MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-214N01
Chromosome	8 (Build37)
Map Location	27,426,401 - 27,588,744
singlet/doublet	doublet
Overlap gene	none
Upstream gene	LOC670822, LOC100040998, Fgfr1, D030041N04Rik, LOC100042416, Whsc1l1, Ppapdc1, Bag4, Lsm1, Star, Ash2l, Kcnu1, Hgsnat, 4930444A02Rik, Fnta, Hook3, 1700047A11Rik, Rnf170, Thap1
Downstream gene	Zfp703, Erlin2, Prosc, Gpr124, Brf2, Rab11fip1, Got1l1, Adrb3, Eif4ebp1, LOC732482, Tex24, Chrnb3, Chrna6, 4921537P18Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC670822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 2 Proteins

name	Fgfr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	D030041N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270035 MGI:2444979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs

name	Whsc1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234135 MGI:2142581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppapdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71910 MGI:1919160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bag4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67384 MGI:1914634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67207 MGI:1914457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Star (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20845 MGI:102760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ash2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23808 MGI:1344416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kcnu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16532 MGI:1202300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgsnat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52120 MGI:1196297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930444A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74653 MGI:1921903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fnta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14272 MGI:104683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hook3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320191 MGI:2443554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700047A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76604 MGI:1923854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rnf170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77733 MGI:1924983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73754 MGI:1921004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp703 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353310 MGI:2662729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs, 4 Proteins

name	Erlin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244373 MGI:2387215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prosc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114863 MGI:1891207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Gpr124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78560 MGI:1925810
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66653 MGI:1913903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab11fip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75767 MGI:1923017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Got1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76615 MGI:1923865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adrb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11556 MGI:87939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eif4ebp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13685 MGI:103267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC732482 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:732482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Tex24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:541463 MGI:1921539
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Chrnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108043 MGI:106212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Chrna6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11440 MGI:106213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921537P18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70952 MGI:1918202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258527 GeneID:100040998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 2 Proteins product : hypothetical protein LOC100040998 transcript_id : XM_001475629.1

name	Fgfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952640 GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 1 transcript_id : NM_010206.2

name	Fgfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952697 GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 1 transcript_id : NM_001079908.1

name	Fgfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952632 GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 1 transcript_id : NM_001079909.1

name	D030041N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345806 GeneID:270035 MGI:2444979
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030041N04 gene transcript_id : NM_173012.2

name	LOC100042416 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258565 GeneID:100042416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs product : hypothetical protein LOC100042416 transcript_id : XM_001478167.1

name	Whsc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48958536 GeneID:234135 MGI:2142581
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 1-like 1 (human) transcript_id : NM_001001735.1

name	Whsc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486902 GeneID:234135 MGI:2142581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 1-like 1 (human) transcript_id : NM_001081269.1

name	Ppapdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487351 GeneID:71910 MGI:1919160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidic acid phosphatase type 2 domain containing 1 transcript_id : NM_028000.1

name	Bag4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686110 GeneID:67384 MGI:1914634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-associated athanogene 4 transcript_id : NM_026121.3

name	Lsm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625666 GeneID:67207 MGI:1914457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_026032.1

name	Star (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130138 GeneID:20845 MGI:102760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : steroidogenic acute regulatory protein transcript_id : NM_011485.4

name	Ash2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248549 GeneID:23808 MGI:1344416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ash2 (absent, small, or homeotic)-like (Drosophila) transcript_id : NM_001080793.1

name	Ash2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248551 GeneID:23808 MGI:1344416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ash2 (absent, small, or homeotic)-like (Drosophila) transcript_id : NM_011791.2

name	Kcnu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300927 GeneID:16532 MGI:1202300
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily U, member 1 transcript_id : NM_008432.3

name	Hgsnat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292432 GeneID:52120 MGI:1196297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan-alpha-glucosaminide N-acetyltransferase transcript_id : NM_029884.1

name	4930444A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372410 GeneID:74653 MGI:1921903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930444A02 gene transcript_id : NM_029037.3

name	Fnta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803059 GeneID:14272 MGI:104683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : farnesyltransferase, CAAX box, alpha transcript_id : NM_008033.3

name	Hook3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131070 GeneID:320191 MGI:2443554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hook homolog 3 (Drosophila) transcript_id : NM_207659.2

name	1700047A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258567 GeneID:76604 MGI:1923854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700047A11 gene transcript_id : XM_001478344.1

name	Rnf170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186462 GeneID:77733 MGI:1924983
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 170 transcript_id : NM_029965.2

name	Thap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40068501 GeneID:73754 MGI:1921004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing, apoptosis associated protein 1 transcript_id : NM_199042.1

name	Zfp703 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258569 GeneID:353310 MGI:2662729
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs, 4 Proteins product : zinc finger protein 703 transcript_id : XM_001478406.1

name	Erlin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956395 GeneID:244373 MGI:2387215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ER lipid raft associated 2 transcript_id : NM_153592.1

name	Prosc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119829185 GeneID:114863 MGI:1891207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline synthetase co-transcribed transcript_id : NM_054057.4

name	Prosc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119829188 GeneID:114863 MGI:1891207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline synthetase co-transcribed transcript_id : NM_001039077.2

name	Prosc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119829189 GeneID:114863 MGI:1891207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proline synthetase co-transcribed transcript_id : NM_001039078.2

name	Gpr124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905078 GeneID:78560 MGI:1925810
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 124 transcript_id : NM_054044.1

name	Brf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347833 GeneID:66653 MGI:1913903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BRF2, subunit of RNA polymerase III transcription initiation factor, BRF1-like transcript_id : NM_025686.2

name	Rab11fip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249096 GeneID:75767 MGI:1923017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11 family interacting protein 1 (class I) transcript_id : NM_001080813.1

name	Got1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037452 GeneID:76615 MGI:1923865
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamic-oxaloacetic transaminase 1-like 1 transcript_id : NM_029674.1

name	Adrb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891719 GeneID:11556 MGI:87939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenergic receptor, beta 3 transcript_id : NM_013462.3

name	Eif4ebp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937367 GeneID:13685 MGI:103267
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 4E binding protein 1 transcript_id : NM_007918.3

name	Tex24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61888893 GeneID:541463 MGI:1921539
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 24 transcript_id : NM_001013609.1

name	Chrnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801755 GeneID:108043 MGI:106212
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 3 transcript_id : NM_173212.2

name	Chrnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381612 GeneID:108043 MGI:106212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, beta polypeptide 3 transcript_id : NM_027454.2

name	Chrna6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542394 GeneID:11440 MGI:106213
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholinergic receptor, nicotinic, alpha polypeptide 6 transcript_id : NM_021369.2

name	4921537P18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374195 GeneID:70952 MGI:1918202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921537P18 gene transcript_id : NM_026256.2

name	LOC100040998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258528 GeneID:100040998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475679.1

name	Fgfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952641 GeneID:14182 MGI:95522
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence TAS]; GO:0008201 - heparin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IGI]; GO:0001759 - induction of an organ [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IGI] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0002053 - positive regulation of mesenchymal cell proliferation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007435 - salivary gland morphogenesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : fibroblast growth factor receptor 1 isoform 1 protein_id : NP_034336.2

name	Fgfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952698 GeneID:14182 MGI:95522
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence TAS]; GO:0008201 - heparin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IGI]; GO:0001759 - induction of an organ [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IGI] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0002053 - positive regulation of mesenchymal cell proliferation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007435 - salivary gland morphogenesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : fibroblast growth factor receptor 1 isoform 2 protein_id : NP_001073377.1

name	Fgfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952633 GeneID:14182 MGI:95522
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence TAS]; GO:0008201 - heparin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IGI]; GO:0001759 - induction of an organ [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IGI] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0002053 - positive regulation of mesenchymal cell proliferation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007435 - salivary gland morphogenesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : fibroblast growth factor receptor 1 isoform 3 protein_id : NP_001073378.1

name	D030041N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370518 GeneID:270035 MGI:2444979
definition	codon_start : 1 product : hypothetical protein LOC270035 protein_id : NP_766600.1

name	LOC100042416 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258566 GeneID:100042416
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478217.1

name	Whsc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486903 GeneID:234135 MGI:2142581
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Wolf-Hirschhorn syndrome candidate 1-like 1 product : Wolf-Hirschhorn syndrome candidate 1-like 1 isoform 2 protein_id : NP_001074738.1

name	Whsc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48958537 GeneID:234135 MGI:2142581
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Wolf-Hirschhorn syndrome candidate 1-like 1 product : Wolf-Hirschhorn syndrome candidate 1-like 1 isoform 1 protein_id : NP_001001735.1

name	Ppapdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487352 GeneID:71910 MGI:1919160
definition	codon_start : 1 product : phosphatidic acid phosphatase type 2 domain containing 1 protein_id : NP_082276.1

name	Bag4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17975504 CCDS:CCDS22201.1 GeneID:67384 MGI:1914634
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : BCL2-associated athanogene 4 protein_id : NP_080397.1

name	Lsm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625667 CCDS:CCDS22202.1 GeneID:67207 MGI:1914457
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : LSM1 homolog, U6 small nuclear RNA associated protein_id : NP_080308.1

name	Star (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543776 CCDS:CCDS22203.1 GeneID:20845 MGI:102760
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0015485 - cholesterol binding [Evidence IEA]; GO:0017127 - cholesterol transporter activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0044255 - cellular lipid metabolism [Evidence IMP]; GO:0008211 - glucocorticoid metabolism [Evidence IMP]; GO:0006869 - lipid transport [Evidence IEA]; GO:0050810 - regulation of steroid biosynthesis [Evidence IDA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : steroidogenic acute regulatory protein protein_id : NP_035615.2

name	Ash2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248552 GeneID:23808 MGI:1344416
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030097 - hemopoiesis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : ash2-like isoform a protein_id : NP_035921.2

name	Ash2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248550 GeneID:23808 MGI:1344416
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030097 - hemopoiesis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : ash2-like isoform b protein_id : NP_001074262.1

name	Kcnu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300928 GeneID:16532 MGI:1202300
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 note : potassium large conductance pH-sensitive channel, subfamily M, alpha member 3 product : potassium channel, subfamily U, member 1 protein_id : NP_032458.3

name	Hgsnat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115292433 GeneID:52120 MGI:1196297
definition	codon_start : 1 product : heparan-alpha-glucosaminide N-acetyltransferase protein_id : NP_084160.1

name	4930444A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312828 CCDS:CCDS22204.1 GeneID:74653 MGI:1921903
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74653 protein_id : NP_083313.1

name	Fnta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679821 CCDS:CCDS22205.1 GeneID:14272 MGI:104683
definition	GO_function : GO:0030548 - acetylcholine receptor regulator activity [Evidence IMP]; GO:0004662 - CAAX-protein geranylgeranyltransferase activity [Evidence IEA]; GO:0004659 - prenyltransferase activity [Evidence IEA]; GO:0004660 - protein farnesyltransferase activity [Evidence IEA]; GO:0008318 - protein prenyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045213 - neurotransmitter receptor metabolism [Evidence IMP]; GO:0018346 - protein amino acid prenylation [Evidence IEA] codon_start : 1 product : farnesyltransferase, CAAX box, alpha protein_id : NP_032059.1

name	Hook3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559745 CCDS:CCDS22206.1 GeneID:320191 MGI:2443554
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0008017 - microtubule binding [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : hook homolog 3 protein_id : NP_997542.1

name	1700047A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258568 GeneID:76604 MGI:1923854
definition	codon_start : 1 product : hypothetical protein LOC76604 protein_id : XP_001478394.1

name	Rnf170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037503 CCDS:CCDS22207.1 GeneID:77733 MGI:1924983
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 170 protein_id : NP_084241.1

name	Thap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068502 CCDS:CCDS22208.1 GeneID:73754 MGI:1921004
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : THAP domain containing, apoptosis associated protein 1 protein_id : NP_950243.1

name	Zfp703 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258570 GeneID:353310 MGI:2662729
definition	codon_start : 1 product : ES neuronal differentiation 2 protein_id : XP_001478456.1

name	Erlin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956396 CCDS:CCDS22209.1 GeneID:244373 MGI:2387215
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : SPFH domain family, member 2 protein_id : NP_705820.1

name	Prosc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16930823 GeneID:114863 MGI:1891207
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : proline synthetase co-transcribed isoform a protein_id : NP_473398.1

name	Prosc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872182 GeneID:114863 MGI:1891207
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : proline synthetase co-transcribed isoform b protein_id : NP_001034166.1

name	Prosc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84872187 GeneID:114863 MGI:1891207
definition	codon_start : 1 note : isoform c is encoded by transcript variant 3 product : proline synthetase co-transcribed isoform c protein_id : NP_001034167.1

name	Gpr124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905079 CCDS:CCDS22210.1 GeneID:78560 MGI:1925810
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : G protein-coupled receptor 124 protein_id : NP_473385.1

name	Brf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076877 CCDS:CCDS22211.1 GeneID:66653 MGI:1913903
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003702 - RNA polymerase II transcription factor activity [Evidence IEA]; GO:0003743 - translation initiation factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 product : RNA polymerase III transcription initiation factor BRF2 protein_id : NP_079962.1

name	Rab11fip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249097 GeneID:75767 MGI:1923017
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Rab coupling protein product : RAB11 family interacting protein 1 protein_id : NP_001074282.1

name	Got1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037453 CCDS:CCDS22212.1 GeneID:76615 MGI:1923865
definition	GO_function : GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : glutamic-oxaloacetic transaminase 1-like 1 protein_id : NP_083950.1

name	Adrb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861166 CCDS:CCDS22213.1 GeneID:11556 MGI:87939
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0043235 - receptor complex [Evidence ISS] GO_function : GO:0031699 - beta-3 adrenergic receptor binding [Evidence IDA]; GO:0004939 - beta-adrenergic receptor activity [Evidence IEA]; GO:0015052 - beta3-adrenergic receptor activity [Evidence ISS]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0051380 - norepinephrine binding [Evidence ISS]; GO:0042803 - protein homodimerization activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007190 - adenylate cyclase activation [Evidence ISS]; GO:0050873 - brown fat cell differentiation [Evidence IGI]; GO:0002024 - diet induced thermogenesis [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IDA]; GO:0031649 - heat generation [Evidence IGI]; GO:0040015 - negative regulation of body size [Evidence IGI]; GO:0002025 - norepinephrine-epinephrine vasodilation during regulation of blood pressure [Evidence IDA]; GO:0043410 - positive regulation of MAPKKK cascade [Evidence ISS]; GO:0009409 - response to cold [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Beta-3 AR; beta 3-AR; Beta-3 adrenoceptor; beta3-adrenergic receptor product : adrenergic receptor, beta 3 protein_id : NP_038490.2

name	Eif4ebp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:122937368 CCDS:CCDS22214.1 GeneID:13685 MGI:103267
definition	GO_component : GO:0005737 - cytoplasm [Evidence IC] GO_function : GO:0008190 - eukaryotic initiation factor 4E binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0003743 - translation initiation factor activity [Evidence IEA]; GO:0030371 - translation repressor activity [Evidence TAS] GO_process : GO:0008286 - insulin receptor signaling pathway [Evidence IDA]; GO:0017148 - negative regulation of protein biosynthesis [Evidence IEA]; GO:0045947 - negative regulation of translational initiation [Evidence IDA]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0006446 - regulation of translational initiation [Evidence TAS] codon_start : 1 product : eukaryotic translation initiation factor 4E binding protein 1 protein_id : NP_031944.3

name	Tex24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61888894 CCDS:CCDS22215.1 GeneID:541463 MGI:1921539
definition	codon_start : 1 note : testis-specific protein product : testis-specific factor 1 protein_id : NP_001013627.1

name	Chrnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532980 CCDS:CCDS22217.1 GeneID:108043 MGI:106212
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : cholinergic receptor, nicotinic, beta polypeptide 3 isoform 1 protein_id : NP_775304.1

name	Chrnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27532978 CCDS:CCDS22216.1 GeneID:108043 MGI:106212
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : cholinergic receptor, nicotinic, beta polypeptide 3 isoform 2 protein_id : NP_081730.1

name	Chrna6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542395 GeneID:11440 MGI:106213
definition	GO_component : GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007271 - synaptic transmission, cholinergic [Evidence IEA] codon_start : 1 note : nicotinic acetylcholine receptor subunit alpha 6; acetylcholine receptor alpha 6 neural; alpha6 nAChR product : cholinergic receptor, nicotinic, alpha polypeptide 6 protein_id : NP_067344.2

name	4921537P18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229050 GeneID:70952 MGI:1918202
definition	codon_start : 1 product : hypothetical protein LOC70952 protein_id : NP_080532.1

name	LOC670822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670822
definition	number : 1 pseudo : _no_value

name	LOC670822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670822
definition	number : 2 pseudo : _no_value

name	LOC732482 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:110835698 GeneID:732482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fam58a pseudogene pseudo : _no_value transcript_id : NR_003107.1

clone name	MSMg01-493K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-448N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-150A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-135B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316A15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462B10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-476G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202H11
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-214N01.b	B6Ng01-214N01.g
ACC	GA031961	GA031962
length	1,103	510
definition	B6Ng01-214N01.b	B6Ng01-214N01.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(27,587,644 - 27,588,744)	(27,426,401 - 27,426,916)
sequence	gaattccagcacccactgcctgggaaagtacctaacttgcattttctttg gttaccattagtaacatggactcaaacagttaagaaataccccatctcat cttttggtagcagcagtagctgaaaaggtctcccttcctcgggctgaaac ctgtctgcctatagtgtctactagttcctggatcgatttcctgtagccct attcttccactgaaggcagagcgtggcatttagcattcttctttccttat cctgctgacagctcctcaaggaagatgtgctgcccgcctcctctgctttg tgtcttaccgatgggagcacccaagcttggtgaagttcagtccttggcaa aggctcagagctggggtgtggcagcttcccttccttttagtttctgaggt actgcttggtcttcttcagtgagtctgggctgatctcccttcccatgatt atctccatgaacaatagaaatcgtctccaaagagccatattgccctgccc cacccagttctcagcaagtgatgctttcctgcagtttgaccgtcttgtgt ctcagttttccagctcccaacaaaaaacagcgctggagatttcagcatct ccacctccccaggaggcattgtgatttcccagcccattacttacacagtg ctatagccaggcctttattatccttctctgttttgtacctccctggacac aggagaacgtgggtgtggtctgttcaccccacctgcttgagcatgttagg aggtaaagcatgcagaggtgcgatggttattttttcttgtctctgtggta gaaggcagattggagtagaaagcctcttctttagctcactgcctcaaaaa gattggttccatggtaaactgtcttcatgctcttcagcaaaccgccgtgg ccagtgggagtaacggaagaggagattctcacctcatggacaagaagctg agggtacgtcagaaagaggcctgggatgatacgtcctcatggacccatcc ttagtacttgctttctttcatcaaagtctctctaagttccagaaccttca aagggttcaccagctgcaatctcagagttctaccaattgaatgtatggga ctc	aattagcaagtgcagcacaggaagtggaccctcacgagaacattgcacac agatgaagaatgtctgcctttataaggcaagccagtgactggggaggatg ggatggcttcggggcatcacttagcccatatttggaggctttgtctccag atttgtgttcctgtggccaggcatgctaatgctaaaggaagggtagtctt ctccatcatcatcatcatcaccatcatcatcatcatcatcacacttgcag tatcctaagtgagagtatgacttgtcatcagagggcggctcagggatcgc tatgaatatgcatacacatatacagttatatatggcatgttaattttgtt tgaagcttagagaatcaacttctttcttatttgaaaggcacagaggcttt gcctgccaacttccagcattacaaaaatctcaacacgatctgtttgtgtg agtgcatgcacatgtgcgtgcctgattgtgtgtatatgtgtgtgtgtatg tgtgagagag
quality values	Open. Hide. 58 33 46 35 58 58 31 19 58 54 52 62 62 38 35 62 62 62 62 62 62 62 62 62 47 62 62 62 62 56 54 62 38 38 38 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 33 49 59 62 62 59 59 62 59 59 62 59 62 62 62 59 62 62 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 43 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 54 58 58 58 47 58 54 41 58 54 54 58 58 58 58 58 54 58 58 58 58 58 58 54 58 54 42 45 40 58 58 54 54 52 58 52 58 58 58 49 58 40 58 58 58 48 58 39 39 49 53 58 42 26 58 52 53 53 58 51 51 58 42 38 58 58 50 58 47 43 51 51 58 42 41 58 49 49 49 58 51 50 49 50 58 53 54 51 58 54 54 37 53 52 53 54 54 39 58 51 50 58 58 58 51 53 53 47 54 53 58 51 51 51 53 53 53 51 58 42 58 58 53 58 31 38 52 58 41 39 58 58 50 51 58 28 28 41 52 40 39 58 32 22 58 54 40 50 53 54 58 58 51 54 51 58 39 33 53 53 54 54 53 42 40 35 44 46 42 32 37 49 44 49 52 54 54 50 51 31 49 30 36 53 38 35 44 41 44 49 25 51 32 45 54 40 42 52 37 45 53 33 33 23 37 22 47 32 45 31 30 28 28 52 42 26 34 39 28 54 54 54 54 32 40 40 40 49 31 53 39 42 45 53 31 28 47 32 45 33 53 53 32 46 23 32 26 31 18 41 45 24 35 13 35 35 6 24 30 32 29 30 32 35 12 6 16 31 37 51 14 17 20 30 30 21 26 35 42 42 29 40 24 31 29 51 47 46 41 22 27 13 46 45 14 6 21 12 20 24 29 32 46 24 46 46 21 21 31 42 23 31 42 26 36 18 33 43 32 26 31 42 34 36 31 21 32 27 28 31 25 36 19 6 25 13 27 24 33 7 13 31 24 16 38 46 28 27 17 32 28 24 17 32 15 9 30 16 32 10 23 27 10 27 10 38 31 25 29 22 16 30 35 31 22 25 32 36 25 32 18 24 21 23 24 18 30 37 27 31 8 28 11 29 19 27 10 9 19 15 13 44 41 31 18 35 16 30 25 19 31 31 28 24 21 24 28 29 15 31 26 31 29 14 19 10 20 12 13 22 19 5 11 36 32 33 34 15 14 14 19 32 17 23 31 14 17 15 28 24 14 33 20 14 25 29 20 29 15 19 20 15 27 21 6 5 21 6 5 14 4 6 11 22 10 21 16 9 4 11 10 20 19 13 10 28 7 20 7 40 23 9 29 7 18 10 9 9 6 6 10 13 16 28 8 5 3 3 4 5 4 6 21 12 13 11 13 6 25 6 16 13 22 7 9 22 10 19 8 6 2 2 5 8 8 17 26 5 13 6 6 9	Open. Hide. 43 59 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 54 59 62 62 62 62 59 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 54 42 49 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 50 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 56 62 62 62 62 62 62 56 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 52 52 46 38 43 43 38 52 52 62 54 62 62 62 62 62 54 46 62 62 62 62 54 62 62 62 62 62 62 54 54 58 58 54 52 52 52 47 40 47 52 52 30 33 28 33 28 10 14 9 12 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_27587644_27588744
seq2: B6Ng01-214N01.b_47_1149 (reverse)

seq1  GAGTCCCATACACTCAA-TGGTAGGACTCTTGATA-TGCAGCTGGTGAAC  48
      |||||||||||| |||| |||||| |||| ||| | ||||||||||||||
seq2  GAGTCCCATACATTCAATTGGTAGAACTC-TGAGATTGCAGCTGGTGAAC  49

seq1  CTTTGGAAGGTTCTGGAAACTTTAGAG-GGCTTTGATGAAAG-AAGCAAG  96
      | || |||||||||||||   |||||| | |||||||||||| |||||||
seq2  CCTTTGAAGGTTCTGGAA--CTTAGAGAGACTTTGATGAAAGAAAGCAAG  97

seq1  TTACTAAGGATGGGTCCATGAGGACGTATCATCCCAGGCCTCTTTCTGGC  146
       ||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  -TACTAAGGATGGGTCCATGAGGACGTATCATCCCAGGCCTCTTTCTGAC  146

seq1  GTACCCTCAGCTTCTTGTCCATGAGGTGAGAATCTCCTCTTCCCGTTACT  196
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  GTACCCTCAGCTTCTTGTCCATGAGGTGAGAATCTCCTCTT-CCGTTACT  195

seq1  CCCACT-GCCACGGCGGTTTGCTGAAGAGCATGAAGACAGTTTACCATGG  245
      |||||| |||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACTGGCCACGGCGGTTTGCTGAAGAGCATGAAGACAGTTTACCATGG  245

seq1  -ACCAATCTTTTTGAGGCAGTGAGCTAAAG-AGAGGCTTTCTACTCCAAT  293
       ||||||||||||||||||||||||||||| |||||||||||||||||||
seq2  AACCAATCTTTTTGAGGCAGTGAGCTAAAGAAGAGGCTTTCTACTCCAAT  295

seq1  CTGCCTTCTACCACAGAGACAAGAAAAAATAACCATCGCACCTCTGCATG  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCTTCTACCACAGAGACAAGAAAAAATAACCATCGCACCTCTGCATG  345

seq1  CTTTACCTCCTAACATGCTCAAGCAGGTGGGGTGAACAGACCACACCCAC  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTACCTCCTAACATGCTCAAGCAGGTGGGGTGAACAGACCACACCCAC  395

seq1  GTTCTCCTGTGTCCAGGGAGGTACAAAACAGAGAAGGATAATAAAGGCCT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTCCTGTGTCCAGGGAGGTACAAAACAGAGAAGGATAATAAAGGCCT  445

seq1  GGCTATAGCACTGTGTAAGTAATGGGCTGGGAAATCACAATGCCTCCTGG  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTATAGCACTGTGTAAGTAATGGGCTGGGAAATCACAATGCCTCCTGG  495

seq1  GGAGGTGGAGATGCTGAAATCTCCAGCGCTGTTTTTTGTTGGGAGCTGGA  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGGTGGAGATGCTGAAATCTCCAGCGCTGTTTTTTGTTGGGAGCTGGA  545

seq1  AAACTGAGACACAAGACGGTCAAACTGCAGGAAAGCATCACTTGCTGAGA  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTGAGACACAAGACGGTCAAACTGCAGGAAAGCATCACTTGCTGAGA  595

seq1  ACTGGGTGGGGCAGGGCAATATGGCTCTTTGGAGACGATTTCTATTGTTC  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGGTGGGGCAGGGCAATATGGCTCTTTGGAGACGATTTCTATTGTTC  645

seq1  ATGGAGATAATCATGGGAAGGGAGATCAGCCCAGACTCACTGAAGAAGAC  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGAGATAATCATGGGAAGGGAGATCAGCCCAGACTCACTGAAGAAGAC  695

seq1  CAAGCAGTACCTCAGAAACTAAAAGGAAGGGAAGCTGCCACACCCCAGCT  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCAGTACCTCAGAAACTAAAAGGAAGGGAAGCTGCCACACCCCAGCT  745

seq1  CTGAGCCTTTGCCAAGGACTGAACTTCACCAAGCTTGGGTGCTCCCATCG  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAGCCTTTGCCAAGGACTGAACTTCACCAAGCTTGGGTGCTCCCATCG  795

seq1  GTAAGACACAAAGCAGAGGAGGCGGGCAGCACATCTTCCTTGAGGAGCTG  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGACACAAAGCAGAGGAGGCGGGCAGCACATCTTCCTTGAGGAGCTG  845

seq1  TCAGCAGGATAAGGAAAGAAGAATGCTAAATGCCACGCTCTGCCTTCAGT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCAGGATAAGGAAAGAAGAATGCTAAATGCCACGCTCTGCCTTCAGT  895

seq1  GGAAGAATAGGGCTACAGGAAATCGATCCAGGAACTAGTAGACACTATAG  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGAATAGGGCTACAGGAAATCGATCCAGGAACTAGTAGACACTATAG  945

seq1  GCAGACAGGTTTCAGCCCGAGGAAGGGAGACCTTTTCAGCTACTGCTGCT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGACAGGTTTCAGCCCGAGGAAGGGAGACCTTTTCAGCTACTGCTGCT  995

seq1  ACCAAAAGATGAGATGGGGTATTTCTTAACTGTTTGAGTCCATGTTACTA  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAAAGATGAGATGGGGTATTTCTTAACTGTTTGAGTCCATGTTACTA  1045

seq1  ATGGTAACCAAAGAAAATGCAAGTTAGGTACTTTCCCAGGCAGTGGGTGC  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTAACCAAAGAAAATGCAAGTTAGGTACTTTCCCAGGCAGTGGGTGC  1095

seq1  TGGAATTC  1101
      ||||||||
seq2  TGGAATTC  1103

seq1: chr8_27426401_27426916
seq2: B6Ng01-214N01.g_68_583

seq1  GAATTCAATTAGCAAGTGCAGCACAGGAAGTGGACCCTCACGAGAACATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAATTAGCAAGTGCAGCACAGGAAGTGGACCCTCACGAGAACATT  50

seq1  GCACACAGATGAAGAATGTCTGCCTTTATAAGGCAAGCCAGTGACTGGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACACAGATGAAGAATGTCTGCCTTTATAAGGCAAGCCAGTGACTGGGG  100

seq1  AGGATGGGATGGCTTCGGGGCATCACTTAGCCCATATTTGGAGGCTTTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGATGGGATGGCTTCGGGGCATCACTTAGCCCATATTTGGAGGCTTTGT  150

seq1  CTCCAGATTTGTGTTCCTGTGGCCAGGCATGCTAATGCTAAAGGAAGGGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCAGATTTGTGTTCCTGTGGCCAGGCATGCTAATGCTAAAGGAAGGGT  200

seq1  AGTCTTCTCCATCATCATCATCATCACCATCATCATCATCATCATCACAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTTCTCCATCATCATCATCATCACCATCATCATCATCATCATCACAC  250

seq1  TTGCAGTATCCTAAGTGAGAGTATGACTTGTCATCAGAGGGCGGCTCAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCAGTATCCTAAGTGAGAGTATGACTTGTCATCAGAGGGCGGCTCAGG  300

seq1  GATCGCTATGAATATGCATACACATATACAGTTATATATGGCATGTTAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCGCTATGAATATGCATACACATATACAGTTATATATGGCATGTTAAT  350

seq1  TTTGTTTGAAGCTTAGAGAATCAACTTCTTTCTTATTTGAAAGGCACAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTGAAGCTTAGAGAATCAACTTCTTTCTTATTTGAAAGGCACAGA  400

seq1  GGCTTTGCCTGCCAACTTCCAGCATTACAAAAATCTCAACACGATCTGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTTGCCTGCCAACTTCCAGCATTACAAAAATCTCAACACGATCTGTT  450

seq1  TGTGTGAGTGCATGCACATGTGCGTGCCTGATTGTGTGTATATGTGTGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGAGTGCATGCACATGTGCGTGCCTGATTGTGTGTATATGTGTGTG  500

seq1  TGTATGTGTGAGAGAG  516
      ||||||||||||||||
seq2  TGTATGTGTGAGAGAG  516

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information