:76808 MGI:1924058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ribosomal protein L18A transcript_id : NM_029751.3

name	Mtap1s (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802735 GeneID:270058 MGI:2443304
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1S transcript_id : NM_173013.2

name	LOC665858 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258885 GeneID:665858
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : similar to ankyrin repeat domain 26 transcript_id : XM_001476565.1

name	2410004L22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802841 GeneID:76478 MGI:1923728
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410004L22 gene transcript_id : NM_029621.2

name	Myo9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124053458 GeneID:17925 MGI:106624
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin IXb transcript_id : NM_015742.2

name	2010315L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348354 GeneID:67023 MGI:1914273
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010315L10 gene transcript_id : NM_025917.2

name	2010315L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119360275 GeneID:67023 MGI:1914273
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010315L10 gene transcript_id : NM_029768.3

name	Ocel1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037486 GeneID:77090 MGI:1924340
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : occludin/ELL domain containing 1 transcript_id : NM_029865.1

name	Nr2f6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807198 GeneID:13864 MGI:1352453
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 2, group F, member 6 transcript_id : NM_010150.2

name	Ushbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340881 GeneID:234395 MGI:1922920
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Usher syndrome 1C binding protein 1 transcript_id : NM_181418.2

name	5430437P03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794445 GeneID:68251 MGI:1915501
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430437P03 gene transcript_id : NM_026636.1

name	Ankrd41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258903 GeneID:234396 MGI:1918775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : ankyrin repeat domain 41, transcript variant 2 transcript_id : XM_001478177.1

name	Ankrd41 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258901 GeneID:234396 MGI:1918775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : ankyrin repeat domain 41, transcript variant 1 transcript_id : XM_001478168.1

name	Abhd8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803545 GeneID:64296 MGI:1918946
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 8 transcript_id : NM_022419.2

name	Mrpl34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145576 GeneID:94065 MGI:2137227
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L34 transcript_id : NM_053162.2

name	1500034J01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258889 GeneID:66498 MGI:1913748
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 147 ESTs, 3 Proteins product : RIKEN cDNA 1500034J01 gene transcript_id : XM_001476732.1

name	Tmem16h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383629 GeneID:382014 MGI:2687327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 209 ESTs, 9 Proteins product : transmembrane protein 16H, transcript variant 1 transcript_id : XM_889480.2

name	Gtpbp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130758 GeneID:70359 MGI:1917609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GTP binding protein 3 transcript_id : NM_032544.3

name	Plvap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14161697 GeneID:84094 MGI:1890497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasmalemma vesicle associated protein transcript_id : NM_032398.1

name	Bst2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366701 GeneID:69550 MGI:1916800
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone marrow stromal cell antigen 2 transcript_id : NM_198095.2

name	1110012M11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753999 GeneID:73711 MGI:1920961
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012M11 gene transcript_id : NM_028617.2

name	BC033932 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258905 GeneID:434325 MGI:3525074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : cDNA sequence BC033932 transcript_id : XM_486124.5

name	Txnl6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704203 GeneID:234404 MGI:1924446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin-like 6 transcript_id : NM_145598.1

name	Slc27a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129963 GeneID:26457 MGI:1347098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 27 (fatty acid transporter), member 1 transcript_id : NM_011977.3

name	Pgls (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370963 GeneID:66171 MGI:1913421
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-phosphogluconolactonase transcript_id : NM_025396.2

name	Bcnp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258906 GeneID:100037278 MGI:3686743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 1 Protein product : BCNP1 homolog transcript_id : XM_001478428.1

name	Glt25d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387811 GeneID:234407 MGI:1924348
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycosyltransferase 25 domain containing 1 transcript_id : NM_146211.2

name	Unc13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274169 GeneID:382018 MGI:3051532
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : unc-13 homolog A (C. elegans) transcript_id : NM_001029873.1

name	Jak3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372856 GeneID:16453 MGI:99928
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Janus kinase 3 transcript_id : NM_010589.4

name	Insl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133922576 GeneID:16336 MGI:108427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin-like 3 transcript_id : NM_013564.5

name	B3gnt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982624 GeneID:72297 MGI:2152535
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 transcript_id : NM_028189.2

name	Fcho1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27754000 GeneID:74015 MGI:1921265
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FCH domain only 1 transcript_id : NM_028715.2

name	EG665991 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383649 GeneID:665991 MGI:3645671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG665991 transcript_id : XM_980754.1

name	LOC385024 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258892 GeneID:385024
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to ankyrin repeat domain 26 transcript_id : XM_001476883.1

name	Zfp709 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366804 GeneID:236193 MGI:2384299
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 709 transcript_id : NM_145624.3

name	Zfp617 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723418 GeneID:170938 MGI:2684459
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 617 transcript_id : NM_133358.2

name	BC049349 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258894 GeneID:234413 MGI:3583954
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 57 ESTs product : cDNA sequence BC049349 transcript_id : XM_981031.2

name	Cyp4f18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13277363 GeneID:72054 MGI:1919304
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 4, subfamily f, polypeptide 18 transcript_id : NM_024444.1

name	Olfr372 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46430569 GeneID:404315 MGI:3030206
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 372 transcript_id : NM_207555.1

name	Olfr373 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892893 GeneID:258532 MGI:3030207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 373 transcript_id : NM_146539.2

name	Olfr374 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129620 GeneID:258335 MGI:3030208
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 374 transcript_id : NM_146338.1

name	Tpm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47894397 GeneID:326618 MGI:2449202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tropomyosin 4 transcript_id : NM_001001491.1

name	Rab8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38372904 GeneID:17274 MGI:96960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB8A, member RAS oncogene family transcript_id : NM_023126.2

name	Hsh2d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37537545 GeneID:209488 MGI:2676364
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hematopoietic SH2 domain containing transcript_id : NM_197944.1

name	Cib3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258911 GeneID:234421 MGI:2685953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins product : calcium and integrin binding family member 3, transcript variant 1 transcript_id : XM_356089.5

name	2510049I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359461 GeneID:67922 MGI:1915172
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510049I19 gene transcript_id : NM_026455.3

name	Ap1m1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372671 GeneID:11767 MGI:102776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex AP-1, mu subunit 1 transcript_id : NM_007456.2

name	LOC100042405 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258914 GeneID:100042405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 908 ESTs, 10 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001478555.1

name	Klf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680579 GeneID:16598 MGI:1342772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 2 (lung) transcript_id : NM_008452.1

name	Eps15l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349898 GeneID:13859 MGI:104582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epidermal growth factor receptor pathway substrate 15-like 1 transcript_id : NM_007944.2

name	Calr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803185 GeneID:73316 MGI:1920566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calreticulin 3 transcript_id : NM_029782.3

name	Calr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387566 GeneID:73316 MGI:1920566
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calreticulin 3 transcript_id : NM_028500.2

name	LOC100042421 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258916 GeneID:100042421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 22 Proteins product : similar to H3 histone, family 3A transcript_id : XM_001478604.1

name	1700030K09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930438 GeneID:72254 MGI:1919504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700030K09 gene transcript_id : NM_028170.1

name	Cherp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672911 GeneID:27967 MGI:106417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium homeostasis endoplasmic reticulum protein transcript_id : NM_138585.3

name	Slc35e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343073 GeneID:270066 MGI:2142403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member E1 transcript_id : NM_177766.2

name	Crsp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350326 GeneID:70625 MGI:1917875
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 7 transcript_id : NM_027485.2

name	LOC100042439 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258918 GeneID:100042439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100042439 transcript_id : XM_001478638.1

name	9130011J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922668 GeneID:66818 MGI:1914068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130011J15 gene transcript_id : NM_172396.3

name	Tmem38a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362330 GeneID:74166 MGI:1921416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 38a transcript_id : NM_144534.1

name	Ell (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124358953 CCDS:CCDS22372.1 GeneID:13716 MGI:109377
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : eleven-nineteen lysine-rich leukemia product : elongation factor RNA polymerase II protein_id : NP_031950.2

name	Isyna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963757 CCDS:CCDS22373.1 GeneID:71780 MGI:1919030
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA] codon_start : 1 product : myo-inositol 1-phosphate synthase A1 protein_id : NP_076116.1

name	Ssbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526996 CCDS:CCDS22374.1 GeneID:76900 MGI:1924150
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003697 - single-stranded DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : single stranded DNA binding protein 4 protein_id : NP_598533.1

name	Lrrc25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346481 CCDS:CCDS22375.1 GeneID:211228 MGI:2445284
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : monocyte and plasmacytoid activated molecule product : leucine rich repeat containing 25 protein_id : NP_694714.1

name	Gdf15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753968 CCDS:CCDS22376.1 GeneID:23886 MGI:1346047
definition	GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : macrophage inhibiting cytokine-1 product : growth differentiation factor 15 protein_id : NP_035949.1

name	Pgpep1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963583 CCDS:CCDS22377.1 GeneID:66522 MGI:1913772
definition	GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004219 - pyroglutamyl-peptidase I activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence ISS] [Evidence IEA] codon_start : 1 product : putative pyroglutamyl-peptidase I protein_id : NP_075706.1

name	Lsm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657317 GeneID:50783 MGI:1354692
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence ISS] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : putative role in U6 snRNP assembly and function note : U6 snRNA-associated SM-like protein 4 product : LSM4 homolog, U6 small nuclear RNA associated protein_id : NP_056631.1

name	Jund1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754404 GeneID:16478 MGI:96648
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : JunD-FL isoform product : jun D proto-oncogene protein_id : NP_034722.1

name	2410018E23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258880 GeneID:637079 MGI:1916991
definition	codon_start : 1 product : similar to KIAA1683 protein protein_id : XP_984456.2

name	LOC100041434 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258882 GeneID:100041434
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476424.1

name	Pde4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475542 CCDS:CCDS22378.1 GeneID:110385 MGI:99556
definition	GO_function : GO:0004115 - 3',5'-cyclic-AMP phosphodiesterase activity [Evidence IEA]; GO:0004114 - 3',5'-cyclic-nucleotide phosphodiesterase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : phosphodiesterase 4C, cAMP specific protein_id : NP_963901.1

name	Rab3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679593 CCDS:CCDS22379.1 GeneID:19339 MGI:97843
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0006887 - exocytosis [Evidence IEA]; GO:0017157 - regulation of exocytosis [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB3A, member RAS oncogene family protein_id : NP_033027.1

name	BC051227 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147205 CCDS:CCDS22380.1 GeneID:234384 MGI:2681846
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234384 protein_id : NP_898993.1

name	Ifi30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628657 GeneID:65972 MGI:2137648
definition	GO_component : GO:0005764 - lysosome [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence TAS] GO_process : GO:0019886 - antigen processing and presentation of exogenous peptide antigen via MHC class II [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy note : lysosomal thiol reductase IP30; lysosomal thio reductase IP30 product : interferon gamma inducible protein 30 protein_id : NP_075552.2

name	Pik3r2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679321 CCDS:CCDS22381.1 GeneID:18709 MGI:1098772
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005942 - phosphoinositide 3-kinase complex [Evidence NAS] [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0016303 - phosphatidylinositol 3-kinase activity [Evidence IMP]; GO:0035014 - phosphoinositide 3-kinase regulator activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence NAS]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0019987 - negative regulation of anti-apoptosis [Evidence IMP]; GO:0042325 - regulation of phosphorylation [Evidence NAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta) protein_id : NP_032867.1

name	LOC100041971 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258897 GeneID:100041971
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477764.1

name	Mast3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383615 GeneID:546071 MGI:2683541
definition	codon_start : 1 product : microtubule associated serine/threonine kinase 3 isoform 2 protein_id : XP_893383.2

name	Il12rb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680399 CCDS:CCDS22382.1 GeneID:16161 MGI:104579
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : interleukin 12 receptor, beta 1 protein_id : NP_032379.1

name	Arrdc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037219 GeneID:70807 MGI:1918057
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : induced by lysergic acid diethylamide-1 product : arrestin domain containing 2 protein_id : NP_081836.1

name	Kcnn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14161696 GeneID:84036 MGI:1933993
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015269 - calcium-activated potassium channel activity [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IDA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0016286 - small conductance calcium-activated potassium channel activity [Evidence ISS] [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : small conductance calcium-activated potassium channel protein 1 product : potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 protein_id : NP_115773.1

name	LOC100042011 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258899 GeneID:100042011
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477907.1

name	Ccdc124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059143 CCDS:CCDS22384.1 GeneID:234388 MGI:1916403
definition	codon_start : 1 product : coiled-coil domain containing 124 protein_id : NP_081240.1

name	Slc5a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17298678 CCDS:CCDS22385.1 GeneID:114479 MGI:2149330
definition	GO_function : GO:0031402 - sodium ion binding [Evidence IEA]; GO:0008507 - sodium:iodide symporter activity [Evidence IDA]; GO:0015293 - symporter activity [Evidence IDA] GO_process : GO:0006811 - ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 5 (sodium iodide symporter), member 5 protein_id : NP_444478.1

name	Rpl18a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037465 CCDS:CCDS22386.1 GeneID:76808 MGI:1924058
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : Ribosomal protein L18A protein_id : NP_084027.1

name	Mtap1s (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370520 CCDS:CCDS22387.1 GeneID:270058 MGI:2443304
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005829 - cytosol [Evidence ISS]; GO:0030425 - dendrite [Evidence IDA]; GO:0005874 - microtubule [Evidence IDA]; GO:0005634 - nucleus [Evidence ISS]; GO:0048471 - perinuclear region [Evidence ISS] GO_function : GO:0051015 - actin filament binding [Evidence IDA]; GO:0048487 - beta-tubulin binding [Evidence ISS]; GO:0003677 - DNA binding [Evidence ISS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0042802 - identical protein binding [Evidence IDA]; GO:0008017 - microtubule binding [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence ISS]; GO:0007420 - brain development [Evidence IEP]; GO:0001578 - microtubule bundle formation [Evidence ISS]; GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IDA]; GO:0007399 - nervous system development [Evidence IEP]; GO:0048812 - neurite morphogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : microtubule-associated protein 8 product : BPY2 interacting protein 1 protein_id : NP_766601.1

name	LOC665858 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258886 GeneID:665858
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476615.1

name	2410004L22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386422 CCDS:CCDS22389.1 GeneID:76478 MGI:1923728
definition	codon_start : 1 exception : mismatches in translation product : RIKEN cDNA 2410004L22 protein_id : NP_083897.1

name	Myo9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124053459 GeneID:17925 MGI:106624
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : myosin IXb protein_id : NP_056557.2

name	2010315L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630259 CCDS:CCDS22390.1 GeneID:67023 MGI:1914273
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IMP]; GO:0007041 - lysosomal transport [Evidence IMP]; GO:0030163 - protein catabolism [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; mouse embryonic development factor 2 product : hypothetical protein LOC67023 isoform 1 protein_id : NP_080193.1

name	2010315L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21630273 GeneID:67023 MGI:1914273
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005764 - lysosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IMP]; GO:0007041 - lysosomal transport [Evidence IMP]; GO:0030163 - protein catabolism [Evidence IMP]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; mouse embryonic development factor 2 product : hypothetical protein LOC67023 isoform 2 protein_id : NP_084044.1

name	Ocel1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037487 CCDS:CCDS22391.1 GeneID:77090 MGI:1924340
definition	GO_function : GO:0003746 - translation elongation factor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : occludin/ELL domain containing 1 protein_id : NP_084141.1

name	Nr2f6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807199 CCDS:CCDS22392.1 GeneID:13864 MGI:1352453
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0004879 - ligand-dependent nuclear receptor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0050965 - detection of temperature stimulus during sensory perception of pain [Evidence IMP]; GO:0043153 - entrainment of circadian clock by photoperiod [Evidence IMP]; GO:0048666 - neuron development [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : avian erythroblastic leukemia viral (v-erb-a) oncogene homolog-like 2 product : nuclear receptor subfamily 2, group F, member 6 protein_id : NP_034280.2

name	Ushbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31088878 CCDS:CCDS22393.1 GeneID:234395 MGI:1922920
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0030165 - PDZ domain binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : AIE-75 binding protein protein_id : NP_852083.1

name	5430437P03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794446 GeneID:68251 MGI:1915501
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68251 protein_id : NP_080912.1

name	Ankrd41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258904 GeneID:234396 MGI:1918775
definition	codon_start : 1 product : ankyrin repeat domain 41 isoform 2 protein_id : XP_001478227.1

name	Ankrd41 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258902 GeneID:234396 MGI:1918775
definition	codon_start : 1 product : ankyrin repeat domain 41 isoform 1 protein_id : XP_001478218.1

name	Abhd8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11967947 GeneID:64296 MGI:1918946
definition	GO_function : GO:0004301 - epoxide hydrolase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation function : expression of this gene product inhibits the growth of E. coli product : abhydrolase domain containing 8 protein_id : NP_071864.1

name	Mrpl34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716449 GeneID:94065 MGI:2137227
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS] codon_start : 1 product : mitochondrial ribosomal protein L34 protein_id : NP_444392.1

name	1500034J01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258890 GeneID:66498 MGI:1913748
definition	codon_start : 1 product : hypothetical protein LOC66498 protein_id : XP_001476782.1

name	Tmem16h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82917876 GeneID:382014 MGI:2687327
definition	codon_start : 1 product : similar to Tmem16h protein isoform 1 protein_id : XP_894573.1

name	Gtpbp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33414589 GeneID:70359 MGI:1917609
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : GTP binding protein 3 protein_id : NP_115933.2

name	Plvap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14161698 CCDS:CCDS22396.1 GeneID:84094 MGI:1890497
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : plasmalemma vesicle associated protein protein_id : NP_115774.1

name	Bst2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674242 CCDS:CCDS22397.1 GeneID:69550 MGI:1916800
definition	codon_start : 1 note : DAMP-1 protein homolog product : DAMP-1 protein protein_id : NP_932763.1

name	1110012M11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312058 CCDS:CCDS22398.1 GeneID:73711 MGI:1920961
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73711 protein_id : NP_082893.1

name	BC033932 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82917885 GeneID:434325 MGI:3525074
definition	codon_start : 1 product : similar to BC033932 protein protein_id : XP_486124.2

name	Txnl6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704204 GeneID:234404 MGI:1924446
definition	GO_function : GO:0015035 - protein disulfide oxidoreductase activity [Evidence IEA] codon_start : 1 product : thioredoxin-like 6 protein_id : NP_663573.1

name	Slc27a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755546 GeneID:26457 MGI:1347098
definition	GO_component : GO:0031410 - cytoplasmic vesicle [Evidence TAS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence TAS] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence TAS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0001676 - long-chain fatty acid metabolism [Evidence TAS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : fatty acid transport protein product : solute carrier family 27, member 1 protein_id : NP_036107.1

name	Pgls (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384778 CCDS:CCDS22400.1 GeneID:66171 MGI:1913421
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : 6-phosphogluconolactonase protein_id : NP_079672.1

name	Bcnp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258907 GeneID:100037278 MGI:3686743
definition	codon_start : 1 product : similar to LOC498604 protein protein_id : XP_001478478.1

name	Glt25d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122765 CCDS:CCDS22401.1 GeneID:234407 MGI:1924348
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009103 - lipopolysaccharide biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycosyltransferase 25 domain containing 1 protein_id : NP_666323.1

name	Unc13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274170 CCDS:CCDS22402.1 GeneID:382018 MGI:3051532
definition	GO_function : GO:0019992 - diacylglycerol binding [Evidence IDA] GO_process : GO:0050435 - beta-amyloid metabolism [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0016188 - synaptic vesicle maturation [Evidence IMP] codon_start : 1 exception : mismatches in translation product : unc-13 homolog A protein_id : NP_001025044.1

name	Jak3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559418 CCDS:CCDS22403.1 GeneID:16453 MGI:99928
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004718 - Janus kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0048535 - lymph node development [Evidence TAS]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : Janus kinase 3 protein_id : NP_034719.2

name	Insl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119092 CCDS:CCDS22404.1 GeneID:16336 MGI:108427
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0008584 - male gonad development [Evidence IMP]; GO:0007582 - physiological process [Evidence IEA] codon_start : 1 note : relaxin like factor; Ley I-L product : insulin-like 3 protein_id : NP_038592.3

name	B3gnt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982625 CCDS:CCDS22405.1 GeneID:72297 MGI:2152535
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation note : core 1 beta-1,3-N-acetylglucosaminyltransferase product : UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 protein_id : NP_082465.2

name	Fcho1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27754001 GeneID:74015 MGI:1921265
definition	codon_start : 1 exception : mismatches in translation product : FCH domain only 1 protein_id : NP_082991.2

name	EG665991 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383650 GeneID:665991 MGI:3645671
definition	codon_start : 1 product : similar to F2rl3 protein protein_id : XP_985848.1

name	LOC385024 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258893 GeneID:385024
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476933.1

name	Zfp709 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559933 GeneID:236193 MGI:2384299
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 14 protein_id : NP_663599.2

name	Zfp617 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723419 GeneID:170938 MGI:2684459
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : Zinc finger protein s11-6 product : zinc finger protein 617 protein_id : NP_579936.2

name	BC049349 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258895 GeneID:234413 MGI:3583954
definition	codon_start : 1 product : hypothetical protein LOC234413 protein_id : XP_986125.2

name	Cyp4f18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13277364 CCDS:CCDS22406.1 GeneID:72054 MGI:1919304
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0050051 - leukotriene-B4 20-monooxygenase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 4f18 product : cytochrome P450 CYP4F18 protein_id : NP_077764.1

name	Olfr372 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46430570 GeneID:404315 MGI:3030206
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NUPS-191522-192466 product : olfactory receptor 372 protein_id : NP_997438.1

name	Olfr373 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133892894 GeneID:258532 MGI:3030207
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NUPS-231686-232630; olfactory receptor MOR282-1 product : olfactory receptor 373 protein_id : NP_666750.2

name	Olfr374 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129621 CCDS:CCDS22407.1 GeneID:258335 MGI:3030208
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NUPS-241490-242431; olfactory receptor MOR130-1 product : olfactory receptor 374 protein_id : NP_666450.1

name	Tpm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47894398 CCDS:CCDS22408.1 GeneID:326618 MGI:2449202
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] codon_start : 1 product : tropomyosin 4 protein_id : NP_001001491.1

name	Rab8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38372905 CCDS:CCDS22409.1 GeneID:17274 MGI:96960
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008134 - transcription factor binding [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : cell line NK14 derived transforming oncogene protein_id : NP_075615.2

name	Hsh2d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37537546 CCDS:CCDS22410.1 GeneID:209488 MGI:2676364
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005070 - SH3/SH2 adaptor activity [Evidence IDA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0042110 - T cell activation [Evidence IDA] codon_start : 1 note : adaptor protein ALx2 product : hematopoietic SH2 domain containing protein_id : NP_922935.1

name	Cib3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258912 GeneID:234421 MGI:2685953
definition	codon_start : 1 product : calcium and integrin binding family member 3 isoform 1 protein_id : XP_356089.2

name	2510049I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385950 GeneID:67922 MGI:1915172
definition	codon_start : 1 product : hypothetical protein LOC67922 protein_id : NP_080731.1

name	Ap1m1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671557 CCDS:CCDS22411.1 GeneID:11767 MGI:102776
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 product : adaptor-related protein complex AP-1, mu subunit 1 protein_id : NP_031482.1

name	LOC100042405 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258915 GeneID:100042405
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478605.1

name	Klf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680580 CCDS:CCDS22412.1 GeneID:16598 MGI:1342772
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : transcription factor; zinc finger protein product : Kruppel-like factor 2 (lung) protein_id : NP_032478.1

name	Eps15l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679669 GeneID:13859 MGI:104582
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epidermal growth factor receptor pathway substrate 15, related sequence product : epidermal growth factor receptor pathway substrate 15, related protein_id : NP_031970.1

name	Calr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624619 CCDS:CCDS22413.1 GeneID:73316 MGI:1920566
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : calreticulin 3 isoform 1 protein_id : NP_082776.1

name	Calr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41462328 GeneID:73316 MGI:1920566
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : calreticulin 3 isoform 2 protein_id : NP_084058.2

name	LOC100042421 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258917 GeneID:100042421
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478654.1

name	1700030K09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930439 CCDS:CCDS22414.1 GeneID:72254 MGI:1919504
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72254 protein_id : NP_082446.1

name	Cherp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119672912 GeneID:27967 MGI:106417
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : SR-related CTD associated factor 6 protein_id : NP_613051.3

name	Slc35e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244270 CCDS:CCDS22415.1 GeneID:270066 MGI:2142403
definition	codon_start : 1 product : solute carrier family 35, member E1 protein_id : NP_808434.1

name	Crsp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28466971 CCDS:CCDS22416.1 GeneID:70625 MGI:1917875
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa product : transcriptional co-activator CRSP7 homolog protein_id : NP_081761.1

name	LOC100042439 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258919 GeneID:100042439
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478688.1

name	9130011J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369485 GeneID:66818 MGI:1914068
definition	codon_start : 1 product : hypothetical protein LOC66818 protein_id : NP_765984.1

name	Tmem38a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362331 CCDS:CCDS22417.1 GeneID:74166 MGI:1921416
definition	codon_start : 1 note : Mitsugumin33A product : transmembrane protein 38a protein_id : NP_653117.1

name	LOC100041583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041583
definition	number : 2 pseudo : _no_value

name	LOC100041583 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041583
definition	number : 1 pseudo : _no_value

name	EG621377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621377
definition	number : 1

name	EG621377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621377
definition	number : 2

name	EG621377 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621377
definition	number : 3

name	LOC665996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665996
definition	number : 1 pseudo : _no_value

name	LOC665996 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665996
definition	number : 2 pseudo : _no_value

name	LOC675190 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675190
definition	number : 1 pseudo : _no_value

name	LOC675190 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675190
definition	number : 2 pseudo : _no_value

name	Snora68 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604691 GeneID:104370 MGI:2148181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 68 transcript_id : NR_002901.1

name	LOC100042057 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258900 GeneID:100042057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042057 pseudo : _no_value transcript_id : XR_033490.1

name	LOC384645 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258887 GeneID:384645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : hypothetical LOC384645 pseudo : _no_value transcript_id : XR_032831.1

name	LOC665928 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258891 GeneID:665928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 37 ESTs, 37 Proteins product : similar to LOC298795 protein pseudo : _no_value transcript_id : XR_032903.1

name	LOC100042289 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258908 GeneID:100042289
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 226 ESTs, 21 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_033709.1

name	LOC670453 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258909 GeneID:670453
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 19 ESTs product : similar to cyclin B2 pseudo : _no_value transcript_id : XR_033725.1

name	LOC666033 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258910 GeneID:666033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 65 ESTs, 20 Proteins product : similar to H3 histone pseudo : _no_value transcript_id : XR_033728.1

name	LOC384840 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258913 GeneID:384840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 844 ESTs, 1 Protein product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_033743.1

clone name	MSMg01-350I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-074D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448M10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396I01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-388C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-530C13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-539G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-481G15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-504I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-459E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-130P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-502F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-379F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-113L14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-340G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-089D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-454J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535O22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199J12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-426E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N24
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-046O19.b	B6Ng01-046O19.g
ACC	DH871939	DH871940
length	541	816
definition	DH871939\|Mus musculus domesticus DNA, BAC clone: B6Ng01-046O19, 5' end.	DH871940\|Mus musculus domesticus DNA, BAC clone: B6Ng01-046O19, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	agaaatccgcctgcctctgcctctcgagtgctgtgattaaaggcgtgcgc caccactgcccagcactctcttaacttctaagccatctctccagcctata aaaataaatttaaaactaaaaggattcagacagtggtggcacacgtcttt aaccccagcactgggaggcagaggcagggggatttctgaattccaggcca acctggtctacagagtgaggtccaggagagccagggcaacacctgtctca aaaaacaaaacaaaaacaacaacaaaaaaaaacaaaaacaaaaaaaaaaa aaactaaaaatgaattaaaaaaaaaaaaaaagggggcaaagaagccagaa aagcattttagaagattgcctgaggcccaaggctggccctcctggtgcag tgcctaccacaaataatcctagagggaagggagactccagtgcctgggtg gcaggtctgccaggaaacctgctgccctcaaaaacagctgccccagggat tggaggattatcaaaggtatagatcggtcaagggctctgct	gaattcttgggcactgttgggttctgcagactttggatacctgggtttgc aaaactggttgcccccctccccaccgtatgtctgaccaaagaaagtggag aatttaaatgggcatctgaacatcagaaagcctttgaggatattaaggag gccctgttgactgcgccggccttggcactgccagatttaaccaggccctt caccctttacattaatgaaagggtgggagtggccagaggggttcttattc agactctagggccatggaagaggcctgtggcatatctaagaagctggacc cagtggccagcggatggcccacatgtctgaaggccactgcagtggtagcc ttgcttgttaaggatgtcggcaagttaagggactatcttagtcagagttt ctattcctgcacaaacatcatgaggcatgttggggaggaaagggtttatt caacttacacttctatactgctgttcatcaccaaggaagtcaggactgga actcaagcaggtcagaaagcaggagctgatgcagaagccatggagggatg ttcttttactggcttgcttcccctgtattgcgtcccactcgaccggcaag aaagacgcaacaaaccggaatcttccgtggcaaaagctttattgcttact tcctcaggaagaccctgaaccgggaaaatggcaccgcttttataacctag cagcatgacgtttcagcacttgatatggcgtgacagctcctgattcgttg ctcgcccatcaccccactattacatcccgagatgggagtgactaagagtg agtcactctgcactgc
quality values	Open. Hide. 17 13 32 24 20 38 50 39 36 43 50 55 61 50 50 55 61 55 61 61 12 14 17 14 11 9 8 8 8 9 19 27 43 43 59 59 59 59 59 59 59 59 61 59 59 61 61 61 61 61 61 59 61 61 59 59 59 61 61 61 59 59 23 19 13 21 26 23 28 18 23 18 24 43 41 52 59 59 61 59 61 59 59 59 52 59 59 59 55 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 59 59 59 52 61 61 59 61 61 61 59 59 59 59 59 59 61 59 59 61 59 59 52 59 49 43 35 59 59 59 59 59 52 52 52 52 52 59 44 39 52 52 49 59 59 49 44 59 38 52 33 38 24 59 27 59 52 49 52 61 59 61 61 59 61 59 61 59 59 61 61 59 59 14 13 14 10 11 18 13 24 23 23 36 39 41 44 33 37 59 59 59 59 27 32 41 45 23 35 25 12 12 18 13 32 23 23 23 24 22 11 12 12 12 8 12 14 30 18 33 27 38 12 18 25 8 21 12 13 13 37 37 45 43 39 41 45 39 39 36 52 44 37 19 13 22 23 18 18 33 33 49 39 29 35 22 31 35 35 24 27 32 36 39 30 21 35 28 35 32 36 41 36 36 36 59 49 59 49 52 52 49 43 44 37 38 39 39 39 36 52 45 45 52 49 39 39 32 24 31 43 52 49 45 28 33 27 13 26 23 36 29 26 19 52 44 59 59 49 45 52 36 29 44 36 27 36 41 30 27 52 52 35 29 18 28 34 43 39 52 52 45 28 49 36 12 52 43 39 39 39 41 49 44 44 24 31 19 27 21 21 18 20 43 26 36 49 45 45 52 38 37 39 43 39 43 31 19 27 23 15 8 15 37 38 38 35 39 41 43 34 43 23 23 21 17 32 32 23 34 34 36 24 18 44 36 52 45 59 59 27 44 37 27 19 39 19 10 27 23 6 7 10 39 28 36 30 20 29 23 27 31 36 9 12 12 37 10 10 11 19 14 11 12 12 13 28 19 15 13 19 25 36 18 30 27 19 30 26 12 13 18 10 19 19 18 11 32 28 20 23 20 16 27 24 13 11 15 28 28 9 23 10 27 27 36 28 45 49 15 11 24 24 10 10 14 13 22 24 9 15 11 19 18 31 14 12 10 15 11 11 12 10 24 28 24 12 9 21 15 18 23 13	Open. Hide. 49 61 43 47 50 50 15 13 12 10 8 8 10 7 12 18 18 26 52 52 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 49 43 39 23 23 23 23 21 31 37 59 43 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 59 61 59 61 59 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 55 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 59 61 59 61 61 59 61 61 61 59 61 61 55 61 61 61 61 61 61 61 61 55 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 52 52 55 61 55 61 61 61 61 55 52 55 52 52 55 55 61 55 61 61 61 61 61 61 61 61 61 61 55 61 47 61 61 55 61 61 61 55 61 61 61 50 47 61 61 42 61 61 61 61 55 61 55 61 61 61 61 61 55 50 55 61 61 61 53 61 61 53 61 61 43 61 37 43 50 47 36 50 35 61 61 61 50 53 50 47 32 61 53 50 50 50 50 53 53 53 61 50 39 35 42 42 27 23 47 38 43 61 16 61 61 61 45 53 45 42 53 53 31 47 52 47 61 39 53 53 43 14 47 28 20 27 32 38 45 53 53 42 30 57 57 37 31 52 53 16 47 45 53 53 20 40 50 45 57 47 45 43 42 53 37 23 20 41 53 53 53 52 53 23 52 52 50 52 50 45 47 47 47 32 28 38 53 45 33 50 38 47 45 52 35 33 37 45 52 41 41 47 43 33 14 32 24 24 38 32 40 30 28 26 27 27 38 24 50 52 52 30 33 30 26 28 43 53 32 25 53 57 23 32 21 17 46 41 31 53 39 53 31 42 43 33 34 37 31 30 52 53 32 14 4 11 34 38 27 33 10 39 40 38 44 31 33 37 33 29 26 39 41 53 53 53 30 31 29 24 30 31 30 8 15 28 24 57 40 37 37 20 29 9 24 6 21 19 15 53 17 31 20 20 32 33 37 21 32 45 27 31 25 15 32 25 40 34 31 30 33 36 32 34 27 38 28 32 29 38 36 30 32 22 33 34 31 23 17 27 25 39 16 14 8 19 30 28 25 30 29 12 8 18 30 20 29 20 22 22 30 28 29 28 28 28 18 28 14 9 13 9 5 18 18 37 24 38 18 36 20 27 30 24 20 16 23 11 14 16 17 21 9 22 22 9 8 24 31 14 26 12 11 11 29 23 25 7 7 12 27 12 29 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_74100112_74100659
seq2: B6Ng01-046O19.b_47_593 (reverse)

seq1  AGCAGAACCCTTGTGCCGATCTTTACCTTTGATAATCCTCCAAACCCTGG  50
      |||||| ||||||  ||||||| |||||||||||||||||||| ||||||
seq2  AGCAGAGCCCTTG-ACCGATCTATACCTTTGATAATCCTCCAATCCCTGG  49

seq1  GGCAGCTGTTTTTGAGGGCAGCAGGTTTCCTGGCTGACCTGCCACCCAGG  100
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  GGCAGCTGTTTTTGAGGGCAGCAGGTTTCCTGGCAGACCTGCCACCCAGG  99

seq1  CACTGGAGTCTCCCTTCCCTCTAGGATTATTTGTGGTAGGCACTGCACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTGGAGTCTCCCTTCCCTCTAGGATTATTTGTGGTAGGCACTGCACCA  149

seq1  GGAGGGCCAGCCTTGGGCCTCAGGCAATCTTCTAAAATGCTTTTCTGGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGCCAGCCTTGGGCCTCAGGCAATCTTCTAAAATGCTTTTCTGGCT  199

seq1  TCTTTGCCCCCTTTTTTTTTTTTTTTAATTCATTTTTAGTTTTTTTTTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTGCCCCCTTTTTTTTTTTTTTTAATTCATTTTTAGTTTTTTTTTTT  249

seq1  TTTGTTTTTGTTTTTTTTTGTTGTTGTTTTTGTTTTGTTTTTTGAGACAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTTTGTTTTTTTTTGTTGTTGTTTTTGTTTTGTTTTTTGAGACAG  299

seq1  GTGTTGCCCTGGCTGTCCTGGAACTCACTCTGTAGACCAGGTTGGCCTGG  350
      |||||||||||||| ||||||| |||||||||||||||||||||||||||
seq2  GTGTTGCCCTGGCTCTCCTGGACCTCACTCTGTAGACCAGGTTGGCCTGG  349

seq1  AATTCAGAAATCCCCCTGCCTCTGCCTCCCAGTGCTGGGGTTAAAGACGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCAGAAATCCCCCTGCCTCTGCCTCCCAGTGCTGGGGTTAAAGACGT  399

seq1  GTGCCACCACTGTCTGAATCCTTTTAGTTTTAAATTTATTTTTATAGGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCCACCACTGTCTGAATCCTTTTAGTTTTAAATTTATTTTTATAGGCT  449

seq1  GGAGAGATGGCTTAGAAGTTAAGAGAGTGCTGGGCAGTGGTGGCGCACGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAGATGGCTTAGAAGTTAAGAGAGTGCTGGGCAGTGGTGGCGCACGC  499

seq1  CTTTAATCACAGCACTCGAGAGGCAGAGGCAGGCGGATTTCTGAATTC  548
      ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAATCACAGCACTCGAGAGGCAGAGGCAGGCGGATTTCTGAATTC  547

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information