MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-178M12
Chromosome	8 (Build37)
Map Location	112,934,519 - 113,106,100
singlet/doublet	doublet
Overlap gene	Hydin, LOC672398
Upstream gene	LOC100042829, Pmfbp1, Dhx38, Txnl4b, Hp, Dhodh, Pkd1l3, 2400003C14Rik, 4930566A11Rik, D8Ertd587e, LOC668089, LOC672735, Ap1g1, Phlppl, Marveld3, LOC100041884, Tat, Chst4, Zfp612, Gm1467, Calb2, BC025546
Downstream gene	Vac14, BC060632, 2010004A03Rik, Sf3b3, Cog4, Fuk, St3gal2, Ddx19a, Ddx19b, Aars, Exosc6, Mrcl, 4930402E16Rik, 9430091E24Rik, Glg1, Rfwd3, LOC547023, Mlkl, Fa2h, Wdr59, Znrf1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042829 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042829
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Pmfbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56523 MGI:1930136
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhx38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64340 MGI:1927617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Txnl4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234723 MGI:2443724
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15439 MGI:96211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dhodh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56749 MGI:1928378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkd1l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244646 MGI:2664670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2400003C14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71955 MGI:1919205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930566A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75871 MGI:1923121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D8Ertd587e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52335 MGI:1261787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668089 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC672735 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ap1g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11765 MGI:101919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phlppl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244650 MGI:2444928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	Marveld3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73608 MGI:1920858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041884 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041884
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Tat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234724 MGI:98487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chst4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26887 MGI:1349479
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp612 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234725 MGI:2443465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384866 MGI:2686313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Calb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12308 MGI:101914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025546 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234728 MGI:2384580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hydin (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244653 MGI:2389007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC672398 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:672398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins pseudo : _no_value

name	Vac14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234729 MGI:2157980
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC060632 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244654 MGI:3039591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010004A03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76527 MGI:1923777
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sf3b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101943 MGI:1289341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cog4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102339 MGI:2142808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fuk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234730 MGI:1916071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	St3gal2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20444 MGI:99427
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ddx19a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13680 MGI:99526
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx19b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234733 MGI:2148251
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aars (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234734 MGI:2384560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exosc6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72544 MGI:1919794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrcl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353287 MGI:2672935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930402E16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319518 MGI:2442188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430091E24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434350 MGI:1924618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Glg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20340 MGI:104967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rfwd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234736 MGI:2384584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC547023 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 485 ESTs, 6 Proteins pseudo : _no_value

name	Mlkl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74568 MGI:1921818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fa2h (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:338521 MGI:2443327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr59 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319481 MGI:2442115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Znrf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170737 MGI:2177308
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042829 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259091 GeneID:100042829
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042829 transcript_id : XM_001479588.1

name	Pmfbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802903 GeneID:56523 MGI:1930136
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyamine modulated factor 1 binding protein 1 transcript_id : NM_019938.2

name	Dhx38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30410009 GeneID:64340 MGI:1927617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 38 transcript_id : NM_178380.1

name	Txnl4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342268 GeneID:234723 MGI:2443724
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thioredoxin-like 4B transcript_id : NM_175646.2

name	Hp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850218 GeneID:15439 MGI:96211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : haptoglobin transcript_id : NM_017370.1

name	Dhodh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85677502 GeneID:56749 MGI:1928378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydroorotate dehydrogenase transcript_id : NM_020046.3

name	Pkd1l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115583680 GeneID:244646 MGI:2664670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 1 like 3 transcript_id : NM_001039700.2

name	Pkd1l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115583671 GeneID:244646 MGI:2664670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polycystic kidney disease 1 like 3 transcript_id : NM_181544.2

name	2400003C14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312625 GeneID:71955 MGI:1919205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2400003C14 gene transcript_id : NM_028018.1

name	4930566A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74315962 GeneID:75871 MGI:1923121
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930566A11 gene transcript_id : NM_029468.1

name	D8Ertd587e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286822 GeneID:52335 MGI:1261787
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 8, ERATO Doi 587, expressed transcript_id : NM_001080930.1

name	LOC672735 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259032 GeneID:672735
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC672735 transcript_id : XM_001477128.1

name	Ap1g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56744241 GeneID:11765 MGI:101919
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor protein complex AP-1, gamma 1 subunit transcript_id : NM_009677.3

name	Phlppl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259036 GeneID:244650 MGI:2444928
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : PH domain and leucine rich repeat protein phosphatase-like, transcript variant 1 transcript_id : XM_146511.7

name	Marveld3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059064 GeneID:73608 MGI:1920858
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MARVEL (membrane-associating) domain containing 3 transcript_id : NM_212447.1

name	Marveld3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059473 GeneID:73608 MGI:1920858
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MARVEL (membrane-associating) domain containing 3 transcript_id : NM_028584.2

name	Tat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130213 GeneID:234724 MGI:98487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tyrosine aminotransferase transcript_id : NM_146214.2

name	Chst4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982527 GeneID:26887 MGI:1349479
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbohydrate (chondroitin 6/keratan) sulfotransferase 4 transcript_id : NM_011998.3

name	Zfp612 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31559870 GeneID:234725 MGI:2443465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 612 transcript_id : NM_175480.3

name	Gm1467 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383818 GeneID:384866 MGI:2686313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : gene model 1467, (NCBI) transcript_id : XM_357906.4

name	Calb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34098930 GeneID:12308 MGI:101914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calbindin 2 transcript_id : NM_007586.1

name	BC025546 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364202 GeneID:234728 MGI:2384580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025546 transcript_id : NM_146215.3

name	Hydin (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31541985 GeneID:244653 MGI:2389007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydrocephalus inducing transcript_id : NM_172916.2

name	Vac14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542487 GeneID:234729 MGI:2157980
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vac14 homolog (S. cerevisiae) transcript_id : NM_146216.2

name	BC060632 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38348491 GeneID:244654 MGI:3039591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC060632 transcript_id : NM_198625.1

name	2010004A03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239432 GeneID:76527 MGI:1923777
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010004A03 gene transcript_id : NM_029646.1

name	Sf3b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118498348 GeneID:101943 MGI:1289341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : splicing factor 3b, subunit 3 transcript_id : NM_133953.2

name	Cog4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118498357 GeneID:102339 MGI:2142808
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : component of oligomeric golgi complex 4 transcript_id : NM_133973.2

name	Fuk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281970 GeneID:234730 MGI:1916071
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucokinase transcript_id : NM_181666.1

name	Fuk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981685 GeneID:234730 MGI:1916071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fucokinase transcript_id : NM_172283.2

name	St3gal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348044 GeneID:20444 MGI:99427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 2 transcript_id : NM_178048.3

name	St3gal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366416 GeneID:20444 MGI:99427
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ST3 beta-galactoside alpha-2,3-sialyltransferase 2 transcript_id : NM_009179.2

name	Ddx19a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681290 GeneID:13680 MGI:99526
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a transcript_id : NM_007916.1

name	Ddx19b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801929 GeneID:234733 MGI:2148251
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 19b transcript_id : NM_172284.3

name	Aars (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254406 GeneID:234734 MGI:2384560
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alanyl-tRNA synthetase transcript_id : NM_146217.3

name	Exosc6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383043 GeneID:72544 MGI:1919794
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exosome component 6 transcript_id : NM_028274.2

name	Mrcl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581539 GeneID:353287 MGI:2672935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannose receptor-like precursor transcript_id : NM_181549.2

name	4930402E16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38142487 GeneID:319518 MGI:2442188
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930402E16 gene transcript_id : NM_198308.1

name	9430091E24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383826 GeneID:434350 MGI:1924618
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 9430091E24 gene transcript_id : XM_489247.4

name	Glg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130514 GeneID:20340 MGI:104967
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : golgi apparatus protein 1 transcript_id : NM_009149.2

name	Rfwd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383539 GeneID:234736 MGI:2384584
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger and WD repeat domain 3 transcript_id : NM_146218.3

name	Mlkl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802525 GeneID:74568 MGI:1921818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mixed lineage kinase domain-like transcript_id : NM_029005.2

name	Fa2h (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342560 GeneID:338521 MGI:2443327
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fatty acid 2-hydroxylase transcript_id : NM_178086.2

name	Wdr59 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372339 GeneID:319481 MGI:2442115
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 59 transcript_id : NM_176923.3

name	Znrf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56711336 GeneID:170737 MGI:2177308
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc and ring finger 1 transcript_id : NM_133206.2

name	LOC100042829 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259092 GeneID:100042829
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479638.1

name	Pmfbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910570 GeneID:56523 MGI:1930136
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] codon_start : 1 note : sperm tail associated protein product : polyamine modulated factor 1 binding protein 1 protein_id : NP_064322.1

name	Dhx38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410010 CCDS:CCDS22652.1 GeneID:64340 MGI:1927617
definition	codon_start : 1 note : pre-mRNA splicing factor 16; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38 product : DEAH (Asp-Glu-Ala-His) box polypeptide 38 protein_id : NP_848467.1

name	Txnl4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316734 GeneID:234723 MGI:2443724
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : Dim1-like protein protein_id : NP_783577.1

name	Hp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850219 GeneID:15439 MGI:96211
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 product : haptoglobin protein_id : NP_059066.1

name	Dhodh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910194 GeneID:56749 MGI:1928378
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0004152 - dihydroorotate dehydrogenase activity [Evidence IEA]; GO:0004158 - dihydroorotate oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006207 - 'de novo' pyrimidine base biosynthesis [Evidence IEA]; GO:0006221 - pyrimidine nucleotide biosynthesis [Evidence IEA]; GO:0006222 - UMP biosynthesis [Evidence IEA] codon_start : 1 product : dihydroorotate dehydrogenase protein_id : NP_064430.1

name	Pkd1l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115583681 GeneID:244646 MGI:2664670
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : polycystic kidney disease 1 like 3 isoform a protein_id : NP_001034789.2

name	Pkd1l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115583672 CCDS:CCDS22654.1 GeneID:244646 MGI:2664670
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : polycystic kidney disease 1 like 3 isoform b protein_id : NP_853522.2

name	2400003C14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312626 CCDS:CCDS22655.1 GeneID:71955 MGI:1919205
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC71955 protein_id : NP_082294.1

name	4930566A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315963 GeneID:75871 MGI:1923121
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC75871 protein_id : NP_083744.1

name	D8Ertd587e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286823 GeneID:52335 MGI:1261787
definition	codon_start : 1 product : hypothetical protein LOC52335 protein_id : NP_001074399.1

name	LOC672735 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259033 GeneID:672735
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477178.1

name	Ap1g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56744242 GeneID:11765 MGI:101919
definition	GO_component : GO:0030130 - clathrin coat of trans-Golgi network vesicle [Evidence IEA]; GO:0030136 - clathrin-coated vesicle [Evidence ISS]; GO:0005905 - coated pit [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA] [Evidence TAS]; GO:0006461 - protein complex assembly [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : gamma-adaptin product : adaptor protein complex AP-1, gamma 1 subunit protein_id : NP_033807.2

name	Phlppl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259037 GeneID:244650 MGI:2444928
definition	codon_start : 1 product : PH domain and leucine rich repeat protein phosphatase-like isoform 1 protein_id : XP_146511.4

name	Marveld3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059065 CCDS:CCDS22656.1 GeneID:73608 MGI:1920858
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant 2 product : MARVEL (membrane-associating) domain containing 3 isoform b protein_id : NP_997612.1

name	Marveld3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059474 CCDS:CCDS22657.1 GeneID:73608 MGI:1920858
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : MARVEL (membrane-associating) domain containing 3 isoform a protein_id : NP_082860.2

name	Tat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122769 CCDS:CCDS22658.1 GeneID:234724 MGI:98487
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016847 - 1-aminocyclopropane-1-carboxylate synthase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0030170 - pyridoxal phosphate binding [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0006519 - amino acid and derivative metabolism [Evidence IEA]; GO:0009074 - aromatic amino acid family catabolism [Evidence IEA]; GO:0009072 - aromatic amino acid family metabolism [Evidence IEA] codon_start : 1 product : tyrosine aminotransferase protein_id : NP_666326.1

name	Chst4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982528 CCDS:CCDS22659.1 GeneID:26887 MGI:1349479
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008146 - sulfotransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA] codon_start : 1 exception : mismatches in translation function : directs expression of 6-sulfo sialyl Lewis X, an L-selectin ligand displayed by CD34 note : HEC-GlcNAc6ST; high endothelial cell GlcNAC-6-sulphotransferase product : carbohydrate (chondroitin 6/keratan) sulfotransferase 4 protein_id : NP_036128.2

name	Zfp612 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559871 CCDS:CCDS22660.1 GeneID:234725 MGI:2443465
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 612 protein_id : NP_780689.2

name	Gm1467 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383819 GeneID:384866 MGI:2686313
definition	codon_start : 1 product : similar to Transducin-like enhancer of split 2, homolog of Drosophila E(spl) protein_id : XP_357906.4

name	Calb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34098931 CCDS:CCDS22661.1 GeneID:12308 MGI:101914
definition	GO_component : GO:0005921 - gap junction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 note : calretinin product : calbindin 2 protein_id : NP_031612.1

name	BC025546 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981920 CCDS:CCDS22662.1 GeneID:234728 MGI:2384580
definition	codon_start : 1 product : hypothetical protein LOC234728 protein_id : NP_666327.2

name	Hydin (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46361984 GeneID:244653 MGI:2389007
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : hydrocephalus 3 product : hydrocephalus inducing protein_id : NP_766504.3

name	Vac14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542488 CCDS:CCDS22663.1 GeneID:234729 MGI:2157980
definition	GO_component : GO:0005774 - vacuolar membrane [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0019209 - kinase activator activity [Evidence ISS] GO_process : GO:0006970 - response to osmotic stress [Evidence ISS] codon_start : 1 note : Tax1 (human T-cell leukemia virus type I) binding protein 1; Tax1 (human T-cell leukemia virus type I) binding protein 2; vacuole morphology 14 product : Vac14 homolog protein_id : NP_666328.2

name	BC060632 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348492 CCDS:CCDS22664.1 GeneID:244654 MGI:3039591
definition	codon_start : 1 product : hypothetical protein LOC244654 protein_id : NP_941027.1

name	2010004A03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239433 GeneID:76527 MGI:1923777
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC76527 protein_id : NP_083922.1

name	Sf3b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527174 CCDS:CCDS22665.1 GeneID:101943 MGI:1289341
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 product : splicing factor 3b, subunit 3 protein_id : NP_598714.1

name	Cog4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527194 GeneID:102339 MGI:2142808
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : component of oligomeric golgi complex 4 protein_id : NP_598734.1

name	Fuk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981686 CCDS:CCDS22666.1 GeneID:234730 MGI:1916071
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0050201 - fucokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; L-fucose kinase; mFLJ00241 protein product : fucokinase isoform 1 protein_id : NP_758487.2

name	Fuk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281971 CCDS:CCDS22666.1 GeneID:234730 MGI:1916071
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0050201 - fucokinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0016310 - phosphorylation [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; L-fucose kinase; mFLJ00241 protein product : fucokinase isoform 2 protein_id : NP_858052.1

name	St3gal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677961 CCDS:CCDS22667.1 GeneID:20444 MGI:99427
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; sialyltransferase 5 product : ST3 beta-galactoside alpha-2,3-sialyltransferase 2 isoform 1 protein_id : NP_033205.1

name	St3gal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017335 GeneID:20444 MGI:99427
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008373 - sialyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform 2 is encoded by transcript variant 2; sialyltransferase 5 product : ST3 beta-galactoside alpha-2,3-sialyltransferase 2 isoform 2 protein_id : NP_835149.1

name	Ddx19a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681291 CCDS:CCDS22668.1 GeneID:13680 MGI:99526
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : eukaryotic translation initiation factor 4A related sequence 1; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 19 product : Ddx19-like protein protein_id : NP_031942.1

name	Ddx19b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986593 CCDS:CCDS22669.1 GeneID:234733 MGI:2148251
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : DDX19 homolog protein_id : NP_758488.1

name	Aars (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34610207 GeneID:234734 MGI:2384560
definition	GO_function : GO:0004813 - alanine-tRNA ligase activity [Evidence IEA]; GO:0004812 - aminoacyl-tRNA ligase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006419 - alanyl-tRNA aminoacylation [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : alanyl-tRNA synthetase protein_id : NP_666329.2

name	Exosc6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794378 GeneID:72544 MGI:1919794
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0000175 - 3'-5'-exoribonuclease activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : Mtr3 (mRNA transport regulator 3)-homolog protein_id : NP_082550.1

name	Mrcl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559797 GeneID:353287 MGI:2672935
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 product : mannose receptor-like protein_id : NP_853527.1

name	4930402E16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38142488 CCDS:CCDS22670.1 GeneID:319518 MGI:2442188
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004047 - aminomethyltransferase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006546 - glycine catabolism [Evidence IEA] codon_start : 1 product : pyruvate dehydrogenase phosphatase regulatory subunit protein_id : NP_938050.1

name	9430091E24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82918549 GeneID:434350 MGI:1924618
definition	codon_start : 1 product : hypothetical protein protein_id : XP_489247.3

name	Glg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677905 CCDS:CCDS22671.1 GeneID:20340 MGI:104967
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017134 - fibroblast growth factor binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] codon_start : 1 note : selectin, endothelial cell, ligand product : golgi apparatus protein 1 protein_id : NP_033175.1

name	Rfwd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542200 CCDS:CCDS22672.1 GeneID:234736 MGI:2384584
definition	GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger and WD repeat domain 3 protein_id : NP_666330.2

name	Mlkl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626037 GeneID:74568 MGI:1921818
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : mixed lineage kinase domain-like protein_id : NP_083281.1

name	Fa2h (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30017399 CCDS:CCDS22674.1 GeneID:338521 MGI:2443327
definition	codon_start : 1 exception : mismatches in translation note : fatty acid hydroxylase domain containing 1 product : fatty acid 2-hydroxylase protein_id : NP_835187.1

name	Wdr59 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892721 CCDS:CCDS22675.1 GeneID:319481 MGI:2442115
definition	codon_start : 1 exception : mismatches in translation product : WD repeat domain 59 protein_id : NP_795897.1

name	Znrf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875354 CCDS:CCDS22676.1 GeneID:170737 MGI:2177308
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : peripheral nerve injury protein nin283; ring finger protein 42 product : zinc ring finger protein 1 protein_id : NP_573469.1

name	LOC100041884 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041884
definition	number : 2 pseudo : _no_value

name	LOC100041884 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041884
definition	number : 1 pseudo : _no_value

name	LOC668089 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259031 GeneID:668089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Larp2 protein pseudo : _no_value transcript_id : XR_033068.1

name	LOC672398 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259093 GeneID:672398
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 4 Proteins product : similar to ribosomal protein L31 pseudo : _no_value transcript_id : XR_034375.1

name	LOC547023 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259094 GeneID:547023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 485 ESTs, 6 Proteins product : similar to ribosomal protein S27a pseudo : _no_value transcript_id : XR_034429.1

clone name	MSMg01-485L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-537G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-400J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235L17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510H01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-185A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-083A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498C07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-093F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342B08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-165F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066O21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526P05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-365I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-408E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277A10
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-178M12.b	B6Ng01-178M12.g
ACC	GA005672	GA005673
length	1,124	975
definition	B6Ng01-178M12.b	B6Ng01-178M12.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(112,934,519 - 112,935,642)	(113,105,131 - 113,106,100)
sequence	gaattcaccatctctcccaacagtggcaccatccgtgcccagggctttac tgccatcaaggtaaagtgtgcagctgtcagcacacacagccaaacaccca ccacctttcagatagccactgatatgtcacctaggggtttctgtccaagg acagtgatagggaatgccgtggggaaaccacacgcaaagctgggccatgt agggactaagcctctgagatcacagaaccagatgcaaataggttgggcaa agaaattcacactgctcaggttaccggagtcgctaaggttggagacagtg ttcagccaattctagcaagacagtcctcaattagctgagtagagagacaa atttccatggaaagaggaacaaagctatccagtggctcccactccccagt cctcttggggtcctgacatgagacttgcttctggcctggatatggcccca ctcatcatcacgatctcagccctagcctctcctcagaggtagtctgacca attgttggaaccagataagatctctttccaggcaaaaagagccttctctt tctccagcttgagattccaggagctgatggggagagggactccagtatct tggggactattgtttcaataatctaatggccaaaaggagatcccaagtgt ctttagaataaccttgttctcaccagaccagacaaaccccagttaaatgg atatccactgagtctaacatgaatgcagaaccagtatcttcataggagcc gtggcttctagttatttctagtacaatccctgttccatacagacaacaca cccactgactctaatagaggagtggaagaacccggagtctggctttcaga ttcaggtcctccacagccatacacatccggccttatgccaagctgacagc taggccaatcagttcgcagtataaatctggatcctggcaaatgtgggtgc catgtgcctttccactagagctttggatttaagttccacgggaagaagag atacgaaggttgcccagcaccctactttggtctgaaatcagaccagtgag gtggccattagtggtgcctcatgtgccccagcaggcttactttcatagta acaagaaagcttcagtcttctctc	gaattcaaacgatacaactcagactcactggacattcttcccaccgatgc ccacactggtgaactcaatcacacgggtattaggttcgagaggcccagcg cctggtcctcggagctctgggttgcgccgatgaccactgatgtagtccga ctccttcaggtcaaagtggcagaacggcaggacgcttcgcccttttgtta tcaaaataggaccttgttctccaagtgggaggttgggaattctgaaatga gagggttatttttaattttgatttttctatcccgttgtccctttcttagc tggttggaaataaatattctgtttaccagaatgtgagttccatgtgagca gagggtgggtttgtcttggtcagtcacaccatattttgccttgactggca cattctatatagtagcataataggcactaatgaatttactgttaaatgga caagtgggctgactctgaggaacctagatgtaagtaccctctgtgtatgt ggctctaagtttttccctcctatcagtggttatgtaaacaacgtgcttgc cctttgggttcactcctaggcatccaatagattatagagaaggacctgga aaccctaaccaagttattctaagacccttggagaaggtgatgcatatgaa cagactcagccttggggctgagctgaggtggctctagtgtggcagaggtc tctctggtataagatcaggggttcaggggaactctggcacttcaggtagg cctctgccatcctagggcaagacttagagaagcttctacaaggcaggtgt tctttctggaaaatttccttggaagaaggtgccatatctgggacgctctc tgatacatgttatttgtttaccttttttttctctctctctcactggacac cagaccagacggggtctgccaacccaatatttccttcccgtctttgttta ttggaggttattgtgggccaggcat
quality values	Open. Hide. 52 31 25 31 62 31 25 62 39 27 62 62 62 62 62 62 62 39 21 54 39 44 62 62 62 49 62 62 59 59 59 62 59 59 56 38 38 43 62 59 49 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 59 62 62 54 62 62 62 54 62 62 59 59 62 62 62 62 62 62 59 62 59 59 59 54 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 41 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 47 58 58 54 58 58 58 58 58 52 58 54 58 58 58 58 58 58 58 58 58 58 51 58 54 58 54 58 58 58 58 58 58 58 54 45 58 49 54 38 54 58 58 54 58 58 58 58 50 58 58 49 58 54 54 58 41 58 58 54 37 58 58 45 48 54 58 54 58 54 58 58 58 58 58 58 45 28 51 58 51 51 58 46 58 49 52 47 42 51 53 58 58 58 53 49 54 54 58 45 38 46 46 58 58 58 40 58 58 47 37 40 50 58 48 49 58 54 53 58 53 58 58 58 47 41 41 58 51 50 49 49 49 58 49 58 58 58 54 52 53 53 40 51 49 46 47 46 22 31 28 41 58 39 32 51 49 40 43 41 44 50 52 58 53 39 58 49 50 54 49 52 52 50 50 50 40 35 51 53 51 51 40 49 41 21 12 54 40 29 53 49 49 47 40 51 32 39 32 54 47 27 40 40 53 53 52 44 50 51 41 37 26 38 32 30 54 54 30 44 44 50 52 51 44 45 53 32 37 33 52 29 52 35 40 31 54 39 45 37 40 47 32 38 38 35 36 34 28 54 51 25 52 26 34 37 52 32 52 37 45 33 53 46 39 34 45 31 35 34 40 27 40 40 32 32 29 31 31 23 45 40 30 28 31 31 52 31 39 8 35 41 25 35 52 29 53 35 39 46 10 11 46 51 26 51 38 35 31 31 32 51 45 23 23 51 22 31 26 19 45 20 33 28 27 20 34 28 31 35 31 29 31 27 29 31 23 29 32 19 30 29 31 26 31 27 35 31 33 16 31 9 27 13 34 21 26 30 22 25 19 33 31 31 31 32 37 14 21 30 32 33 21 34 38 22 24 24 27 32 30 7 8 13 10 15 26 32 37 17 31 31 16 33 46 20 31 36 37 27 19 10 15 16 31 20 27 27 31 27 44 21 16 22 19 25 44 29 14 17 12 29 13 13 27 25 29 21 30 26 48 37 28 21 16 31 19 31 13 32 22 21 19 48 34 21 13 25 25 44 30 22 22 14 17 6 7 30 22 34 16 31 15 7 10 6 19 7 5 18 14 15 14 7 10 9 25 7 4 10 7 8 19 20 21 16 20 28 31 20 22 37 29 32 27 27 14 37 15 22 13 4 6 26 24 27 47 21 24 24 20 8 31 5 8 13 9 6 6 14 21 16 6 5 19 6 25 12 18 5 5 14 11 23 19 7 6 3 6 14 18 24 20 14 4 7 9 3 30 21 12 24 28 9 22 16 5 9 26 13 19 16 29 20 16 16 16 15 8 15 4 6 18 16 8 5 16 28 11 18 8 17 15 9 19 5 11 17 17 14 11 4 4 4 4	Open. Hide. 62 49 51 47 62 47 43 62 62 62 62 62 62 59 62 43 56 62 62 59 59 50 59 62 62 59 49 62 62 59 62 59 62 62 62 54 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 54 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 53 62 62 62 54 62 54 52 62 62 62 62 62 58 58 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 42 45 58 54 58 58 54 54 58 46 54 58 54 42 42 58 51 58 52 54 54 54 54 54 54 54 58 54 58 54 41 58 54 33 52 58 58 49 58 58 52 41 58 58 54 54 54 46 44 52 58 52 54 51 53 41 58 58 53 51 58 48 58 33 58 58 58 47 51 51 51 40 58 47 19 46 32 58 51 32 51 50 42 49 50 41 49 49 58 47 52 51 38 40 58 51 39 46 51 51 53 39 44 49 58 49 46 53 53 51 21 47 49 53 44 7 54 46 46 37 22 39 42 51 37 50 32 51 39 46 49 35 42 26 58 9 44 39 53 51 50 58 51 40 53 58 33 34 30 39 46 33 43 32 28 35 21 58 58 54 30 33 41 31 47 54 26 20 54 31 35 54 37 40 50 49 30 37 42 24 32 37 37 13 54 33 42 20 40 32 27 40 37 26 27 27 39 28 42 26 53 33 51 37 54 53 29 28 30 33 31 15 45 39 37 23 54 29 25 39 26 33 30 32 37 26 33 31 7 54 19 52 22 34 6 40 29 31 33 33 36 33 52 47 31 31 34 14 29 53 53 41 41 53 41 41 12 6 10 31 33 31 39 21 36 18 33 29 18 33 18 26 21 33 31 33 31 32 31 46 10 9 7 25 31 38 33 34 34 31 30 43 28 20 21 29 31 35 8 8 25 28 51 32 33 24 40 7 25 7 21 31 37 36 36 40 46 42 42 33 23 37 25 31 30 34 25 34 24 20 27 35 30 32 11 22 7 19 13 11 9 6 31 16 30 18 11 30 22 7 31 32 18 24 16 7 8 25 32 26 29 32 46 22 9 44 14 15 8 31 22 30 14 13 41 23 31 31 16 18 16 7 37 24 13 7 32 17 7 9 24 11 6 21 6 7 21 18 29 17 10 24 9 31 31 24 5 11 38 21 14 7 6 25

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_112934519_112935642
seq2: B6Ng01-178M12.b_46_1169

seq1  GAATTCACCATCTCTCCCAACAGTGGCACCATCCGTGCCCAGGGCTTTAC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACCATCTCTCCCAACAGTGGCACCATCCGTGCCCAGGGCTTTAC  50

seq1  TGCCATCAAGGTAAAGTGTGCAGCTGTCAGCACACACAGCCAAACACCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCATCAAGGTAAAGTGTGCAGCTGTCAGCACACACAGCCAAACACCCA  100

seq1  CCACCTTTCAGATAGCCACTGATATGTCACCTAGGGGTTTCTGTCCAAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCTTTCAGATAGCCACTGATATGTCACCTAGGGGTTTCTGTCCAAGG  150

seq1  ACAGTGATAGGGAATGCCGTGGGGAAACCACACGCAAAGCTGGGCCATGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGATAGGGAATGCCGTGGGGAAACCACACGCAAAGCTGGGCCATGT  200

seq1  AGGGACTAAGCCTCTGAGATCACAGAACCAGATGCAAATAGGTTGGGCAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGACTAAGCCTCTGAGATCACAGAACCAGATGCAAATAGGTTGGGCAA  250

seq1  AGAAATTCACACTGCTCAGGTTACCGGAGTCGCTAAGGTTGGAGACAGTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATTCACACTGCTCAGGTTACCGGAGTCGCTAAGGTTGGAGACAGTG  300

seq1  TTCAGCCAATTCTAGCAAGACAGTCCTCAATTAGCTGAGTAGAGAGACAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGCCAATTCTAGCAAGACAGTCCTCAATTAGCTGAGTAGAGAGACAA  350

seq1  ATTTCCATGGAAAGAGGAACAAAGCTATCCAGTGGCTCCCACTCCCCAGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCCATGGAAAGAGGAACAAAGCTATCCAGTGGCTCCCACTCCCCAGT  400

seq1  CCTCTTGGGGTCCTGACATGAGACTTGCTTCTGGCCTGGATATGGCCCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTGGGGTCCTGACATGAGACTTGCTTCTGGCCTGGATATGGCCCCA  450

seq1  CTCATCATCACGATCTCAGCCCTAGCCTCTCCTCAGAGGTAGTCTGACCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATCATCACGATCTCAGCCCTAGCCTCTCCTCAGAGGTAGTCTGACCA  500

seq1  ATTGTTGGAACCAGATAAGATCTCTTTCCAGGCAAAAAGAGCCTTCTCTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTGGAACCAGATAAGATCTCTTTCCAGGCAAAAAGAGCCTTCTCTT  550

seq1  TCTCCAGCTTGAGATTCCAGGAGCTGATGGGGAGAGGGACTCCAGTATCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCAGCTTGAGATTCCAGGAGCTGATGGGGAGAGGGACTCCAGTATCT  600

seq1  TGGGGACTATTGTTTCAATAATCTAATGGCCAAAAGGAGATCCCAAGTGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGACTATTGTTTCAATAATCTAATGGCCAAAAGGAGATCCCAAGTGT  650

seq1  CTTTAGAATAACCTTGTTCTCACCAGACCAGACAAACCCCAGTTAAATGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTAGAATAACCTTGTTCTCACCAGACCAGACAAACCCCAGTTAAATGG  700

seq1  ATATCCACTGAGTCTAACATGAATGCAGAACCAGTATCTTCATAGGAGCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCCACTGAGTCTAACATGAATGCAGAACCAGTATCTTCATAGGAGCC  750

seq1  GTGGCTTCTAGTTATTTCTAGTACAATCCCTGTTCCATACAGACAACACA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCTTCTAGTTATTTCTAGTACAATCCCTGTTCCATACAGACAACACA  800

seq1  CCCACTGACTCTAATAGAGGAGTGGAAGAACCCGGAGTCTGGC-TTCAGA  849
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  CCCACTGACTCTAATAGAGGAGTGGAAGAACCCGGAGTCTGGCTTTCAGA  850

seq1  TTCAGGTCCTCCACAGCCATACACATCCGGCCTTATGCCAAGCTGACAGC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAGGTCCTCCACAGCCATACACATCCGGCCTTATGCCAAGCTGACAGC  900

seq1  TAGGCCAATCAGGTTCGCAGTATAAATCTGGATCCTGGCAAATGTGGGTG  949
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  TAGGCCAATCA-GTTCGCAGTATAAATCTGGATCCTGGCAAATGTGGGTG  949

seq1  CCATGTGCCTTTCCACTAGAGCTTTGGATTTAAG-TCCACGGGAAG-AGA  997
      |||||||||||||||||||||||||||||||||| ||||||||||| |||
seq2  CCATGTGCCTTTCCACTAGAGCTTTGGATTTAAGTTCCACGGGAAGAAGA  999

seq1  GATACGAAGGGTGCCCAGCACCCTAC-TTGGTCTGAAATCAGAACAGTGA  1046
      |||||||||| ||||||||||||||| |||||||||||||||| ||||||
seq2  GATACGAAGGTTGCCCAGCACCCTACTTTGGTCTGAAATCAGACCAGTGA  1049

seq1  GGTGGCCA-TAGTGGTGCCTCATGGTGCCCCCAGCAGGGTTAC-TTCATA  1094
      |||||||| |||||||||||||| ||| |||||||||| |||| ||||||
seq2  GGTGGCCATTAGTGGTGCCTCAT-GTG-CCCCAGCAGGCTTACTTTCATA  1097

seq1  GTTAACCAAGAAAGGCTTCAGTCTTCTCTC  1124
      ||  | ||||||| ||||||||||||||||
seq2  GT--AACAAGAAA-GCTTCAGTCTTCTCTC  1124

seq1: chr8_113105131_113106100
seq2: B6Ng01-178M12.g_65_1039 (reverse)

seq1  ATGCCTGGCCCACAATAAACT-CAATAAACAAAGACGGGAAGG-AATATT  48
      |||||||||||||||||| || ||||||||||||||||||||| ||||||
seq2  ATGCCTGGCCCACAATAACCTCCAATAAACAAAGACGGGAAGGAAATATT  50

seq1  GGGTTGGCAGACCCGGTCTGGTCTGGTGTCCAGTGAGAGAGAGAGAAAAA  98
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  GGGTTGGCAGACCCCGTCTGGTCTGGTGTCCAGTGAGAGAGAGAGAAAAA  100

seq1  AAA-GTAAACAAAT-ACATGTATCAGAGAGCGTCCCAGATATGGCACCTT  146
      ||| |||||||||| |||||||||||||||||||||||||||||||||||
seq2  AAAGGTAAACAAATAACATGTATCAGAGAGCGTCCCAGATATGGCACCTT  150

seq1  CTTCC-AGGAAATTTTCCAGAAAGAACACCTGCCTTGTAGAAGCTTCTCT  195
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCAAGGAAATTTTCCAGAAAGAACACCTGCCTTGTAGAAGCTTCTCT  200

seq1  AAGTCTTGCCCTAGGATGGCAGAGGCCTACCTGAAGTGCCAGAGTTCCCC  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCTTGCCCTAGGATGGCAGAGGCCTACCTGAAGTGCCAGAGTTCCCC  250

seq1  TGAACCCCTGATCTTATACCAGAGAGACCTCTGCCACACTAGAGCCACCT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACCCCTGATCTTATACCAGAGAGACCTCTGCCACACTAGAGCCACCT  300

seq1  CAGCTCAGCCCCAAGGCTGAGTCTGTTCATATGCATCACCTTCTCCAAGG  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTCAGCCCCAAGGCTGAGTCTGTTCATATGCATCACCTTCTCCAAGG  350

seq1  GTCTTAGAATAACTTGGTTAGGGTTTCCAGGTCCTTCTCTATAATCTATT  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTAGAATAACTTGGTTAGGGTTTCCAGGTCCTTCTCTATAATCTATT  400

seq1  GGATGCCTAGGAGTGAACCCAAAGGGCAAGCACGTTGTTTACATAACCAC  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGCCTAGGAGTGAACCCAAAGGGCAAGCACGTTGTTTACATAACCAC  450

seq1  TGATAGGAGGGAAAAACTTAGAGCCACATACACAGAGGGTACTTACATCT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATAGGAGGGAAAAACTTAGAGCCACATACACAGAGGGTACTTACATCT  500

seq1  AGGTTCCTCAGAGTCAGCCCACTTGTCCATTTAACAGTAAATTCATTAGT  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTCCTCAGAGTCAGCCCACTTGTCCATTTAACAGTAAATTCATTAGT  550

seq1  GCCTATTATGCTACTATATAGAATGTGCCAGTCAAGGCAAAATATGGTGT  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTATTATGCTACTATATAGAATGTGCCAGTCAAGGCAAAATATGGTGT  600

seq1  GACTGACCAAGACAAACCCACCCTCTGCTCACATGGAACTCACATTCTGG  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTGACCAAGACAAACCCACCCTCTGCTCACATGGAACTCACATTCTGG  650

seq1  TAAACAGAATATTTATTTCCAACCAGCTAAGAAAGGGACAACGGGATAGA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACAGAATATTTATTTCCAACCAGCTAAGAAAGGGACAACGGGATAGA  700

seq1  AAAATCAAAATTAAAAATAACCCTCTCATTTCAGAATTCCCAACCTCCCA  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATCAAAATTAAAAATAACCCTCTCATTTCAGAATTCCCAACCTCCCA  750

seq1  CTTGGAGAACAAGGTCCTATTTTGATAACAAAAGGGCGAAGCGTCCTGCC  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGGAGAACAAGGTCCTATTTTGATAACAAAAGGGCGAAGCGTCCTGCC  800

seq1  GTTCTGCCACTTTGACCTGAAGGAGTCGGACTACATCAGTGGTCATCGGC  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTGCCACTTTGACCTGAAGGAGTCGGACTACATCAGTGGTCATCGGC  850

seq1  GCAACCCAGAGCTCCGAGGACCAGGCGCTGGGCCTCTCGAACCTAATACC  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAACCCAGAGCTCCGAGGACCAGGCGCTGGGCCTCTCGAACCTAATACC  900

seq1  CGTGTGATTGAGTTCACCAGTGTGGGCATCGGTGGGAAGAATGTCCAGTG  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTGTGATTGAGTTCACCAGTGTGGGCATCGGTGGGAAGAATGTCCAGTG  950

seq1  AGTCTGAGTTGTATCGTTTGAATTC  970
      |||||||||||||||||||||||||
seq2  AGTCTGAGTTGTATCGTTTGAATTC  975

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information