MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-235M18
Chromosome	8 (Build37)
Map Location	19,976,773 - 19,977,958
singlet/doublet	singlet
Overlap gene	EG665822
Upstream gene	Defb40, Defb37, Defb38, Defb39, Defb12, Defb34, EG546038, Spag11, Defb14, Defb4, EG654452, Defb6, EG574081, Defb5, Defb3, Defb54-ps, LOC100040504, LOC100040514, Defb8, LOC100040528, LOC100041511, Defb7, LOC670326, LOC100040561, LOC624198, EG665730, 4930467E23Rik, LOC100041567, LOC547150, LOC100040599
Downstream gene	6820431F20Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Defb40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360217 MGI:2672976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb37 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353320 MGI:2672966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360212 MGI:2672972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360214 MGI:2672974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77674 MGI:1924924
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:360211 MGI:2672979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546038 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546038 MGI:3647173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Spag11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78128 MGI:1925378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244332 MGI:2675345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56519 MGI:1927667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG654452 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:654452 MGI:3647175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Defb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:116746 MGI:2151044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG574081 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574081 MGI:3646525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81007 MGI:1933153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27358 MGI:1351612
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Defb54-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC100040504 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Defb8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244334 MGI:2654206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040528 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040528
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100041511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 835 ESTs, 7 Proteins

name	Defb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:246080 MGI:2179200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 6 Proteins pseudo : _no_value

name	LOC100040561 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040561
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC624198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 12 Proteins pseudo : _no_value

name	EG665730 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665730 MGI:3643584
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	4930467E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626415 MGI:1923056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100041567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 305 ESTs

name	LOC547150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 8 Proteins

name	LOC100040599 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040599
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG665822 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665822 MGI:3643361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	6820431F20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:381598 MGI:3694236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 29 ESTs, 8 Proteins

name	Defb40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120587014 GeneID:360217 MGI:2672976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 40 transcript_id : NM_183039.3

name	Defb37 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129202 GeneID:353320 MGI:2672966
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 37 transcript_id : NM_181683.1

name	Defb38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942121 GeneID:360212 MGI:2672972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 38 transcript_id : NM_183036.1

name	Defb39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112807196 GeneID:360214 MGI:2672974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 39 transcript_id : NM_183038.2

name	Defb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384433 GeneID:77674 MGI:1924924
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 12 transcript_id : NM_152802.2

name	Defb34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942123 GeneID:360211 MGI:2672979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 34 transcript_id : NM_183035.1

name	EG546038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360037 GeneID:546038 MGI:3647173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546038 transcript_id : NM_001034905.2

name	EG546038 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88501724 GeneID:546038 MGI:3647173
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546038 transcript_id : NM_001039563.1

name	Spag11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346552 GeneID:78128 MGI:1925378
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sperm associated antigen 11 transcript_id : NM_153115.1

name	Defb14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33942109 GeneID:244332 MGI:2675345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 14 transcript_id : NM_183026.1

name	Defb4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379735 GeneID:56519 MGI:1927667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 4 transcript_id : NM_019728.3

name	Defb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16905104 GeneID:116746 MGI:2151044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 6 transcript_id : NM_054074.1

name	EG574081 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778926 GeneID:574081 MGI:3646525
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574081 transcript_id : NM_001025351.1

name	Defb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118200342 GeneID:81007 MGI:1933153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 5 transcript_id : NM_030734.2

name	Defb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114796631 GeneID:27358 MGI:1351612
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 3 transcript_id : NM_013756.2

name	Defb8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32129299 GeneID:244334 MGI:2654206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 8 transcript_id : NM_153108.3

name	LOC100041511 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258391 GeneID:100041511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 835 ESTs, 7 Proteins product : similar to Mus musculus ribosomal protein L19 transcript_id : XM_001476576.1

name	Defb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21361233 GeneID:246080 MGI:2179200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 7 transcript_id : NM_139220.1

name	LOC100041567 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258395 GeneID:100041567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 305 ESTs product : similar to p47 protein transcript_id : XM_001476645.1

name	6820431F20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258397 GeneID:381598 MGI:3694236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 29 ESTs, 8 Proteins product : RIKEN cDNA 6820431F20 gene transcript_id : XM_001481304.1

name	Defb40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120587015 GeneID:360217 MGI:2672976
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : beta defensin 40 product : defensin beta 40 protein_id : NP_898860.3

name	Defb37 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32129203 GeneID:353320 MGI:2672966
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide note : beta defensin 37 product : defensin beta 37 protein_id : NP_859011.1

name	Defb38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942122 GeneID:360212 MGI:2672972
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide note : beta defensin 38 product : defensin beta 38 protein_id : NP_898857.1

name	Defb39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112807197 CCDS:CCDS22130.1 GeneID:360214 MGI:2672974
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 39 protein_id : NP_898859.2

name	Defb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23680955 GeneID:77674 MGI:1924924
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0050829 - defense response to Gram-negative bacterium [Evidence IDA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : beta defensin 12 protein_id : NP_690015.1

name	Defb34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942124 GeneID:360211 MGI:2672979
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide note : beta defensin 34 product : defensin beta 34 protein_id : NP_898856.1

name	EG546038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88501725 CCDS:CCDS22133.1 GeneID:546038 MGI:3647173
definition	codon_start : 1 exception : mismatches in translation note : isoform c is encoded by transcript variant c; sperm-associated antigen 11c/h product : sperm-associated antigen 11c/h isoform c protein_id : NP_001034652.1

name	EG546038 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702268 GeneID:546038 MGI:3647173
definition	codon_start : 1 note : isofrom h is encoded by transcript variant h; sperm-associated antigen 11c/h product : sperm-associated antigen 11c/h isofrom h protein_id : NP_001030077.1

name	Spag11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346553 GeneID:78128 MGI:1925378
definition	GO_component : GO:0001669 - acrosome [Evidence ISS]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA] [Evidence ISS]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : antimicrobial peptide Bin1b; beta defensin EP2e product : sperm associated antigen 11 protein_id : NP_694755.1

name	Defb14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942110 GeneID:244332 MGI:2675345
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide note : beta defensin 14 product : defensin beta 14 protein_id : NP_898847.1

name	Defb4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789929 GeneID:56519 MGI:1927667
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 note : beta defensin-4 product : defensin beta 4 protein_id : NP_062702.1

name	Defb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905105 GeneID:116746 MGI:2151044
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0050829 - defense response to Gram-negative bacterium [Evidence IDA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 6 protein_id : NP_473415.1

name	EG574081 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778927 GeneID:574081 MGI:3646525
definition	codon_start : 1 note : beta-defensin 50 product : beta-defensin 53 protein_id : NP_001020522.1

name	Defb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118200343 GeneID:81007 MGI:1933153
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 5 protein_id : NP_109659.2

name	Defb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304997 GeneID:27358 MGI:1351612
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 product : defensin beta 3 protein_id : NP_038784.1

name	Defb8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982564 GeneID:244334 MGI:2654206
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IDA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy function : antimicrobial peptide note : beta-defensin 8 product : defensin related 1 protein_id : NP_694748.2

name	LOC100041511 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258392 GeneID:100041511
definition	codon_start : 1 product : similar to Mus musculus ribosomal protein L19 protein_id : XP_001476626.1

name	Defb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361234 GeneID:246080 MGI:2179200
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 function : antimicrobial peptide product : defensin beta 7 protein_id : NP_631966.1

name	LOC100041567 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258396 GeneID:100041567
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476695.1

name	6820431F20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258398 GeneID:381598 MGI:3694236
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : RIKEN cDNA 6820431F20 gene protein_id : XP_001481354.1 transl_except : (pos:complement(19991058..19991060),aa:OTHER) transl_except : (pos:complement(19991010..19991012),aa:OTHER) transl_except : (pos:complement(19990986..19990988),aa:OTHER) transl_except : (pos:complement(19990968..19990970),aa:OTHER)

name	LOC100040504 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040504
definition	number : 1 pseudo : _no_value

name	LOC100040504 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040504
definition	number : 2 pseudo : _no_value

name	LOC100040514 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040514
definition	number : 1 pseudo : _no_value

name	LOC100040514 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040514
definition	number : 2 pseudo : _no_value

name	LOC100040528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040528
definition	number : 2 pseudo : _no_value

name	LOC100040528 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040528
definition	number : 1 pseudo : _no_value

name	LOC100040561 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040561
definition	number : 1 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 12 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 11 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 10 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 9 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 8 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 7 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 6 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 5 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 4 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 3 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 2 pseudo : _no_value

name	LOC100040599 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040599
definition	number : 1 pseudo : _no_value

name	EG654452 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84993757 GeneID:654452 MGI:3647175
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG654452 pseudo : _no_value transcript_id : NR_002878.1

name	Defb54-ps (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:84993764 GeneID:654456
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : defensin beta 54 pseudogene pseudo : _no_value transcript_id : NR_002881.1

name	LOC670326 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258375 GeneID:670326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 6 Proteins product : similar to La ribonucleoprotein domain family, member 1 pseudo : _no_value transcript_id : XR_031974.1

name	LOC624198 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258393 GeneID:624198
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 12 Proteins product : similar to cadherin 11 pseudo : _no_value transcript_id : XR_032846.1

name	EG665730 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149258394 GeneID:665730 MGI:3643584
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : predicted gene, EG665730 pseudo : _no_value transcript_id : XR_002294.2

name	4930467E23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149258376 GeneID:626415 MGI:1923056
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : RIKEN cDNA 4930467E23 gene transcript_id : XR_032009.1

name	LOC547150 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94383059 GeneID:547150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 ESTs, 8 Proteins product : similar to p47 protein transcript_id : XR_001562.1

name	EG665822 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94383060 GeneID:665822 MGI:3643361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG665822 pseudo : _no_value transcript_id : XR_001794.1

clone name	MSMg01-155F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357K11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-516I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-128I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520E11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482C12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-360K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070E07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-208L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-454N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499K24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-133C04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-460G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360K02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385P10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-134I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277C03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415H01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356J16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495I24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-434I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-438C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181L04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-272D15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075K17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-364M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-269I12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078M12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-233B23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061K24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-136B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-484G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-058C21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-154B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-452G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-489I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-165D08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-105F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-427B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532N18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-329G19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-363F07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-463B04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-512C06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-512J08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158D01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-392M15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525P09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-344C15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368A10
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-144F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348E12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-235M18.b	B6Ng01-235M18.g
ACC	GA047181	GA047182
length	1,187	1,200
definition	B6Ng01-235M18.b	B6Ng01-235M18.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcctgggtcaggaggctgaccagcggttccaatggttgaaggtgct ttagtttgctcctctgttcctgtgataaaacactcatcaaaaaaacaact taggagagggaaggattaatttgggttgtgggtcacagtctaccatcaaa ggaagcttgtgcaagaactcaaggctggaacacagaggcaggaatggaaa caaagaccatggaggaatgtttactggcttgctctatgtggctcactccg acagctttcttatacagcccaggagaatgtgcccaaggttggcactgcct acagtggtctgagccctctcgcaccaattagaaattaagaaatgtttctt ccacagacatgacaactgtccgatctgataggggcagttctttagttaag gttccccctttcaggggactccaagcttgtgccaagttgacaactgaagc tagctatgataggggtctttgtccagttcccttctccgggcgtgtatcca tttctctgtagctgagacagtcatttggtgggcattgctgtcagctagtg gacacttgaaaatcctagattcttaacctgtgggtagtgatcctcttggg gtctgctatcctgcatatcagatattacattatgatttatagcagtagca gatttacagttatgaagcagcaacaagatagttcttctaatactatgaat gacactttatcagtcattttctttacaactgaaactctgggaattcccga attaacatccttgcctgtgggcttcttgtacacaccagaaaaagttccaa acttgtgctcctagttgttctgctgtgctttgtctaaatgaacttttatg agcccggctgccatccagtttcacacagatcctctacccacaattcactt gggaagaccaagtctgctgtcatgcactactgtcagggtgtggtttctgg ggcgcttatgcttattttttaatacgaattttcccaggttggcttgggca gaatcctccctctggagcatgaacactacttgcttccactgaattttttc ctccaattcacgaactagctgaacttgaaattttctgaaaagacttaaag cctgaggaacctggtacaaaatttatgtagcttccgaccacaccaacctt catttcctggttgatgatgtgaacctcctgcatcaga	gaattctagaacgtctttaatttctttatttcttccttgacccagagatc attgagtagagagttgttcagttcccatgagtgtgtaggctttctggttt ttctgttgttattgaagtccacctttaacctactgtgttctgataggatg caaggggtcatttcaaattttttgtatctgaagaggctttctttgtgacc aatgatatggtcaattttggagaaagttccagaagatgatgagaaaaagt tacatgctcttgatttggggtgaaatattctacacataatgcttaggtcc atttgattgataacatctgttagttttattatttctccatttagtttttg tctgaatgacctgtagattggtgaaagagaagtgttgaagtctcccatta ataatctatggggtttggtgtatgctttaagctttaatagtgttctctta caaacgtggttgtccttgtgtttgaaacttagatgttcagaattgagata tcatctcagtagatttttcttttgatgagtatgaagcatactcatacagg gaagcctgtatgaagtatatgaagtatatgaagtatactcatacattatg aaggatactcatacagggaagcctgtctcttttgattacctttggttaaa agtctataatattagatattagaaggttttcgtcttggtttgactcagct tgatacttaggtctgcttgcttgaaaaattttggttcagcactgcactct gaggtaatgactatctttattgctgatgtgtgtttcttgtatgcactaca atagtgtatcttgttttcacatccattctatttgcttgtgttttgtgtgt gtgtgtttaattagaaaattgagtcgatttatattgagagatattaatgg acctgtgattggatagtgcctattttttttttttgaagctttaaaatgaa agcttttattttctgagtgctcatgaagttgggacatttcatgatctgaa ctgtatcccggaatggagctgttacaacatttttataagaatggaaaaca aaaggcagggtgggcttgtttgcatgaccaatttgacattaagggcttaa ggcaaggaaattacagaagctaacatgggtgaacattctcgactatctgg ctacgtgtttccaaggacctgtaattagctttatgtgctgtgtcgaccga
quality values	Open. Hide. 58 29 19 26 54 54 54 45 58 49 58 62 27 27 62 62 47 47 49 62 62 62 47 47 39 31 62 62 62 56 56 35 51 44 10 21 32 34 28 24 32 46 62 44 62 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 43 43 32 28 48 43 40 43 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 47 62 56 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 54 42 62 62 62 62 54 54 42 58 58 54 58 58 58 58 58 58 58 54 58 58 58 54 58 58 42 58 54 54 48 58 58 54 58 54 58 58 58 58 52 58 54 53 58 45 54 58 58 52 52 52 41 34 52 52 45 53 54 34 49 32 54 41 47 58 52 58 54 58 58 58 58 58 50 58 58 42 58 58 58 58 58 45 51 58 46 58 58 49 58 39 58 54 33 51 49 51 49 58 37 34 48 44 43 48 53 53 40 58 53 52 53 24 45 48 49 32 51 49 51 50 58 50 52 53 49 44 32 52 53 51 41 53 51 51 58 51 32 46 51 34 41 50 54 58 48 52 50 46 53 39 53 52 33 34 58 58 31 52 36 58 51 34 40 32 39 49 50 49 51 54 49 41 51 41 49 49 58 58 44 40 32 33 8 58 39 24 58 32 50 39 35 36 50 42 45 45 54 53 37 46 38 38 42 45 45 54 54 42 39 34 38 35 17 41 54 29 32 39 31 52 37 49 37 32 18 54 51 54 54 31 28 31 52 31 52 32 53 42 53 39 34 34 34 41 53 39 52 41 22 41 42 53 31 52 21 35 47 30 39 21 33 47 21 32 29 32 54 32 53 26 29 14 18 49 9 26 19 26 18 32 32 49 49 27 34 22 31 46 10 26 49 16 33 29 28 32 31 29 39 34 27 10 46 25 32 51 51 37 39 23 31 31 31 16 25 31 33 21 37 23 14 16 33 31 51 37 18 24 27 7 51 46 21 21 30 20 43 46 42 25 27 33 23 32 8 23 18 27 27 30 30 31 33 25 21 31 29 22 10 16 31 24 20 34 32 38 27 32 32 13 13 12 12 48 28 12 23 16 29 35 31 36 6 10 16 36 33 37 27 9 16 30 25 31 22 21 32 30 31 26 24 19 48 41 10 13 6 4 5 7 13 5 5 5 12 20 41 44 34 12 38 14 8 4 22 22 26 17 24 13 15 6 17 29 27 22 31 32 31 20 22 16 29 25 20 33 8 11 24 24 22 11 31 7 17 29 7 14 33 8 8 7 11 12 30 32 19 21 20 21 17 20 23 19 12 5 12 32 29 33 32 48 48 48 31 18 11 9 6 15 32 25 32 19 15 32 17 7 5 30 15 28 13 8 3 3 5 18 8 9 5 5 6 9 13 29 12 15 9 9 17 16 8 16 6 30 12 8 5 4 3 4 15 16 30 28 8 10 10 20 14 18 6 9 11 23 11 7 9 23 21 6 4 6 13 12 17 9 6 19 11 6 7 22 5 12 4 2 4 2 8 20 6 7 8 12 6 11 4 14 12 15 9 6 4 14 4 6 9 11 24 13 7 12 2 3 2 2 2 3 2 2 4 2 6 6 3 4 11 8 4 5 25 8 13 6 22 16 4 4 6 9 4 12	Open. Hide. 62 49 42 44 62 62 62 47 59 30 18 34 25 25 24 27 45 46 59 56 49 49 62 62 59 62 59 59 59 62 62 62 62 62 54 62 62 62 62 59 62 62 59 59 62 59 54 54 59 62 62 62 62 62 49 46 43 48 36 54 48 54 62 62 62 62 59 59 59 46 38 56 54 62 62 54 46 59 59 59 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 54 49 49 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 56 59 62 62 62 62 59 54 49 56 50 62 59 54 54 62 62 62 62 54 54 54 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 47 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 54 58 42 54 58 58 58 58 58 58 58 49 54 52 58 58 58 58 54 54 53 54 54 58 54 58 54 58 54 58 52 58 54 49 54 58 58 58 44 49 38 35 39 58 58 54 52 58 54 54 52 58 49 49 54 58 46 58 58 54 58 54 48 58 54 58 58 58 58 52 34 29 46 38 31 58 58 58 58 48 45 50 48 39 58 58 58 50 51 54 53 52 49 41 58 50 51 34 32 42 50 42 26 41 41 37 49 35 36 45 37 45 23 58 58 34 51 43 46 50 58 27 48 24 28 46 37 50 50 36 50 42 50 23 54 58 52 58 39 40 49 50 47 37 41 30 58 50 49 51 49 50 58 46 49 50 54 42 50 42 58 58 58 28 17 58 58 50 41 33 39 44 49 39 33 53 17 38 37 53 51 25 49 41 53 41 36 20 6 16 21 40 38 40 53 36 32 34 34 36 51 34 54 32 49 51 47 37 25 39 32 49 26 51 32 51 34 31 18 54 39 45 31 14 49 24 31 32 31 35 25 41 37 34 37 25 51 33 25 25 17 49 32 53 40 39 34 21 54 26 54 54 25 40 24 32 23 39 33 51 27 45 39 53 26 53 25 49 24 31 31 32 14 53 18 52 13 46 46 18 53 26 47 26 47 18 47 25 46 21 46 28 34 22 21 17 24 25 15 8 18 41 40 32 32 31 42 31 26 30 29 18 36 30 46 41 22 26 6 30 13 29 25 23 32 16 17 6 15 29 28 25 27 30 25 21 26 17 32 26 42 20 31 33 12 42 18 15 31 24 31 15 21 41 31 33 15 22 7 40 37 41 43 41 48 46 46 41 39 22 13 31 18 18 25 12 46 21 9 10 23 27 21 28 31 31 27 9 28 26 30 36 21 14 30 36 47 33 30 20 29 32 8 22 19 8 8 8 5 18 32 21 34 32 44 32 21 41 11 31 12 16 38 48 37 30 13 15 22 13 15 32 32 25 11 33 22 27 32 24 12 11 16 43 25 7 16 17 17 13 19 17 9 9 34 27 30 18 6 7 18 27 19 20 7 30 48 48 39 33 9 15 6 7 15 13 24 4 12 15 15 40 28 12 10 8 30 18 32 4 11 7 6 3 29 10 14 27 32 19 7 5 13 16 8 21 13 6 6 5 20 21 20 12 15 6 10 30 34 27 10 11 10 6 9 11 15 9 13 27 17 5 9 16 6 21 7 5 22 19 15 7 14 2 19 11 18 8 21 8 3 5 3 2 7 3 12 17 6 14 7 22 16 11 13 7 6 12 7 11 4 11 4 9 4 6 4 1 3 2 4 7 8 6 16 18 7 4 4 4 5 6 6 6 17 22 6 7 5 4 11 3 1 4 2 2 3 3 4 4 7 6 3 3 18 10 17 16 5 11 4 4 3 6 4 5 4 5 4 9 4 5 5 7 16 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_19976773_19977958
seq2: B6Ng01-235M18.b_47_1233 (reverse)

seq1  TCTGCTGCAGGAAGTCAACATCACCACAACCAAGGAAATTGAAGTTGGTG  50
      |||| ||||||| ||  ||||||   ||||| |||||||  | |||||| 
seq2  TCTGATGCAGGAGGTTCACATCA--TCAACC-AGGAAATGAAGGTTGGT-  46

seq1  GTGGTCGGAAAGCTACCATAATTTTTGTACCA-GTTCCTCA-GCTTTAAG  98
      |||||||| |||||| ||||| |||||||||| |||||||| ||||||||
seq2  GTGGTCGG-AAGCTA-CATAAATTTTGTACCAGGTTCCTCAGGCTTTAAG  94

seq1  TCTTTCCAGAAAA-TTCATGTCAGGCTAGTTCGTGAATTGGA-GAAAAAA  146
      ||||| ||||||| |||| ||   |||||||||||||||||| |||||||
seq2  TCTTTTCAGAAAATTTCAAGTTCAGCTAGTTCGTGAATTGGAGGAAAAAA  144

seq1  TTCAGTGGGAAGCAAGTAGTGTTCATTGCT-CAGA-GGAGGATTCTGCCC  194
      |||||| |||||||||||||||||| |||| |||| ||||||||||||||
seq2  TTCAGT-GGAAGCAAGTAGTGTTCA-TGCTCCAGAGGGAGGATTCTGCCC  192

seq1  AAGCCAACCT-GGAAAATCCGTA-TGAAAAATAAGCAGAAGCGCCCCAGA  242
      |||||||||| ||||||| |||| | ||||||||||| ||||||||||||
seq2  AAGCCAACCTGGGAAAATTCGTATTAAAAAATAAGCATAAGCGCCCCAGA  242

seq1  AACCACACCCTGACAGTAGTGCATGACAGCAGACTTGGTCTTCCCAAGTG  292
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCACACCCTGACAGTAGTGCATGACAGCAGACTTGGTCTTCCCAAGTG  292

seq1  AAATTGTGGGTAGAGGATCTGTGTGAAACTGGATGGCAGCC-GGCTCATA  341
       |||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  -AATTGTGGGTAGAGGATCTGTGTGAAACTGGATGGCAGCCGGGCTCATA  341

seq1  AAAGTTCATTTAGACAAAGCACAGCAGAACAACTAGGAGCACAAGGTTGG  391
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  AAAGTTCATTTAGACAAAGCACAGCAGAACAACTAGGAGCACAAGTTTGG  391

seq1  AACTTTTTCTGGTGTGTACAAGAAGCCCACAGGCAAGGATGTTAATTC-G  440
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AACTTTTTCTGGTGTGTACAAGAAGCCCACAGGCAAGGATGTTAATTCGG  441

seq1  GAATTCCCAGAGTTTCAGTTGTAAAGAAAATGACTGATAAAGTGTCATTC  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCAGAGTTTCAGTTGTAAAGAAAATGACTGATAAAGTGTCATTC  491

seq1  ATAGTATTAGAAGTACTATCTTGTTGCTGCTTCATAACTGTAAATCTGCT  540
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  ATAGTATTAGAAGAACTATCTTGTTGCTGCTTCATAACTGTAAATCTGCT  541

seq1  ACTGCTATAAATCATAATGTAATATCTGATATGCAGGATAGCAGACCCCA  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCTATAAATCATAATGTAATATCTGATATGCAGGATAGCAGACCCCA  591

seq1  AGAGGATCACTACCCACAGGTTAAGAATCTAGGATTTTCAAGTGTCCACT  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGATCACTACCCACAGGTTAAGAATCTAGGATTTTCAAGTGTCCACT  641

seq1  AGCTGACAGCAATGCCCACCAAATGACTGCCTCAGCTACAGAGAAATGGA  690
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  AGCTGACAGCAATGCCCACCAAATGACTGTCTCAGCTACAGAGAAATGGA  691

seq1  TACACGCCCGGAGAAGGGAACTGGACAAAGACCCCTATCATAGCTAGCTT  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACACGCCCGGAGAAGGGAACTGGACAAAGACCCCTATCATAGCTAGCTT  741

seq1  CAGTTGTCAACTTGGCACAAGCTTGGAGTCCCCTGAAAGGGGGAACCTTA  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTTGTCAACTTGGCACAAGCTTGGAGTCCCCTGAAAGGGGGAACCTTA  791

seq1  ACTAAAGAACTGCCCCTATCAGATCGGCCAGTTGTCATGTCTGTGGAAGA  840
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  ACTAAAGAACTGCCCCTATCAGATCGGACAGTTGTCATGTCTGTGGAAGA  841

seq1  AACATTTCTTAATTTCTAATTGGTGCGAGAGGGCTCAGACCACTGTAGGC  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATTTCTTAATTTCTAATTGGTGCGAGAGGGCTCAGACCACTGTAGGC  891

seq1  AGTGCCAACCTTGGGCACATTCTCCTGGGCTGTATAAGAAAGCTGTCGGA  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGCCAACCTTGGGCACATTCTCCTGGGCTGTATAAGAAAGCTGTCGGA  941

seq1  GTGAGCCACATAGAGCAAGCCAGTAAACATTCCTCCATGGTCTTTGTTTC  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGCCACATAGAGCAAGCCAGTAAACATTCCTCCATGGTCTTTGTTTC  991

seq1  CATTCCTGCCTCTGTGTTCCAGCCTTGAGTTCTTGCACAAGCTTCCTTTG  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCCTGCCTCTGTGTTCCAGCCTTGAGTTCTTGCACAAGCTTCCTTTG  1041

seq1  ATGGTAGACTGTGACCCACAACCCAAATTAATCCTTCCCTCTCCTAAGTT  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTAGACTGTGACCCACAACCCAAATTAATCCTTCCCTCTCCTAAGTT  1091

seq1  GTTTTTTTGATGAGTGTTTTATCACAGGAACAGAGGAGCAAACTAAAGCA  1140
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTTTGATGAGTGTTTTATCACAGGAACAGAGGAGCAAACTAAAGCA  1141

seq1  CCTTCAACCATTGGAACCGCTGGTCAGCCTCCTGACCCAGGAATTC  1186
      ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCAACCATTGGAACCGCTGGTCAGCCTCCTGACCCAGGAATTC  1187

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information