MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-200F24
Chromosome	8 (Build37)
Map Location	88,037,706 - 88,038,814
singlet/doublet	singlet
Overlap gene	Gpt2
Upstream gene	Cacna1a, Ier2, LOC100039975, Btbd14b, Trmt1, LOC100039997, Lyl1, Nfix, Dand5, Gadd45gip1, Rad23a, Calr, LOC546080, Farsa, Syce2, Gcdh, Klf1, Dnase2a, Mast1, Rtbdn, Rnaseh2a, LOC666841, Prdx2, Junb, Hook2, Best2, Asna1, 2310036O22Rik, Tnpo2, Fbxw9, EG436049, Dhps, 1500041N16Rik, BC056474, Man2b1, EG244556, EG624855, Olfr371, Vps35, Orc6l, D830007F02Rik, 4921524J17Rik
Downstream gene	Dnaja2, Neto2, Itfg1, LOC100040798, Phkb, LOC671665, LOC100040165, Abcc12
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cacna1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12286 MGI:109482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ier2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15936 MGI:104815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039975 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Btbd14b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66830 MGI:1914080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212528 MGI:1289155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Lyl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17095 MGI:96891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfix (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18032 MGI:97311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dand5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23863 MGI:1344365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gadd45gip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102060 MGI:1914947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad23a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19358 MGI:105126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12317 MGI:88252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins pseudo : _no_value

name	Farsa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66590 MGI:1913840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syce2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71846 MGI:1919096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270076 MGI:104541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Klf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16596 MGI:1342771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13423 MGI:1329019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mast1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56527 MGI:1861901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtbdn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234542 MGI:2443686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnaseh2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69724 MGI:1916974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs

name	Prdx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21672 MGI:109486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Junb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16477 MGI:96647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hook2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170833 MGI:2181664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Best2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212989 MGI:2387588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56495 MGI:1928379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310036O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68544 MGI:1922833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnpo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212999 MGI:2384849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68628 MGI:1915878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436049 MGI:3645690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Dhps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330817 MGI:2683592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500041N16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67836 MGI:1915086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC056474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414077 MGI:3041257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17159 MGI:107286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG244556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244556 MGI:3648473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624855 MGI:3643620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258858 MGI:3030205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65114 MGI:1890467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Orc6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56452 MGI:1929285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D830007F02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213435 MGI:2443063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921524J17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66714 MGI:1913964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108682 MGI:1915391
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnaja2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56445 MGI:1931882
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Neto2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74513 MGI:1921763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itfg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71927 MGI:106419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040798 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 5 Proteins pseudo : _no_value

name	Phkb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102093 MGI:97578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040165 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Abcc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244562 MGI:2441679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174794 GeneID:12286 MGI:109482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, P/Q type, alpha 1A subunit transcript_id : NM_007578.3

name	Ier2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802849 GeneID:15936 MGI:104815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immediate early response 2 transcript_id : NM_010499.3

name	Btbd14b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543308 GeneID:66830 MGI:1914080
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 14B transcript_id : NM_025788.2

name	Trmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574125 GeneID:212528 MGI:1289155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) transcript_id : NM_198020.1

name	LOC100039997 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258964 GeneID:100039997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100039997 transcript_id : XM_001473917.1

name	Lyl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865988 GeneID:17095 MGI:96891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphoblastomic leukemia transcript_id : NM_008535.2

name	Nfix (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517470 GeneID:18032 MGI:97311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/X transcript_id : NM_010906.2

name	Nfix (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517486 GeneID:18032 MGI:97311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/X transcript_id : NM_001081982.1

name	Nfix (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517473 GeneID:18032 MGI:97311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/X transcript_id : NM_001081981.1

name	Dand5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742721 GeneID:23863 MGI:1344365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DAN domain family, member 5 transcript_id : NM_201227.2

name	Gadd45gip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387542 GeneID:102060 MGI:1914947
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest and DNA-damage-inducible, gamma interacting protein 1 transcript_id : NM_183358.3

name	Rad23a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368388 GeneID:19358 MGI:105126
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD23a homolog (S. cerevisiae) transcript_id : NM_009010.3

name	Calr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116875821 GeneID:12317 MGI:88252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calreticulin transcript_id : NM_007591.3

name	Farsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130298 GeneID:66590 MGI:1913840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phenylalanyl-tRNA synthetase, alpha subunit transcript_id : NM_025648.2

name	Syce2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366155 GeneID:71846 MGI:1919096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptonemal complex central element protein 2 transcript_id : NM_027954.2

name	Gcdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680426 GeneID:270076 MGI:104541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaryl-Coenzyme A dehydrogenase transcript_id : NM_001044744.1

name	Gcdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680424 GeneID:270076 MGI:104541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaryl-Coenzyme A dehydrogenase transcript_id : NM_008097.2

name	Klf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754453 GeneID:16596 MGI:1342771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 1 (erythroid) transcript_id : NM_010635.1

name	Dnase2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299638 GeneID:13423 MGI:1329019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease II alpha transcript_id : NM_010062.3

name	Mast1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628633 GeneID:56527 MGI:1861901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated serine/threonine kinase 1 transcript_id : NM_019945.2

name	Rtbdn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048290 GeneID:234542 MGI:2443686
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retbindin transcript_id : NM_144929.2

name	Rnaseh2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384190 GeneID:69724 MGI:1916974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease H2, large subunit transcript_id : NM_027187.3

name	LOC666841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258967 GeneID:666841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs product : hypothetical LOC666841 transcript_id : XM_986414.2

name	Prdx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383789 GeneID:21672 MGI:109486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxiredoxin 2 transcript_id : NM_011563.3

name	Junb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680511 GeneID:16477 MGI:96647
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Jun-B oncogene transcript_id : NM_008416.1

name	Hook2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875435 GeneID:170833 MGI:2181664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hook homolog 2 (Drosophila) transcript_id : NM_133255.1

name	Best2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350632 GeneID:212989 MGI:2387588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bestrophin 2 transcript_id : NM_145388.2

name	Asna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12025541 GeneID:56495 MGI:1928379
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arsA (bacterial) arsenite transporter, ATP-binding, homolog 1 transcript_id : NM_019652.1

name	2310036O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362707 GeneID:68544 MGI:1922833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310036O22 gene transcript_id : NM_026760.2

name	Tnpo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801768 GeneID:212999 MGI:2384849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transportin 2 (importin 3, karyopherin beta 2b) transcript_id : NM_145390.3

name	Fbxw9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248555 GeneID:68628 MGI:1915878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 9 transcript_id : NM_026791.2

name	EG436049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82918066 GeneID:436049 MGI:3645690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG436049 transcript_id : XM_488140.2

name	Dhps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87252719 GeneID:330817 MGI:2683592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyhypusine synthase transcript_id : NM_001039514.1

name	1500041N16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067129 GeneID:67836 MGI:1915086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500041N16 gene transcript_id : NM_026399.2

name	BC056474 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709456 GeneID:414077 MGI:3041257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC056474 transcript_id : NM_001001493.2

name	Man2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195689 GeneID:17159 MGI:107286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha B1 transcript_id : NM_010764.2

name	EG244556 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627692 GeneID:244556 MGI:3648473
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG244556 transcript_id : NM_001037745.1

name	EG624855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388245 GeneID:624855 MGI:3643620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG624855 transcript_id : NM_001037922.2

name	Olfr371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170061 GeneID:258858 MGI:3030205
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 371 transcript_id : NM_146859.1

name	Vps35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367507 GeneID:65114 MGI:1890467
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 35 transcript_id : NM_022997.3

name	Orc6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790136 GeneID:56452 MGI:1929285
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : origin recognition complex, subunit 6-like (S. cerevisiae) transcript_id : NM_019716.1

name	D830007F02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374524 GeneID:213435 MGI:2443063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D830007F02 gene transcript_id : NM_175441.4

name	4921524J17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386323 GeneID:66714 MGI:1913964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921524J17 gene transcript_id : NM_025722.2

name	Gpt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369119 GeneID:108682 MGI:1915391
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamic pyruvate transaminase (alanine aminotransferase) 2 transcript_id : NM_173866.2

name	Dnaja2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382324 GeneID:56445 MGI:1931882
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily A, member 2 transcript_id : NM_019794.2

name	Neto2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486762 GeneID:74513 MGI:1921763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuropilin (NRP) and tolloid (TLL)-like 2 transcript_id : NM_001081324.1

name	Itfg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802868 GeneID:71927 MGI:106419
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin alpha FG-GAP repeat containing 1 transcript_id : NM_028007.2

name	Phkb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789095 GeneID:102093 MGI:97578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase beta transcript_id : NM_199446.1

name	Abcc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129935 GeneID:244562 MGI:2441679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family C (CFTR/MRP), member 12 transcript_id : NM_172912.4

name	Cacna1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174795 GeneID:12286 MGI:109482
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : calcium channel, P/Q type, alpha 1A; P/Q-type calcium channel alpha1A subunit product : calcium channel, voltage-dependent, P/Q type, alpha 1A subunit protein_id : NP_031604.3

name	Ier2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542990 CCDS:CCDS22474.1 GeneID:15936 MGI:104815
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : immediate early response 2 protein_id : NP_034629.2

name	Btbd14b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543309 CCDS:CCDS22475.1 GeneID:66830 MGI:1914080
definition	codon_start : 1 exception : mismatches in translation product : transcriptional repressor NAC1 protein_id : NP_080064.2

name	Trmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574126 GeneID:212528 MGI:1289155
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004809 - tRNA (guanine-N2-)-methyltransferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TRM1 tRNA methyltransferase 1 homolog protein_id : NP_932137.1

name	LOC100039997 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258965 GeneID:100039997
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473967.1

name	Lyl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865989 CCDS:CCDS22476.1 GeneID:17095 MGI:96891
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : lymphoblastomic leukemia protein_id : NP_032561.2

name	Nfix (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517474 GeneID:18032 MGI:97311
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : nuclear factor I/X isoform 3 protein_id : NP_001075450.1

name	Nfix (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754838 GeneID:18032 MGI:97311
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : nuclear factor I/X isoform 2 protein_id : NP_035036.1

name	Nfix (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517487 GeneID:18032 MGI:97311
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : nuclear factor I/X isoform 1 protein_id : NP_001075451.1

name	Dand5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054862 CCDS:CCDS22477.1 GeneID:23863 MGI:1344365
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007368 - determination of left/right symmetry [Evidence IMP] [Evidence IGI]; GO:0030512 - negative regulation of transforming growth factor beta receptor signaling pathway [Evidence IGI]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 note : cerberus-like 2; dante product : DAN domain family, member 5 protein_id : NP_957679.1

name	Gadd45gip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254411 CCDS:CCDS22478.1 GeneID:102060 MGI:1914947
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : papillomavirus L2 interacting nuclear protein 1 protein_id : NP_899202.2

name	Rad23a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34447211 GeneID:19358 MGI:105126
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IGI] codon_start : 1 product : RAD23a homolog protein_id : NP_033036.2

name	Calr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680836 CCDS:CCDS22479.1 GeneID:12317 MGI:88252
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] [Evidence IEA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0040020 - regulation of meiosis [Evidence IDA] codon_start : 1 product : calreticulin protein_id : NP_031617.1

name	Farsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794462 CCDS:CCDS22480.1 GeneID:66590 MGI:1913840
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] codon_start : 1 product : phenylalanine-tRNA synthetase-like, alpha subunit protein_id : NP_079924.1

name	Syce2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313691 CCDS:CCDS22481.1 GeneID:71846 MGI:1919096
definition	GO_component : GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007130 - synaptonemal complex formation [Evidence IC] codon_start : 1 exception : mismatches in translation note : central element synaptonemal complex 1 product : synaptonemal complex central element protein 2 protein_id : NP_082230.1

name	Gcdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680427 GeneID:270076 MGI:104541
definition	EC_number : 1.3.99.7 GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004361 - glutaryl-CoA dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutaryl-Coenzyme A dehydrogenase protein_id : NP_001038209.1

name	Gcdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680425 CCDS:CCDS22482.1 GeneID:270076 MGI:104541
definition	EC_number : 1.3.99.7 GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004361 - glutaryl-CoA dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutaryl-Coenzyme A dehydrogenase protein_id : NP_032123.2

name	Klf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754454 CCDS:CCDS22483.1 GeneID:16596 MGI:1342771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0048821 - erythrocyte development [Evidence IMP]; GO:0043249 - erythrocyte maturation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Kruppel-like factor 1 (erythroid) protein_id : NP_034765.1

name	Dnase2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753654 CCDS:CCDS22484.1 GeneID:13423 MGI:1329019
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0004531 - deoxyribonuclease II activity [Evidence IDA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006308 - DNA catabolism [Evidence IMP]; GO:0006259 - DNA metabolism [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP] codon_start : 1 product : deoxyribonuclease II alpha protein_id : NP_034192.1

name	Mast1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628634 GeneID:56527 MGI:1861901
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 note : syntrophin-associated serine-threonine protein kinase; syntrophin associated serine/threonine kinase product : microtubule associated serine/threonine kinase 1 protein_id : NP_064329.2

name	Rtbdn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450337 CCDS:CCDS22485.1 GeneID:234542 MGI:2443686
definition	codon_start : 1 product : retbindin protein_id : NP_659178.1

name	Rnaseh2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037175 CCDS:CCDS22486.1 GeneID:69724 MGI:1916974
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0004523 - ribonuclease H activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016070 - RNA metabolism [Evidence IEA] codon_start : 1 product : ribonuclease H2, large subunit protein_id : NP_081463.1

name	LOC666841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94383713 GeneID:666841
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991508.1

name	Prdx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560539 GeneID:21672 MGI:109486
definition	GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence TAS]; GO:0051920 - peroxiredoxin activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence TAS]; GO:0008379 - thioredoxin peroxidase activity [Evidence TAS] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006800 - oxygen and reactive oxygen species metabolism [Evidence TAS]; GO:0006979 - response to oxidative stress [Evidence TAS] codon_start : 1 exception : unclassified translation discrepancy note : thioredoxin peroxidase 1; Prx II-1; thioredoxin reductase; Trx dependent peroxide reductase 1; thiol specific antioxidant protein; thioredoxin dependent peroxide reductase 1; protector protein; Calpromotin product : peroxiredoxin 2 protein_id : NP_035693.2

name	Junb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680512 CCDS:CCDS22488.1 GeneID:16477 MGI:96647
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Jun-B oncogene protein_id : NP_032442.1

name	Hook2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875436 CCDS:CCDS22489.1 GeneID:170833 MGI:2181664
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0008017 - microtubule binding [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hook homolog 2 protein_id : NP_573518.1

name	Best2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703776 GeneID:212989 MGI:2387588
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vitelliform macular dystrophy 2-like protein 1 protein_id : NP_663363.1

name	Asna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025542 GeneID:56495 MGI:1928379
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015446 - arsenite-transporting ATPase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0046685 - response to arsenic [Evidence IEA] codon_start : 1 function : catalytic subunit of arsenite extrusion pump function : resistance to As(III)/Sb(III) note : arsenite-translocating ATPase product : arsA (bacterial) arsenite transporter, ATP-binding, homolog 1 protein_id : NP_062626.1

name	2310036O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362708 CCDS:CCDS22490.1 GeneID:68544 MGI:1922833
definition	codon_start : 1 product : hypothetical protein LOC68544 protein_id : NP_081036.2

name	Tnpo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875502 CCDS:CCDS22491.1 GeneID:212999 MGI:2384849
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : karyopherin (importin) beta 2b protein_id : NP_663365.2

name	Fbxw9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248556 GeneID:68628 MGI:1915878
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : F-box and WD-40 domain protein 9 protein_id : NP_081067.2

name	EG436049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82918067 GeneID:436049 MGI:3645690
definition	codon_start : 1 product : similar to hCG1650801 protein_id : XP_488140.2

name	Dhps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87252720 CCDS:CCDS22492.1 GeneID:330817 MGI:2683592
definition	EC_number : 2.5.1.46 GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008612 - hypusine biosynthesis from peptidyl-lysine [Evidence IEA]; GO:0050983 - spermidine catabolism to deoxyhypusine, using deoxyhypusine synthase [Evidence ISS] codon_start : 1 product : deoxyhypusine synthase protein_id : NP_001034603.1

name	1500041N16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067130 CCDS:CCDS22493.1 GeneID:67836 MGI:1915086
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : MAPK cascade scaffold protein product : mitogen-activated protein kinase organizer 1 protein_id : NP_080675.2

name	BC056474 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47894404 GeneID:414077 MGI:3041257
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC414077 protein_id : NP_001001493.1

name	Man2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195690 CCDS:CCDS22494.1 GeneID:17159 MGI:107286
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IMP] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007611 - learning and/or memory [Evidence IMP]; GO:0006013 - mannose metabolism [Evidence IMP] [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : lysosomal alpha-mannosidase product : mannosidase 2, alpha B1 protein_id : NP_034894.2

name	EG244556 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627693 GeneID:244556 MGI:3648473
definition	codon_start : 1 product : zinc finger protein 791 protein_id : NP_001032834.1

name	EG624855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702318 GeneID:624855 MGI:3643620
definition	codon_start : 1 product : hypothetical protein LOC624855 protein_id : NP_001033011.1

name	Olfr371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170062 CCDS:CCDS22496.1 GeneID:258858 MGI:3030205
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NUPS-13298842-13299780; olfactory receptor MOR141-3 product : olfactory receptor 371 protein_id : NP_667070.1

name	Vps35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928670 GeneID:65114 MGI:1890467
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0045045 - secretory pathway [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0006624 - vacuolar protein processing or maturation [Evidence ISS] codon_start : 1 note : maternal embryonic message 3 product : vacuolar protein sorting 35 protein_id : NP_075373.1

name	Orc6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790137 CCDS:CCDS22497.1 GeneID:56452 MGI:1929285
definition	GO_component : GO:0005664 - nuclear origin of replication recognition complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 exception : mismatches in translation note : origin recognition complex subunit 6 product : origin recognition complex subunit 6-like protein_id : NP_062690.1

name	D830007F02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776559 GeneID:213435 MGI:2443063
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004687 - myosin light chain kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : myosin light chain kinase protein_id : NP_780650.2

name	4921524J17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385182 CCDS:CCDS22498.1 GeneID:66714 MGI:1913964
definition	codon_start : 1 product : hypothetical protein LOC66714 protein_id : NP_079998.1

name	Gpt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27805389 CCDS:CCDS22499.1 GeneID:108682 MGI:1915391
definition	GO_function : GO:0016847 - 1-aminocyclopropane-1-carboxylate synthase activity [Evidence IEA]; GO:0004021 - alanine transaminase activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : glutamic pyruvate transaminase (alanine aminotransferase) 2 protein_id : NP_776291.1

name	Dnaja2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789937 CCDS:CCDS22500.1 GeneID:56445 MGI:1931882
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : DNA J protein product : DnaJ (Hsp40) homolog, subfamily A, member 2 protein_id : NP_062768.1

name	Neto2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486763 GeneID:74513 MGI:1921763
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : brain-specific transmembrane protein product : neuropilin- and tolloid-like protein 2 protein_id : NP_001074793.1

name	Itfg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386278 GeneID:71927 MGI:106419
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : mismatches in translation product : T-cell immunomodulatory protein protein_id : NP_082283.1

name	Phkb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789096 CCDS:CCDS22501.1 GeneID:102093 MGI:97578
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 product : phosphorylase kinase beta protein_id : NP_955517.1

name	Abcc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52138554 CCDS:CCDS22502.1 GeneID:244562 MGI:2441679
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family C (CFTR/MRP), member 12 protein_id : NP_766500.3

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 1 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 2 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 3 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 4 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 5 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 6 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 7 pseudo : _no_value

name	LOC671665 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671665
definition	number : 1 pseudo : _no_value

name	LOC100040165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040165
definition	number : 3 pseudo : _no_value

name	LOC100040165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040165
definition	number : 2 pseudo : _no_value

name	LOC100040165 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040165
definition	number : 1 pseudo : _no_value

name	LOC546080 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258966 GeneID:546080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 pseudo : _no_value transcript_id : XR_031475.1

name	LOC100040798 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258979 GeneID:100040798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 5 Proteins product : similar to F1Fo-ATPase subunit e pseudo : _no_value transcript_id : XR_032558.1

clone name	MSMg01-516A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317I24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-491N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515M13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-136F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187O19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-501B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084H19
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-271G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-318O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-407D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-480P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-200F24.b	B6Ng01-200F24.g
ACC	GA021456	GA021457
length	289	1,110
definition	B6Ng01-200F24.b	B6Ng01-200F24.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	taacagtgggagctggggctgtttctgactcttgcctgctttgggaaatc ctttcctcctactagtctatgtaacttgttatgccatgtttggttgatgt ccctggaagacttgttctttcctgaagggaaacagagaagtggatctggg agagggacttggaagagaggtgggagaggaaactgtggatgggatataat atatgagagaagaataaataaattaataaaagagagagatagagagagag acagagagacgggagatctctttttttgctcataccgtt	gaattccactgctacacacaacgcacacttgaaaataaagacaaatttat gcttacccagggcttgggactcagcaatcactgcacatgaagacaccaaa gagacaaacatgaacagttgagagaataagagaaagtcatatatggcttt acaggggtcaggttacaccctgtttgaggagacataagacacagctttga tacaggtccagaaagctggaaggaagtgcctaagggccaaaccagaagat gggcaaaaggaattccctataaactgacagaaacatctgtgattacactt cctctctcctataacataccacagatgtcctatgaggacaccccagcagg agataagaggaatagccctggcccaacctccaggtgtaatgacatacacc tctaacacaagcatttgctatgctgaagcaggagggttgcaagttcgagg ccagcctaaggagggcttctaagtgaataagtaaaagagctgtcttatca gagtccgtagcccagagtcagtgagctcctgggctacggctctcagtgag atcacagaagatgtgttctaaggtttcatctgatgagcaatggctggagt tgctgaggccctccaaggacagattctaagaaggaacccaactcagagga cagcggagctgagaagcaaacacaataatgttgattcaggttactgcttt atgcccgggctccacagctccaccatacggtctttcagttttgagttgga ttttcgtcttgaaaccagaagcaccctggcttaacatctcaagtctcttt ggcatcttttaaccaagctggctatggtatgtggttggaaagtttccatt tcctatcacccaccctcttttagcagctgactgatttccatgcattaaga ccccagaaagcaaggaaagatgggttgcccacttaaaagtttatctcata aggatggactcatgaggccagacatggtgatgcatgactttagttccagc acttgggaggcagtgaagcagatgtctgtgagttcagccagcctgtcttg ccattagtaagtcaggacagtcaggagctatatagtaaaacctagtctca gagagacaga
quality values	Open. Hide. 62 62 62 44 31 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 59 62 62 62 56 49 46 33 33 56 54 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 54 49 54 62 54 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 49 54 62 62 62 62 62 59 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 49 49 54 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 54 54 62 59 59 59 62 62 62 59 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 59 51 43 59 43 51 23 29 25 50 43 29 28 40 28 34 24 38 30 22 24 27 19 35 22 32 30 50 38 38 26 17 30 23 13 29 19 17 14 16 11 24 20 11 15 22 16 16 14 10 11 13 10 18 11 11 8 10 10 10 10 10 10 11 10 11 10 10 13 9 14 10 10 7 12 9 6 6 6 6	Open. Hide. 62 47 51 47 62 62 44 32 49 54 47 38 24 27 38 25 35 35 46 46 59 62 59 59 62 62 62 59 62 62 33 26 49 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 59 56 59 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 59 54 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 56 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 54 58 58 54 54 58 52 54 54 54 54 52 58 54 54 58 58 54 41 54 41 58 58 58 54 58 58 58 58 54 54 54 52 54 58 58 58 58 58 52 52 48 58 58 58 54 58 54 54 50 58 58 58 54 46 42 54 52 54 54 52 58 58 50 45 26 58 51 58 51 58 51 53 58 50 42 38 37 58 58 49 50 49 54 58 58 51 49 58 58 35 51 50 58 51 58 58 50 58 58 58 44 47 58 58 54 58 58 58 32 16 36 40 49 50 53 41 48 46 50 50 58 37 46 50 51 41 27 51 54 53 50 58 53 58 41 29 58 51 40 40 44 44 50 44 44 51 52 52 40 58 21 58 41 40 52 47 51 41 58 32 17 49 51 41 41 14 58 54 32 51 39 53 53 51 50 51 50 41 40 50 54 49 54 33 49 49 35 22 54 38 32 27 54 39 41 31 49 42 54 42 49 54 51 53 53 53 49 35 44 34 34 26 44 53 37 47 31 52 39 34 38 44 40 49 19 28 25 35 45 42 42 26 51 32 39 26 54 54 37 42 34 41 51 54 54 40 30 30 32 33 42 32 31 23 54 53 33 39 40 32 52 32 52 52 41 53 40 20 31 31 32 51 51 28 45 40 40 47 47 31 33 24 29 47 36 27 22 31 25 47 52 35 31 35 23 45 30 27 30 30 40 46 27 15 27 21 25 30 31 32 51 51 31 31 33 37 21 8 51 31 37 33 27 46 28 36 31 39 42 51 23 25 25 43 34 32 32 24 31 41 37 30 46 33 32 27 38 31 31 32 31 31 48 30 25 41 28 30 30 32 23 31 46 22 23 29 46 33 27 31 34 46 46 35 32 27 38 34 32 38 31 26 31 25 32 32 22 9 22 25 22 31 22 24 25 27 23 30 24 30 30 13 17 12 14 31 16 24 16 31 46 23 31 31 25 8 27 30 13 44 36 28 15 18 19 31 21 16 20 26 29 28 13 7 12 11 19 18 38 43 19 9 17 38 9 32 29 31 25 34 29 9 6 11 6 24 10 14 9 15 33 14 23 31 24 25 29 28 8 25 9 16 23 24 30 17 22 32 17 26 5 14 21 31 31 30 31 33 34 33 9 16 31 33 10 7 9 5 17 14 8 9 11 20 32 26 19 13 26 9 5 6 33 17 13 6 5 5 8 14 8 28 14 6 21 12 10 11 10 27 27 15 13 16 7 25 13 7 8 5 3 8 16 11 15 7 7 8 3 5 8 5 6 6 18 7 15 10 10 26 18 13 26 6 8 9 3 9 13 6 4 5 6 6 12 8 8 8 25 7 21 7 3 4 5 10 6 6 22 16 7 5 9 7 14 18 19 18 19 16 20 8 5 5 18 5 4 4 7 6 3 6 13

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_88037706_88038814
seq2: B6Ng01-200F24.g_64_1173 (reverse)

seq1  TCTGTCTCTCTGAGACTAGGTCTTACTATATAGCT-CTGACTGTCCTGGA  49
      ||||||||||||||||||||| ||||||||||||| ||||||||||||  
seq2  TCTGTCTCTCTGAGACTAGGTTTTACTATATAGCTCCTGACTGTCCTG--  48

seq1  ACTTACTA--TGCAGACCAGGCTGGCCTTGAACTCACAGACATCTGCTTC  97
      ||||||||   |||   |||||||||  ||||||||||||||||||||||
seq2  ACTTACTAATGGCAAGACAGGCTGGC--TGAACTCACAGACATCTGCTTC  96

seq1  ACTGCCTCCCAAGTGCTGGAACTAAAGTCATGCATCACCATGTCTGGCCT  147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCCTCCCAAGTGCTGGAACTAAAGTCATGCATCACCATGTCTGGCCT  146

seq1  CATGAGT-CATCCTTATGAGATTAACTTTTAAGTGGGCAA-CCATCTTTC  195
      ||||||| |||||||||||||| ||||||||||||||||| |||||||||
seq2  CATGAGTCCATCCTTATGAGATAAACTTTTAAGTGGGCAACCCATCTTTC  196

seq1  CTTGCTTTCTGGGGTCTTAATGCATGGAAATCAGTCAGCTGCTAAAAGAG  245
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGCTTTCTGGGGTCTTAATGCATGGAAATCAGTCAGCTGCTAAAAGAG  246

seq1  GGTGGGTGATAGGAAATGGAAACTTTCCAACCACATACCATAGCCAGCTT  295
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGGTGATAGGAAATGGAAACTTTCCAACCACATACCATAGCCAGCTT  296

seq1  GGTTAAAAGATGCCAAAGAGACTTGAGATGTTAAGCCAGGGTGCTTCTGG  345
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTAAAAGATGCCAAAGAGACTTGAGATGTTAAGCCAGGGTGCTTCTGG  346

seq1  TTTCAAGACGAAAATCCAACTCAAAACTGAAAGACCGTATGGTGGAGCTG  395
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAAGACGAAAATCCAACTCAAAACTGAAAGACCGTATGGTGGAGCTG  396

seq1  TGGAGCCCGGGCATAAAGCAGTAACCTGAATCAACATTATTGTGTTTGCT  445
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGCCCGGGCATAAAGCAGTAACCTGAATCAACATTATTGTGTTTGCT  446

seq1  TCTCAGCTCCGCTGTCCTCTGAGTTGGGTTCCTTCTTAGAATCTGTCCTT  495
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAGCTCCGCTGTCCTCTGAGTTGGGTTCCTTCTTAGAATCTGTCCTT  496

seq1  GGAGGGCCTCAGCAACTCCAGCCATTGCTCATCAGATGAAACCTTAGAAC  545
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGGCCTCAGCAACTCCAGCCATTGCTCATCAGATGAAACCTTAGAAC  546

seq1  ACATCTTCTGTGATCTCACTGAGAGCCGTAGCCCAGGAGCTCACTGACTC  595
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCTTCTGTGATCTCACTGAGAGCCGTAGCCCAGGAGCTCACTGACTC  596

seq1  TGGGCTACGGACTCTGATAAGACAGCTCTTTTACTTATTCACTTAGAAGC  645
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTACGGACTCTGATAAGACAGCTCTTTTACTTATTCACTTAGAAGC  646

seq1  CCTCCTTAGGCTGGCCTCGAACTTGCAACCCTCCTGCTTCAGCATAGCAA  695
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTTAGGCTGGCCTCGAACTTGCAACCCTCCTGCTTCAGCATAGCAA  696

seq1  ATGCTTGTGTTAGAGGTGTATGTCATTACACCTGGAGGTTGGGCCAGGGC  745
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTTGTGTTAGAGGTGTATGTCATTACACCTGGAGGTTGGGCCAGGGC  746

seq1  TATTCCTCTTATCTCCTGCTGGGGTGTCCTCATAGGACATCTGTGGTATG  795
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCCTCTTATCTCCTGCTGGGGTGTCCTCATAGGACATCTGTGGTATG  796

seq1  TTATAGGAGAGAGGAAGTGTAATCACAGATGTTTCTGTCAGTTTATAGGG  845
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAGGAGAGAGGAAGTGTAATCACAGATGTTTCTGTCAGTTTATAGGG  846

seq1  AATTCCTTTTGCCCATCTTCTGGTTTGGCCCTTAGGCACTTCCTTCCAGC  895
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCCTTTTGCCCATCTTCTGGTTTGGCCCTTAGGCACTTCCTTCCAGC  896

seq1  TTTCTGGACCTGTATCAAAGCTGTGTCTTATGTCTCCTCAAACAGGGTGT  945
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTGGACCTGTATCAAAGCTGTGTCTTATGTCTCCTCAAACAGGGTGT  946

seq1  AACCTGACCCCTGTAAAGCCATATATGACTTTCTCTTATTCTCTCAACTG  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCTGACCCCTGTAAAGCCATATATGACTTTCTCTTATTCTCTCAACTG  996

seq1  TTCATGTTTGTCTCTTTGGTGTCTTCATGTGCAGTGATTGCTGAGTCCCA  1045
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCATGTTTGTCTCTTTGGTGTCTTCATGTGCAGTGATTGCTGAGTCCCA  1046

seq1  AGCCCTGGGTAAGCATAAATTTGTCTTTATTTTCAAGTGTGCGTTGTGTG  1095
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCTGGGTAAGCATAAATTTGTCTTTATTTTCAAGTGTGCGTTGTGTG  1096

seq1  TAGCAGTGGAATTC  1109
      ||||||||||||||
seq2  TAGCAGTGGAATTC  1110

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information