MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-197J13
Chromosome	8 (Build37)
Map Location	108,994,390 - 109,101,937
singlet/doublet	doublet
Overlap gene	6030452D12Rik, Cdh3, LOC100042734
Upstream gene	2700055K07Rik, Zdhhc1, LOC667837, Hsd11b2, Atp6v0d1, Agrp, EG667846, 2310066E14Rik, LOC546100, Ctcf, EG546101, D130029J02Rik, Acd, Pard6a, E130303B06Rik, 4933405L10Rik, Gfod2, Ranbp10, Tsnaxip1, Cenpt, LOC100041617, Thap11, Nutf2, Edc4, Nrn1l, Pskh1, Ctrl, Psmb10, Lcat, Slc12a4, Dpep3, Dpep2, Ddx28, Dus2l, Nfatc3, Rbm35b, Lypla3, Slc7a6, Slc7a6os, Prmt7, Smpd3, Zfp90
Downstream gene	Cdh1, Tmco7, Has3, 5830457O10Rik, Cirh1a, EG234703, Sntb2, Vps4a, Cog8, Nip7, Tmed6, Terf2, EG667847, Cyb5b, LOC100042791, Nfat5, Nqo1, Nob1, Wwp2, LOC100042812
Link	Open Mouse BAC browser

Click to get alignment info.

name	2700055K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67971 MGI:1915221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70796 MGI:1918046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Hsd11b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15484 MGI:104720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11972 MGI:1201778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agrp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11604 MGI:892013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667846 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667846 MGI:3647575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 952 ESTs, 3 Proteins

name	2310066E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75687 MGI:1922937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Ctcf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13018 MGI:109447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG546101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546101 MGI:3642938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 453 ESTs, 34 Proteins

name	D130029J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234695 MGI:2685431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497652 MGI:87873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pard6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56513 MGI:1927223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	E130303B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102124 MGI:2142593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933405L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71046 MGI:1918296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 2 Proteins

name	Gfod2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70575 MGI:1917825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ranbp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74334 MGI:1921584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsnaxip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72236 MGI:1919486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320394 MGI:2443939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041617 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Thap11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59016 MGI:1930964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nutf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68051 MGI:1915301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234699 MGI:2446249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrn1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234700 MGI:2443642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pskh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244631 MGI:3528383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109660 MGI:88558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19171 MGI:1096380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16816 MGI:96755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc12a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20498 MGI:1309465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpep3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71854 MGI:1919104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319446 MGI:2442042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71986 MGI:1919236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dus2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66369 MGI:1913619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfatc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18021 MGI:103296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm35b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77411 MGI:1924661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lypla3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192654 MGI:2178076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330836 MGI:2142598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a6os (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66432 MGI:1916951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prmt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214572 MGI:2384879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58994 MGI:1927578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp90 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22751 MGI:104786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6030452D12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330837 MGI:3045356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Cdh3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12560 MGI:88356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042734 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1277 ESTs, 7 Proteins

name	Cdh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12550 MGI:88354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmco7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272538 MGI:2142786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Has3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15118 MGI:109599
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830457O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214987 MGI:2443370
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cirh1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21771 MGI:1096573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG234703 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234703 MGI:3648679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 1005 ESTs, 9 Proteins

name	Sntb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20650 MGI:101771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116733 MGI:1890520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cog8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97484 MGI:2142885
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nip7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66164 MGI:1913414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmed6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66269 MGI:1913519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Terf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21750 MGI:1195972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG667847 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667847 MGI:3647574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2652 ESTs, 10 Proteins

name	Cyb5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66427 MGI:1913677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042791 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 2115 ESTs, 2 Proteins

name	Nfat5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54446 MGI:1859333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nqo1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18104 MGI:103187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nob1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67619 MGI:1914869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wwp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66894 MGI:1914144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 807 ESTs, 7 Proteins

name	2700055K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980918 GeneID:67971 MGI:1915221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700055K07 gene transcript_id : NM_026481.2

name	Zdhhc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357306 GeneID:70796 MGI:1918046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 1 transcript_id : NM_175160.3

name	Hsd11b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778912 GeneID:15484 MGI:104720
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid 11-beta dehydrogenase 2 transcript_id : NM_008289.2

name	Atp6v0d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802838 GeneID:11972 MGI:1201778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit D1 transcript_id : NM_013477.3

name	Agrp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491876 GeneID:11604 MGI:892013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : agouti related protein transcript_id : NM_007427.2

name	EG667846 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259072 GeneID:667846 MGI:3647575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 952 ESTs, 3 Proteins product : predicted gene, EG667846 transcript_id : XM_992869.2

name	2310066E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486970 GeneID:75687 MGI:1922937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310066E14 gene transcript_id : NM_001081241.1

name	LOC546100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94383788 GeneID:546100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical LOC546100 transcript_id : XM_622446.3

name	Ctcf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681072 GeneID:13018 MGI:109447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCCTC-binding factor transcript_id : NM_007794.1

name	Ctcf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342434 GeneID:13018 MGI:109447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCCTC-binding factor transcript_id : NM_181322.2

name	EG546101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383789 GeneID:546101 MGI:3642938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 453 ESTs, 34 Proteins product : predicted gene, EG546101 transcript_id : XM_620708.3

name	D130029J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131122 GeneID:234695 MGI:2685431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D130029J02 gene transcript_id : NM_001033320.2

name	Acd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593058 GeneID:497652 MGI:87873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenocortical dysplasia transcript_id : NM_001012638.1

name	Pard6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145500 GeneID:56513 MGI:1927223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : par-6 (partitioning defective 6,) homolog alpha (C. elegans) transcript_id : NM_001047436.1

name	Pard6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145494 GeneID:56513 MGI:1927223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : par-6 (partitioning defective 6,) homolog alpha (C. elegans) transcript_id : NM_019695.2

name	Pard6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145498 GeneID:56513 MGI:1927223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : par-6 (partitioning defective 6,) homolog alpha (C. elegans) transcript_id : NM_001047435.1

name	E130303B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38142469 GeneID:102124 MGI:2142593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130303B06 gene transcript_id : NM_198299.1

name	4933405L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259073 GeneID:71046 MGI:1918296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : RIKEN cDNA 4933405L10 gene transcript_id : XM_134328.4

name	Gfod2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802477 GeneID:70575 MGI:1917825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose-fructose oxidoreductase domain containing 2 transcript_id : NM_027469.2

name	Ranbp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676379 GeneID:74334 MGI:1921584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN binding protein 10 transcript_id : NM_145824.4

name	Tsnaxip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357349 GeneID:72236 MGI:1919486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translin-associated factor X (Tsnax) interacting protein 1 transcript_id : NM_024445.3

name	Cenpt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380926 GeneID:320394 MGI:2443939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein T transcript_id : NM_177150.2

name	LOC100041617 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259024 GeneID:100041617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041617 transcript_id : XM_001476693.1

name	Thap11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946933 GeneID:59016 MGI:1930964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing 11 transcript_id : NM_021513.1

name	Nutf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892556 GeneID:68051 MGI:1915301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear transport factor 2 transcript_id : NM_026532.3

name	Edc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795580 GeneID:234699 MGI:2446249
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enhancer of mRNA decapping 4 transcript_id : NM_181594.2

name	Nrn1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383424 GeneID:234700 MGI:2443642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuritin 1-like transcript_id : NM_175024.3

name	Pskh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982544 GeneID:244631 MGI:3528383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein serine kinase H1 transcript_id : NM_173432.2

name	Ctrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598840 GeneID:109660 MGI:88558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chymotrypsin-like transcript_id : NM_023182.2

name	Psmb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373194 GeneID:19171 MGI:1096380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 10 transcript_id : NM_013640.2

name	Lcat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678671 GeneID:16816 MGI:96755
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lecithin cholesterol acyltransferase transcript_id : NM_008490.1

name	Slc12a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892389 GeneID:20498 MGI:1309465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12, member 4 transcript_id : NM_009195.2

name	Dpep3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369401 GeneID:71854 MGI:1919104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidase 3 transcript_id : NM_027960.2

name	Dpep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32880213 GeneID:319446 MGI:2442042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidase 2 transcript_id : NM_176913.3

name	Ddx28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369283 GeneID:71986 MGI:1919236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 transcript_id : NM_028038.2

name	Dus2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365381 GeneID:66369 MGI:1913619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydrouridine synthase 2-like (SMM1, S. cerevisiae) transcript_id : NM_025518.3

name	Nfatc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199768 GeneID:18021 MGI:103296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 transcript_id : NM_010901.2

name	Rbm35b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341162 GeneID:77411 MGI:1924661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 35b transcript_id : NM_176838.2

name	Lypla3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543133 GeneID:192654 MGI:2178076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysophospholipase 3 transcript_id : NM_133792.2

name	Slc7a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130634 GeneID:330836 MGI:2142598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 transcript_id : NM_178798.3

name	Slc7a6os (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222271 GeneID:66432 MGI:1916951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7, member 6 opposite strand transcript_id : NM_001007567.1

name	Prmt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703807 GeneID:214572 MGI:2384879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 7 transcript_id : NM_145404.1

name	Smpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130464 GeneID:58994 MGI:1927578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 3, neutral transcript_id : NM_021491.3

name	Zfp90 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113679838 GeneID:22751 MGI:104786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 90 transcript_id : NM_011764.3

name	Cdh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802137 GeneID:12560 MGI:88356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 3 transcript_id : NM_007665.2

name	Cdh3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802880 GeneID:12560 MGI:88356
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 3 transcript_id : NM_001037809.2

name	LOC100042734 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259079 GeneID:100042734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1277 ESTs, 6 Proteins product : similar to acidic ribosomal phosphoprotein P1, transcript variant 1 transcript_id : XM_001479364.1

name	LOC100042734 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259081 GeneID:100042734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 66 ESTs, 1 Protein product : similar to acidic ribosomal phosphoprotein P1, transcript variant 2 transcript_id : XM_001479370.1

name	Cdh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129809 GeneID:12550 MGI:88354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 1 transcript_id : NM_009864.2

name	Tmco7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370559 GeneID:272538 MGI:2142786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and coiled-coil domains 7 transcript_id : NM_173037.1

name	Has3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351756 GeneID:15118 MGI:109599
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronan synthase 3 transcript_id : NM_008217.3

name	5830457O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84000433 GeneID:214987 MGI:2443370
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5830457O10 gene transcript_id : NM_145412.3

name	Cirh1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982958 GeneID:21771 MGI:1096573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cirrhosis, autosomal recessive 1A (human) transcript_id : NM_011574.1

name	EG234703 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383798 GeneID:234703 MGI:3648679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 1005 ESTs, 9 Proteins product : predicted gene, EG234703 transcript_id : XM_134291.7

name	Sntb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382839 GeneID:20650 MGI:101771
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : syntrophin, basic 2 transcript_id : NM_009229.3

name	Vps4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18699725 GeneID:116733 MGI:1890520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 4a (yeast) transcript_id : NM_126165.1

name	Cog8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66392580 GeneID:97484 MGI:2142885
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : component of oligomeric golgi complex 8 transcript_id : NM_139229.3

name	Nip7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13928673 GeneID:66164 MGI:1913414
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear import 7 homolog (S. cerevisiae) transcript_id : NM_025391.1

name	Tmed6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383925 GeneID:66269 MGI:1913519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane emp24 protein transport domain containing 6 transcript_id : NM_025458.2

name	Terf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133904141 GeneID:21750 MGI:1195972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : telomeric repeat binding factor 2 transcript_id : NM_009353.2

name	Terf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133904139 GeneID:21750 MGI:1195972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : telomeric repeat binding factor 2 transcript_id : NM_001083118.1

name	EG667847 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259083 GeneID:667847 MGI:3647574
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 mRNAs, 2652 ESTs, 9 Proteins product : predicted gene, EG667847, transcript variant 2 transcript_id : XM_001004356.2

name	Cyb5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373832 GeneID:66427 MGI:1913677
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b5 type B transcript_id : NM_025558.3

name	LOC100042791 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259084 GeneID:100042791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 1812 ESTs, 2 Proteins product : similar to ribosomal protein, transcript variant 1 transcript_id : XM_001479484.1

name	LOC100042791 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259086 GeneID:100042791
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 2114 ESTs, 2 Proteins product : similar to ribosomal protein, transcript variant 2 transcript_id : XM_001479493.1

name	Nfat5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26080414 GeneID:54446 MGI:1859333
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells 5 transcript_id : NM_133957.2

name	Nfat5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055287 GeneID:54446 MGI:1859333
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells 5 transcript_id : NM_018823.1

name	Nqo1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94400772 GeneID:18104 MGI:103187
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAD(P)H dehydrogenase, quinone 1 transcript_id : NM_008706.3

name	Nob1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344103 GeneID:67619 MGI:1914869
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIN1/RPN12 binding protein 1 homolog (S. cerevisiae) transcript_id : NM_026277.2

name	Wwp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543965 GeneID:66894 MGI:1914144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WW domain containing E3 ubiquitin protein ligase 2 transcript_id : NM_025830.3

name	LOC100042812 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259088 GeneID:100042812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 807 ESTs, 7 Proteins product : similar to ribosomal protein S26 transcript_id : XM_001479547.1

name	Zdhhc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424758 CCDS:CCDS22603.1 GeneID:70796 MGI:1918046
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA] codon_start : 1 product : zinc finger, DHHC domain containing 1 protein_id : NP_780369.1

name	Hsd11b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778913 GeneID:15484 MGI:104720
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : 11(beta)-HSD2 product : hydroxysteroid 11-beta dehydrogenase 2 protein_id : NP_032315.2

name	Atp6v0d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981304 CCDS:CCDS22604.1 GeneID:11972 MGI:1201778
definition	GO_component : GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IDA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump), 42 kDa; lysosomal 38kDa; ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D; ATPase, H+ transporting, V0 subunit D product : ATPase, H+ transporting, V0 subunit D isoform 1 protein_id : NP_038505.2

name	Agrp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671529 CCDS:CCDS22605.1 GeneID:11604 MGI:892013
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005184 - neuropeptide hormone activity [Evidence IDA] GO_process : GO:0009755 - hormone-mediated signaling [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IDA]; GO:0007582 - physiological process [Evidence IDA] codon_start : 1 note : orexigenic neuropeptide product : agouti related protein protein_id : NP_031453.1

name	EG667846 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383782 GeneID:667846 MGI:3647575
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997963.1

name	2310066E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486971 GeneID:75687 MGI:1922937
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC75687 protein_id : NP_001074710.1

name	LOC546100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63578927 GeneID:546100
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622446.1

name	EG546101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383790 GeneID:546101 MGI:3642938
definition	codon_start : 1 product : similar to 17,000 dalton myosin light chain protein_id : XP_620708.3

name	Ctcf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681073 CCDS:CCDS22606.1 GeneID:13018 MGI:109447
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006306 - DNA methylation [Evidence IDA]; GO:0009048 - dosage compensation, by inactivation of X chromosome [Evidence TAS]; GO:0006349 - imprinting [Evidence IMP] [Evidence IDA]; GO:0010216 - maintenance of DNA methylation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CCCTC-binding factor protein_id : NP_031820.1

name	Ctcf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044459 CCDS:CCDS22606.1 GeneID:13018 MGI:109447
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006306 - DNA methylation [Evidence IDA]; GO:0009048 - dosage compensation, by inactivation of X chromosome [Evidence TAS]; GO:0006349 - imprinting [Evidence IMP] [Evidence IDA]; GO:0010216 - maintenance of DNA methylation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CCCTC-binding factor protein_id : NP_851839.1

name	D130029J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701822 CCDS:CCDS22607.1 GeneID:234695 MGI:2685431
definition	codon_start : 1 product : hypothetical protein LOC234695 protein_id : NP_001028492.1

name	Acd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593059 CCDS:CCDS22608.1 GeneID:497652 MGI:87873
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IEA]; GO:0000783 - nuclear telomere cap complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0035282 - segmentation [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP]; GO:0000723 - telomere maintenance [Evidence IEA] [Evidence ISS]; GO:0001655 - urogenital system development [Evidence IMP] codon_start : 1 product : adrenocortical dysplasia protein_id : NP_001012656.1

name	Pard6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145501 GeneID:56513 MGI:1927223
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0030742 - GTP-dependent protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030010 - establishment of cell polarity [Evidence TAS]; GO:0045217 - intercellular junction maintenance [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; Tax interaction protein 40 product : par-6 (partitioning defective 6,) homolog alpha isoform 3 protein_id : NP_001040901.1

name	Pard6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145495 CCDS:CCDS22609.1 GeneID:56513 MGI:1927223
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0030742 - GTP-dependent protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030010 - establishment of cell polarity [Evidence TAS]; GO:0045217 - intercellular junction maintenance [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Tax interaction protein 40 product : par-6 (partitioning defective 6,) homolog alpha isoform 1 protein_id : NP_062669.2

name	Pard6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145499 GeneID:56513 MGI:1927223
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0030742 - GTP-dependent protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030010 - establishment of cell polarity [Evidence TAS]; GO:0045217 - intercellular junction maintenance [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Tax interaction protein 40 product : par-6 (partitioning defective 6,) homolog alpha isoform 2 protein_id : NP_001040900.1

name	E130303B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38142470 CCDS:CCDS22610.1 GeneID:102124 MGI:2142593
definition	codon_start : 1 product : hypothetical protein LOC102124 protein_id : NP_938041.1

name	4933405L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259074 GeneID:71046 MGI:1918296
definition	codon_start : 1 product : hypothetical protein LOC71046 protein_id : XP_134328.2

name	Gfod2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312610 CCDS:CCDS22612.1 GeneID:70575 MGI:1917825
definition	codon_start : 1 product : glucose-fructose oxidoreductase domain containing 2 protein_id : NP_081745.1

name	Ranbp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40804757 CCDS:CCDS22613.1 GeneID:74334 MGI:1921584
definition	codon_start : 1 product : Ran-binding protein 10 protein_id : NP_665823.2

name	Tsnaxip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789217 CCDS:CCDS22614.1 GeneID:72236 MGI:1919486
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : translin-associated factor X (Tsnax) interacting protein 1 protein_id : NP_077765.1

name	Cenpt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893125 CCDS:CCDS22615.1 GeneID:320394 MGI:2443939
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : centromere protein T protein_id : NP_796124.1

name	LOC100041617 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259025 GeneID:100041617
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476743.1

name	Thap11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946934 CCDS:CCDS22616.1 GeneID:59016 MGI:1930964
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : THAP domain containing 11 protein_id : NP_067488.1

name	Nutf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386032 CCDS:CCDS22617.1 GeneID:68051 MGI:1915301
definition	GO_function : GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0006606 - protein import into nucleus [Evidence IDA] codon_start : 1 product : nuclear transport factor 2 protein_id : NP_080808.1

name	Edc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712002 GeneID:234699 MGI:2446249
definition	codon_start : 1 product : cDNA sequence BC022641 protein_id : NP_853625.1

name	Nrn1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542833 CCDS:CCDS22618.1 GeneID:234700 MGI:2443642
definition	codon_start : 1 note : MRCC2446-like protein; candidate plasticity gene 15-2 product : neuritin 1-like protein_id : NP_778189.1

name	Pskh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734116 CCDS:CCDS22619.1 GeneID:244631 MGI:3528383
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 product : protein serine kinase H1 protein_id : NP_775608.1

name	Ctrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13374559 CCDS:CCDS22620.1 GeneID:109660 MGI:88558
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : chymotrypsin A; chymotrypsin A CTRA-1 product : chymotrypsin-like protein_id : NP_075671.1

name	Psmb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305417 CCDS:CCDS22621.1 GeneID:19171 MGI:1096380
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : proteasome (prosomome, macropain) subunit, beta type 10; prosome Mecl1; proteasome subunit MECL1 product : proteasome (prosome, macropain) subunit, beta type 10 protein_id : NP_038668.1

name	Lcat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678672 CCDS:CCDS22622.1 GeneID:16816 MGI:96755
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004607 - phosphatidylcholine-sterol O-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : lecithin-cholesterol acyltransferase Lcat product : lecithin cholesterol acyltransferase protein_id : NP_032516.1

name	Slc12a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677993 CCDS:CCDS22623.1 GeneID:20498 MGI:1309465
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0015377 - cation:chloride symporter activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : K-Cl cotransporter KCC1 product : solute carrier family 12, member 4 protein_id : NP_033221.1

name	Dpep3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313683 CCDS:CCDS22624.1 GeneID:71854 MGI:1919104
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0008239 - dipeptidyl-peptidase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004237 - membrane dipeptidase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 product : putative membrane-bound dipeptidase 3 protein_id : NP_082236.1

name	Dpep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32880214 CCDS:CCDS22625.1 GeneID:319446 MGI:2442042
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0008239 - dipeptidyl-peptidase activity [Evidence IEA]; GO:0008238 - exopeptidase activity [Evidence IDA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004237 - membrane dipeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : putative membrane-bound dipeptidase 2 protein_id : NP_795887.2

name	Ddx28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312584 CCDS:CCDS22626.1 GeneID:71986 MGI:1919236
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 protein_id : NP_082314.1

name	Dus2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625595 CCDS:CCDS22627.1 GeneID:66369 MGI:1913619
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : dihydrouridine synthase 2-like protein_id : NP_079794.1

name	Nfatc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199769 CCDS:CCDS22628.1 GeneID:18021 MGI:103296
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0045333 - cellular respiration [Evidence IMP]; GO:0007507 - heart development [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP] [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear factor of activated T-cells, cytoplasmic 3 product : cytoplasmic nuclear factor of activated T-cells 3 protein_id : NP_035031.2

name	Rbm35b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849887 CCDS:CCDS22629.1 GeneID:77411 MGI:1924661
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 35b protein_id : NP_789808.1

name	Lypla3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527008 CCDS:CCDS22630.1 GeneID:192654 MGI:2178076
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0047499 - calcium-independent phospholipase A2 activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004622 - lysophospholipase activity [Evidence IDA]; GO:0004607 - phosphatidylcholine-sterol O-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006672 - ceramide metabolism [Evidence IDA]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : lysosomal phospholipase A2 product : lysophospholipase 3 protein_id : NP_598553.1

name	Slc7a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520283 CCDS:CCDS22631.1 GeneID:330836 MGI:2142598
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carriersolute carrier family 7 (cationic amino acid transporter, y+ system), member 6 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 protein_id : NP_848913.1

name	Slc7a6os (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222272 CCDS:CCDS22632.1 GeneID:66432 MGI:1916951
definition	codon_start : 1 product : solute carrier family 7, member 6 opposite strand protein_id : NP_001007568.1

name	Prmt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703808 CCDS:CCDS22633.1 GeneID:214572 MGI:2384879
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0042393 - histone binding [Evidence ISS]; GO:0008469 - histone-arginine N-methyltransferase activity [Evidence ISS]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0035241 - protein-arginine omega-N monomethyltransferase activity [Evidence ISS]; GO:0035243 - protein-arginine omega-N symmetric methyltransferase activity [Evidence ISS]; GO:0008757 - S-adenosylmethionine-dependent methyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016277 - [myelin basic protein]-arginine N-methyltransferase activity [Evidence ISS] GO_process : GO:0016571 - histone methylation [Evidence ISS]; GO:0018216 - peptidyl-arginine methylation [Evidence ISS]; GO:0043393 - regulation of protein binding [Evidence ISS] codon_start : 1 product : protein arginine N-methyltransferase 7 protein_id : NP_663379.1

name	Smpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946902 CCDS:CCDS22634.1 GeneID:58994 MGI:1927578
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0000137 - Golgi cis cisterna [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030072 - peptide hormone secretion [Evidence IMP]; GO:0006950 - response to stress [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0006684 - sphingomyelin metabolism [Evidence IDA] codon_start : 1 note : fragilitas ossium; neutral sphingomyelinase II product : sphingomyelin phosphodiesterase 3, neutral protein_id : NP_067466.1

name	Zfp90 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756067 CCDS:CCDS22635.1 GeneID:22751 MGI:104786
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : Nk10 expressed protein; zinc finger protein 83 product : zinc finger protein 90 protein_id : NP_035894.1

name	Cdh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83715978 CCDS:CCDS22637.1 GeneID:12560 MGI:88356
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : cadherin 3 isoform a protein_id : NP_001032898.1

name	Cdh3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45496816 GeneID:12560 MGI:88356
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : cadherin 3 isoform b protein_id : NP_031691.1

name	LOC100042734 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259082 GeneID:100042734
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 2 protein_id : XP_001479420.1

name	LOC100042734 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259080 GeneID:100042734
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 1 protein_id : XP_001479414.1

name	Cdh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753374 CCDS:CCDS22638.1 GeneID:12550 MGI:88354
definition	GO_component : GO:0005912 - adherens junction [Evidence IDA]; GO:0045177 - apical part of cell [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0008013 - beta-catenin binding [Evidence IPI]; GO:0005509 - calcium ion binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0051260 - protein homooligomerization [Evidence IDA]; GO:0019538 - protein metabolism [Evidence IDA]; GO:0043281 - regulation of caspase activity [Evidence IDA] codon_start : 1 note : uvomorulin; E-cadherin product : cadherin 1 protein_id : NP_033994.1

name	Tmco7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370560 CCDS:CCDS22639.1 GeneID:272538 MGI:2142786
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : transmembrane and coiled-coil domains 7 protein_id : NP_766625.1

name	Has3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680173 CCDS:CCDS22640.1 GeneID:15118 MGI:109599
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0050501 - hyaluronan synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hyaluronan synthase 3 protein_id : NP_032243.1

name	5830457O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84000434 GeneID:214987 MGI:2443370
definition	codon_start : 1 product : hypothetical protein LOC214987 protein_id : NP_663387.3

name	Cirh1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982959 GeneID:21771 MGI:1096573
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : cirrhosis, autosomal recessive 1A protein_id : NP_035704.1

name	EG234703 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20886513 GeneID:234703 MGI:3648679
definition	codon_start : 1 product : similar to QM protein protein_id : XP_134291.1

name	Sntb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678059 CCDS:CCDS22642.1 GeneID:20650 MGI:101771
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : syntrophin, basic 2 protein_id : NP_033255.1

name	Vps4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18699726 GeneID:116733 MGI:1890520
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence ISS] codon_start : 1 note : vacuolar protein sorting protein 4a product : vacuolar protein sorting 4a protein_id : NP_569053.1

name	Cog8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66392581 CCDS:CCDS22643.1 GeneID:97484 MGI:2142885
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : conserved oligomeric Golgi complex protein 8 product : component of oligomeric golgi complex 8 protein_id : NP_631975.3

name	Nip7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928674 CCDS:CCDS22644.1 GeneID:66164 MGI:1913414
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Saccharomyces cerevisiae Nip7p homolog protein_id : NP_079667.1

name	Tmed6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384864 CCDS:CCDS22645.1 GeneID:66269 MGI:1913519
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane emp24 protein transport domain containing 6 protein_id : NP_079734.1

name	Terf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133904142 CCDS:CCDS22646.1 GeneID:21750 MGI:1195972
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043047 - single-stranded telomeric DNA binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0000723 - telomere maintenance [Evidence IMP] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : telomeric repeat binding factor 2 isoform 1 protein_id : NP_033379.2

name	Terf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133904140 GeneID:21750 MGI:1195972
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043047 - single-stranded telomeric DNA binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0000723 - telomere maintenance [Evidence IMP] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : telomeric repeat binding factor 2 isoform 2 protein_id : NP_001076587.1

name	EG667847 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383784 GeneID:667847 MGI:3647574
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001004356.1

name	Cyb5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542438 CCDS:CCDS22647.1 GeneID:66427 MGI:1913677
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : cytochrome b5 outer mitochondrial membrane product : cytochrome b5 outer mitochondrial membrane precursor protein_id : NP_079834.2

name	LOC100042791 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259085 GeneID:100042791
definition	codon_start : 1 product : similar to ribosomal protein isoform 1 protein_id : XP_001479534.1

name	LOC100042791 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259087 GeneID:100042791
definition	codon_start : 1 product : similar to ribosomal protein isoform 2 protein_id : XP_001479543.1

name	Nfat5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055288 CCDS:CCDS22648.1 GeneID:54446 MGI:1859333
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006351 - transcription, DNA-dependent [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant b; tonicity-responsive enhancer binding protein; Rel domain-containing transcription factor product : nuclear factor of activated T-cells 5 isoform b protein_id : NP_061293.1

name	Nfat5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270033 GeneID:54446 MGI:1859333
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0003700 - transcription factor activity [Evidence IEA] [Evidence ISS] GO_process : GO:0001816 - cytokine production [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006351 - transcription, DNA-dependent [Evidence ISS] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant a; tonicity-responsive enhancer binding protein; Rel domain-containing transcription factor product : nuclear factor of activated T-cells 5 isoform a protein_id : NP_598718.1

name	Nqo1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94400773 GeneID:18104 MGI:103187
definition	GO_function : GO:0003955 - NAD(P)H dehydrogenase (quinone) activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence IMP] codon_start : 1 note : NAD(P)H menadione oxidoreductase 1, dioxin inducible; diaphorase 4 (NADH/NADPH); NAD(P)H dehydrogenase (quinone) product : NAD(P)H dehydrogenase, quinone 1 protein_id : NP_032732.3

name	Nob1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794454 CCDS:CCDS22649.1 GeneID:67619 MGI:1914869
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030490 - processing of 20S pre-rRNA [Evidence ISS]; GO:0042274 - ribosomal small subunit biogenesis [Evidence ISS] codon_start : 1 note : PSMD8 binding protein 1 product : nin one binding protein protein_id : NP_080553.1

name	LOC100042812 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259089 GeneID:100042812
definition	codon_start : 1 product : similar to ribosomal protein S26 protein_id : XP_001479597.1

name	Wwp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385304 GeneID:66894 MGI:1914144
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] codon_start : 1 note : WW domain-containing protein 4 product : WW domain-containing protein 2 protein_id : NP_080106.1

name	LOC667837 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667837
definition	number : 1 pseudo : _no_value

name	LOC667837 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667837
definition	number : 2 pseudo : _no_value

name	6030452D12Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149259028 GeneID:330837 MGI:3045356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 6030452D12 gene transcript_id : XR_035325.1

clone name	MSMg01-538B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116D01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-399F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436E14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-195P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-531M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189O07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245M01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-197J13.b	B6Ng01-197J13.g
ACC	GA019417	GA019418
length	1,146	528
definition	B6Ng01-197J13.b	B6Ng01-197J13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(109,100,780 - 109,101,937)	(108,994,390 - 108,994,923)
sequence	gaattccaggatagccagggctataccatgagatcttgtctcaaataaat taaatacacaaacaaaagaaagaaaaagaaaaaattggaggaaggaagga gagagagagagaagagagagagagaaagagaacctcgttaagattggcta gaagaagacaagaagcatcctcgctaaggagcaactaattccactgcctg gcatgaagaaaggaaaggtttaataattcagagaaggcaggccgggtggc tcatgcctgtaatcccagaactcaggaggctgagacaggattgtctaggc tacattgcaagtttcagactaaccttggctatggtgagcccctgtccaaa aaaaaaaaaagctctttgcaggtgtggaaggacaagtagcggaggcaggg acactgagaaggtgtcactgtggcaaagccaacagtccaggaatggggaa ggagcgtgtcttctgtggctgtgtgacctgtatgtggaagtgggacagat cagcaggagctgagatttttggacaaagtccaggactgaaaggactttaa acagcctgctacttgtatttcactgagggggtcacaggaatgcaaggacg tgtattggcacagagggaggaggactgttctaagagactggcctgggagc acgggcttctgtagttctctccactggagttcacagtctgacctcagcca gaggaagtaggcacaaaatgggtggggcagtgcttgtcagccagcccgaa atccaagccctgatattattccctggtggcttctgagagagatgactaat atctctaagataagaaaggcttctgatgcaacctgatattcttgttggtg gcgactgggaacccacgtttagaggagctgaattactacaggggagaaaa gagcagttatgttattaaagtgaaatgacttatatcattcctggtttcct gactatgggctatgatgtgaccagctgtctcctgtcttcaggctcctgca ggacttccccactagtatagactgttccctagaactggagccaaaataac caccccccccatttttttcgtttcttgaaacaggtttctctgtggagctc tgccgtcctggaactcactctagaacaagctgccttgaactcgaaa	actttgcagaccaggctggcctcgaacacagaaattcacttgcctctgcc tccccagtgctggaattaaaggcgtgcaccactaccatccagccagaggt ttttcgttttgagatgcatatgtatatgccaaaaaaaataggaaaaatat acagatatgctaaaaagaaaatggaaaaggaagacataattacttatatt tatgccacttagaaatgtggtttcctaatcccaggacagccagggctata cagagaaaccctgtctcaaaaaaaccacaaaagaaagaaaggaaggaagg aaggaaggaaggaaggaagggagagagagagagagagagagagagagaga gagagagagaaagaaagatagaaagaaagaaagaaagaaagaaagaaaga aagaaagaaagaaaaggaaggtggtttccaaccgggtggtggtgcacgcc tttaatcccagcgctccagaggcagaggcaggcagatgtttgagagatgg aggacagccaggtctgcatactgaattt
quality values	Open. Hide. 62 41 30 42 62 62 39 14 62 62 38 42 62 62 62 44 32 62 62 49 59 62 62 62 62 62 59 59 62 62 59 62 59 59 59 48 43 49 48 59 54 49 56 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 54 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 40 47 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 52 62 62 62 62 62 62 62 62 54 62 62 47 62 62 62 62 47 58 58 58 54 58 58 58 54 58 58 58 58 58 54 58 58 58 54 40 54 58 58 58 39 58 58 58 58 52 58 52 54 58 58 58 58 54 54 58 54 54 54 54 58 42 54 54 58 58 58 52 58 58 58 58 52 50 54 54 52 54 41 58 58 47 47 58 54 39 58 54 33 58 58 52 52 52 53 39 51 46 58 34 42 39 51 58 51 47 58 51 58 58 47 32 24 53 47 42 51 58 43 49 49 49 39 50 54 47 50 50 58 53 53 53 53 49 51 42 46 46 37 37 58 44 21 51 52 46 46 39 37 50 50 50 53 51 50 42 51 52 53 52 37 46 31 22 37 50 27 50 51 52 27 43 50 39 58 27 19 49 29 58 58 44 42 44 49 44 41 53 58 58 58 31 39 39 38 50 39 53 52 52 41 50 40 35 50 40 37 39 39 44 44 30 46 36 40 42 33 50 24 49 34 52 50 47 27 35 34 32 31 40 29 31 29 51 32 54 47 38 45 49 11 23 39 26 53 35 28 31 52 53 31 52 30 47 47 35 21 37 38 23 37 32 54 47 38 40 43 37 42 40 31 33 23 34 32 31 46 31 42 45 14 9 38 22 22 28 31 32 29 32 22 32 31 39 30 26 33 29 39 41 26 27 23 40 30 31 21 40 17 33 40 19 23 51 38 23 26 32 23 31 28 37 18 18 21 18 36 29 20 39 33 31 51 24 31 24 31 22 35 21 10 31 34 31 37 33 32 13 23 42 28 15 30 12 33 46 46 19 42 22 26 48 48 42 17 33 24 24 19 11 13 43 23 31 43 31 32 21 31 29 37 31 28 25 33 11 7 46 29 23 28 31 31 31 25 9 7 9 20 24 14 29 12 7 18 17 38 34 22 46 18 32 25 16 20 10 17 23 31 24 21 41 21 13 14 26 16 24 10 5 10 9 15 19 13 21 23 24 21 21 24 19 22 27 10 34 11 19 10 12 7 13 15 14 11 14 11 7 11 21 8 8 10 7 17 11 19 15 30 23 18 36 31 29 19 15 8 19 6 4 5 7 13 7 7 6 12 17 8 22 12 33 25 7 10 7 7 31 15 18 21 29 4 7 14 17 28 40 29 27 8 21 8 15 7 8 21 27 29 38 40 29 21 3 5 13 18 21 21 17 9 5 3 3 4 40 18 3 5 11 7 22 29 15 7 11 23 16 3 11 5 7 8 13 15 13 5 2 1 2 3 4 5 4 10 18 5 4 5 4 4 11 5 4 17 14 3 5 10 12 4 7 17 25 5 4 5 13 5 9 4 4 4 3 4 13 3 5 13 21 6 24 23 4 11 7 7 15 7 11	Open. Hide. 39 59 62 62 62 62 44 43 35 35 46 49 32 27 32 46 51 62 62 62 62 62 62 50 54 62 62 62 62 59 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 62 59 59 62 62 62 48 56 54 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 59 56 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 54 49 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 54 48 56 59 62 59 51 56 34 41 49 45 34 56 56 50 43 59 50 50 50 62 59 50 43 56 50 51 43 56 56 50 49 59 56 50 46 62 56 48 50 56 48 50 51 59 56 50 50 62 59 62 56 56 40 56 50 56 46 54 46 59 51 56 43 56 38 56 49 59 50 59 51 59 49 51 41 51 49 59 59 59 49 56 43 40 34 39 30 39 29 23 13 45 30 18 14 24 13 13 13 30 19 23 19 34 18 10 23 45 39 34 30 43 41 39 24 41 30 20 23 34 36 43 34 51 43 38 24 39 24 24 24 43 50 38 35 32 24 10 14 27 16 27 38 27 51 44 28 30 51 32 42 44 27 32 38 50 56 30 42 51 43 38 56 39 39 56 42 27 51 31 27 33 27 22 38 27 43 37 22 14 10 12 10 18 14 14 24 10 23 31 39 46 50 39 56 27 23 56 23 38 31 21 15 35 20 30 23 13 10 24 14 11 10 17 12 12 12 25 33 43 31 13 20 9 13 14 23 18 14 9 10 12 9 9 7 10 14 10 7 6 9 6 13 9 10 8 11 17 9 21 14 13 9 12 9 9

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_109100780_109101937
seq2: B6Ng01-197J13.b_44_1189 (reverse)

seq1  TTTCTGAGTTCAAGGCCAGCCTGGTCTAGGAGTGAGTTCCAGGACAGCCA  50
      |||| |||||||||| |||| || |||| |||||||||||||||| | ||
seq2  TTTC-GAGTTCAAGG-CAGCTTGTTCTA-GAGTGAGTTCCAGGAC-GGCA  46

seq1  GAGCTACACAGAGAAACCCTGTTTCAAGGAAAAAGGAAAAAAAAAGGGGG  100
      ||||| |||||||||| |||||||||||   ||| |  ||||||| ||||
seq2  GAGCTCCACAGAGAAA-CCTGTTTCAAG---AAACG--AAAAAAATGGGG  90

seq1  GGGGTGGTTATTTTTGGCTCCCAGTTCTAGGGAACAGTCTATACTAGTGG  150
      |||||||||| |||||||| ||||||||||||||||||||||||||||||
seq2  GGGGTGGTTA-TTTTGGCT-CCAGTTCTAGGGAACAGTCTATACTAGTGG  138

seq1  GGAAGTCCTGGCAGGAGCTTG-AGACAGGAGACAGCTGGTCACATCATAG  199
      ||||||||| |||||||| || ||||||||||||||||||||||||||||
seq2  GGAAGTCCT-GCAGGAGCCTGAAGACAGGAGACAGCTGGTCACATCATAG  187

seq1  -CCATAGTCAGGAAACCAGAAATGATATAAGTCATTTCACTTTAATAACA  248
       |||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  CCCATAGTCAGGAAACCAGGAATGATATAAGTCATTTCACTTTAATAACA  237

seq1  TAACTGCTCTTTTCTCCCCTGTAGTAATTCAGCTCCTCTAAACGTGGGTT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTGCTCTTTTCTCCCCTGTAGTAATTCAGCTCCTCTAAACGTGGGTT  287

seq1  CCCCAGTCGCCACCAACAAGAATATCAGGTTGCATCAGAAGCCTTTCTTA  348
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  -CCCAGTCGCCACCAACAAGAATATCAGGTTGCATCAGAAGCCTTTCTTA  336

seq1  TCTTAGAGATATTAGTCATCTCTCTCAGAAGCCACCAGGGAATAATATCA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAGAGATATTAGTCATCTCTCTCAGAAGCCACCAGGGAATAATATCA  386

seq1  GGGCTTGGATTTCGGGCTGGCTGACAAGCACTGCCCCACCCATTTTGTGC  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTTGGATTTCGGGCTGGCTGACAAGCACTGCCCCACCCATTTTGTGC  436

seq1  CTACTTCCTCTGGCTGAGGTCAGACTGTGAACTCCAGTGGAGAGAACTAC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTTCCTCTGGCTGAGGTCAGACTGTGAACTCCAGTGGAGAGAACTAC  486

seq1  AGAAGCCCGTGCTCCCAGGCCAGTCTCTTAGAACAGTCCTCCTCCCTCTG  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGCCCGTGCTCCCAGGCCAGTCTCTTAGAACAGTCCTCCTCCCTCTG  536

seq1  TGCCAATACACGTCCTTGCATTCCTGTGACCCCCTCAGTGAAATACAAGT  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAATACACGTCCTTGCATTCCTGTGACCCCCTCAGTGAAATACAAGT  586

seq1  AGCAGGCTGTTTAAAGTCCTTTCAGTCCTGGACTTTGTCCAAAAATCTCA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGCTGTTTAAAGTCCTTTCAGTCCTGGACTTTGTCCAAAAATCTCA  636

seq1  GCTCCTGCTGATCTGTCCCACTTCCACATACAGGTCACACAGCCACAGAA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCTGCTGATCTGTCCCACTTCCACATACAGGTCACACAGCCACAGAA  686

seq1  GACACGCTCCTTCCCCATTCCTGGACTGTTGGCTTTGCCACAGTGACACC  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACACGCTCCTTCCCCATTCCTGGACTGTTGGCTTTGCCACAGTGACACC  736

seq1  TTCTCAGTGTCCCTGCCTCCGCTACTTGTCCTTCCACACCTGCAAAGAGC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCAGTGTCCCTGCCTCCGCTACTTGTCCTTCCACACCTGCAAAGAGC  786

seq1  TTTTTTTTTTTTTGGACAGGGGCTCACCATAGCCAAGGTTAGTCTGAAAC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTTTTTTGGACAGGGGCTCACCATAGCCAAGGTTAGTCTGAAAC  836

seq1  TTGCAATGTAGCCTAGACAATCCTGTCTCAGCCTCCTGAGTTCTGGGATT  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAATGTAGCCTAGACAATCCTGTCTCAGCCTCCTGAGTTCTGGGATT  886

seq1  ACAGGCATGAGCCACCCGGCCTGCCTTCTCTGAATTATTAAACCTTTCCT  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGCATGAGCCACCCGGCCTGCCTTCTCTGAATTATTAAACCTTTCCT  936

seq1  TTCTTCATGCCAGGCAGTGGAATTAGTTGCTCCTTAGCGAGGATGCTTCT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCATGCCAGGCAGTGGAATTAGTTGCTCCTTAGCGAGGATGCTTCT  986

seq1  TGTCTTCTTCTAGCCAATCTTAACGAGGTTCTCTTTCTCTCTCTCTCTTC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTTCTTCTAGCCAATCTTAACGAGGTTCTCTTTCTCTCTCTCTCTTC  1036

seq1  TCTCTCTCTCTCCTTCCTTCCTCCAATTTTTTCTTTTTCTTTCTTTTGTT  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTCTCTCTCCTTCCTTCCTCCAATTTTTTCTTTTTCTTTCTTTTGTT  1086

seq1  TGTGTATTTAATTTATTTGAGACAAGATCTCATGGTATAGCCCTGGCTAT  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTATTTAATTTATTTGAGACAAGATCTCATGGTATAGCCCTGGCTAT  1136

seq1  CCTGGAATTC  1158
      ||||||||||
seq2  CCTGGAATTC  1146

seq1: chr8_108994390_108994923
seq2: B6Ng01-197J13.g_71_604

seq1  GAATTCACTTTGCAGACCAGGCTGGCCTCGAACACAGAAATTCACTTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTTTGCAGACCAGGCTGGCCTCGAACACAGAAATTCACTTGCC  50

seq1  TCTGCCTCCCCAGTGCTGGAATTAAAGGCGTGCACCACTACCATCCAGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCTCCCCAGTGCTGGAATTAAAGGCGTGCACCACTACCATCCAGCC  100

seq1  AGAGGTTTTTCGTTTTGAGATGCATATGTATATGCCAAAAAAAATAGGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGTTTTTCGTTTTGAGATGCATATGTATATGCCAAAAAAAATAGGAA  150

seq1  AAATATACAGATATGCTAAAAAGAAAATGGAAAAGGAAGACATAATTACT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATATACAGATATGCTAAAAAGAAAATGGAAAAGGAAGACATAATTACT  200

seq1  TATATTTATGCCACTTAGAAATGTGGTTTCCTAATCCCAGGACAGCCAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATTTATGCCACTTAGAAATGTGGTTTCCTAATCCCAGGACAGCCAGG  250

seq1  GCTATACAGAGAAACCCTGTCTCAAAAAAACCACAAAAGAAAGAAAGGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTATACAGAGAAACCCTGTCTCAAAAAAACCACAAAAGAAAGAAAGGAA  300

seq1  GGAAGGAAGGAAGGAAGGAAGGAAGGGAGAGAGAGAGAGAGAGAGAGAGA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGAAGGAAGGAAGGAAGGAAGGGAGAGAGAGAGAGAGAGAGAGAGA  350

seq1  GAGAGAGAGAGAGAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA  400
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  GAGAGAGAGAGAGAGAAAGAAAGATAGAAAGAAAGAAAGAAAGAAAGAAA  400

seq1  GAAAGAAAGAAAGAAAGAAAAGGAAGGTGGTTTCCAACCGGGTGGTGGTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAAAGAAAGAAAGAAAAGGAAGGTGGTTTCCAACCGGGTGGTGGTG  450

seq1  CACGCCTTTAATCCCAGCGCTCCAGAGGCAGAGGCAGGCAGATGTTTGAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGCCTTTAATCCCAGCGCTCCAGAGGCAGAGGCAGGCAGATGTTTGAG  500

seq1  AGATGGAGGACAGCCAGGTCTGCAGACTGAATTT  534
      |||||||||||||||||||||||| |||||||||
seq2  AGATGGAGGACAGCCAGGTCTGCATACTGAATTT  534

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information