MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-258F03
Chromosome	8 (Build37)
Map Location	97,828,189 - 97,996,506
singlet/doublet	doublet
Overlap gene	BC016201, Map1lc3-ps6, 1700055M20Rik, Zfp319, AA960436, Mmp15, Gtl3, Csnk2a2
Upstream gene	Nup93, Slc12a3, Herpud1, EG434339, AI451557, Cpne2, 2310065K24Rik, Rspry1, Arl2bp, Pllp, Ccl22, Cx3cl1, 1700121C10Rik, Ccl17, Ciapin1, LOC664947, Coq9, Polr2c, Dok4, LOC100040942, Ccdc102a, Gpr114, Gpr56, Gpr97, Gm770, Katnb1, Kifc3
Downstream gene	4933406B17Rik, Ccdc113, 4931432M23Rik, EG546088, LOC100041040, Gins3, LOC547022, Ndrg4, Setd6, Cnot1, LOC100041953, LOC100041088, BC031853, LOC100041972, Got2, LOC667445
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nup93 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71805 MGI:1919055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc12a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20497 MGI:108114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Herpud1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64209 MGI:1927406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434339 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434339 MGI:3646624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 148 ESTs, 10 Proteins

name	AI451557 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102084 MGI:2142553
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cpne2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234577 MGI:2387578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310065K24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102122 MGI:1919637
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rspry1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67610 MGI:1914860
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl2bp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107566 MGI:1349429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pllp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67801 MGI:1915051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccl22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20299 MGI:1306779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cx3cl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20312 MGI:1097153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700121C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67364 MGI:1914614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	Ccl17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20295 MGI:1329039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ciapin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109006 MGI:1922083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC664947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Coq9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67914 MGI:1915164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Polr2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20021 MGI:109299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dok4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114255 MGI:2148865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	Ccdc102a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234582 MGI:2686927
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr114 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382045 MGI:2685955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr56 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14766 MGI:1340051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54672 MGI:1859670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm770 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330830 MGI:2685616
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Katnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74187 MGI:1921437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kifc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16582 MGI:109202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC016201 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234586 MGI:2385303
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 5 Proteins

name	Map1lc3-ps6 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384883
definition	note : microtubule-associated protein 1 light chain 3 pseudogene copy 6 pseudo : _no_value

name	1700055M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73407 MGI:1920657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Zfp319 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:79233 MGI:1890618
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AA960436 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101985 MGI:2142454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mmp15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17388 MGI:109320
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gtl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14894 MGI:107428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csnk2a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13000 MGI:88547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933406B17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71040 MGI:1918290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244608 MGI:3606076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931432M23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70993 MGI:1918243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546088 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546088 MGI:3645264
definition	note : predicted gene, EG546088 pseudo : _no_value

name	LOC100041040 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041040
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Gins3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78833 MGI:1926083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC547022 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547022
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ndrg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234593 MGI:2384590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66083 MGI:1913333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnot1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234594 MGI:2442402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 321 ESTs, 4 Proteins

name	LOC100041953 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 357 ESTs, 4 Proteins

name	LOC100041088 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	BC031853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234595 MGI:2679005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs

name	Got2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14719 MGI:95792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667445 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Nup93 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352587 GeneID:71805 MGI:1919055
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleoporin 93 transcript_id : NM_172410.2

name	Slc12a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14547896 GeneID:20497 MGI:108114
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12, member 3 transcript_id : NM_019415.1

name	Herpud1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:11612514 GeneID:64209 MGI:1927406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 transcript_id : NM_022331.1

name	EG434339 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259022 GeneID:434339 MGI:3646624
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 148 ESTs, 10 Proteins product : predicted gene, EG434339 transcript_id : XM_486145.4

name	AI451557 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384162 GeneID:102084 MGI:2142553
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AI451557 transcript_id : NM_001033207.2

name	Cpne2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25141333 GeneID:234577 MGI:2387578
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine II transcript_id : NM_153507.2

name	2310065K24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560082 GeneID:102122 MGI:1919637
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310065K24 gene transcript_id : NM_028221.2

name	Rspry1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386272 GeneID:67610 MGI:1914860
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger and SPRY domain containing 1 transcript_id : NM_026274.3

name	Arl2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18859590 GeneID:107566 MGI:1349429
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 2 binding protein transcript_id : NM_024191.1

name	Arl2bp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360051 GeneID:107566 MGI:1349429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylation factor-like 2 binding protein transcript_id : NM_024269.3

name	Pllp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382577 GeneID:67801 MGI:1915051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plasma membrane proteolipid transcript_id : NM_026385.4

name	Ccl22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677878 GeneID:20299 MGI:1306779
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 22 transcript_id : NM_009137.1

name	Cx3cl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114431260 GeneID:20312 MGI:1097153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X3-C motif) ligand 1 transcript_id : NM_009142.3

name	1700121C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259026 GeneID:67364 MGI:1914614
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : RIKEN cDNA 1700121C10 gene transcript_id : XM_001477748.1

name	Ccl17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981506 GeneID:20295 MGI:1329039
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) ligand 17 transcript_id : NM_011332.2

name	Ciapin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129955 GeneID:109006 MGI:1922083
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine induced apoptosis inhibitor 1 transcript_id : NM_134141.4

name	LOC664947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258981 GeneID:664947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to ribosomal protein L7a transcript_id : XM_001475485.1

name	Coq9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129840 GeneID:67914 MGI:1915164
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coenzyme Q9 homolog (yeast) transcript_id : NM_026452.2

name	Polr2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130554 GeneID:20021 MGI:109299
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polymerase (RNA) II (DNA directed) polypeptide C transcript_id : NM_009090.4

name	Dok4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892638 GeneID:114255 MGI:2148865
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : docking protein 4 transcript_id : NM_053246.2

name	LOC100040942 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258983 GeneID:100040942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : hypothetical protein LOC100040942 transcript_id : XM_001475534.1

name	Ccdc102a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677622 GeneID:234582 MGI:2686927
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 102A transcript_id : NM_001033533.1

name	Gpr114 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386352 GeneID:382045 MGI:2685955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 114 transcript_id : NM_001033468.2

name	Gpr56 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982717 GeneID:14766 MGI:1340051
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 56 transcript_id : NM_018882.2

name	Gpr97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40789244 GeneID:54672 MGI:1859670
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 97 transcript_id : NM_173036.2

name	Gm770 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372892 GeneID:330830 MGI:2685616
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 770, (NCBI) transcript_id : NM_001042715.2

name	Katnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84095200 GeneID:74187 MGI:1921437
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : katanin p80 (WD40-containing) subunit B 1 transcript_id : NM_028805.2

name	Kifc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84042514 GeneID:16582 MGI:109202
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member C3 transcript_id : NM_010631.2

name	BC016201 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704201 GeneID:234586 MGI:2385303
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 21 ESTs, 5 Proteins product : cDNA sequence BC016201 transcript_id : NM_145601.1

name	1700055M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40804745 GeneID:73407 MGI:1920657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700055M20 gene transcript_id : NM_199455.1

name	1700055M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365819 GeneID:73407 MGI:1920657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700055M20 gene transcript_id : NM_028532.2

name	Zfp319 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254352 GeneID:79233 MGI:1890618
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 319 transcript_id : NM_024467.3

name	AA960436 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527175 GeneID:101985 MGI:2142454
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AA960436 transcript_id : NM_133954.1

name	Mmp15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55926148 GeneID:17388 MGI:109320
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : matrix metallopeptidase 15 transcript_id : NM_008609.3

name	Gtl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680126 GeneID:14894 MGI:107428
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene trap locus 3 transcript_id : NM_008187.1

name	Csnk2a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982441 GeneID:13000 MGI:88547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 2, alpha prime polypeptide transcript_id : NM_009974.2

name	4933406B17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259034 GeneID:71040 MGI:1918290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933406B17 gene transcript_id : XM_001477935.1

name	Ccdc113 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801871 GeneID:244608 MGI:3606076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 113 transcript_id : NM_172914.2

name	4931432M23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625795 GeneID:70993 MGI:1918243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931432M23 gene transcript_id : NM_027640.1

name	Gins3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802560 GeneID:78833 MGI:1926083
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GINS complex subunit 3 (Psf3 homolog) transcript_id : NM_030198.2

name	Ndrg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130183 GeneID:234593 MGI:2384590
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-myc downstream regulated gene 4 transcript_id : NM_145602.2

name	Setd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368643 GeneID:66083 MGI:1913333
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain containing 6 transcript_id : NM_001035123.2

name	Cnot1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383742 GeneID:234594 MGI:2442402
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 321 ESTs, 4 Proteins product : CCR4-NOT transcription complex, subunit 1, transcript variant 2 transcript_id : XM_894673.2

name	LOC100041953 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259038 GeneID:100041953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 357 ESTs, 4 Proteins product : similar to SAP18 transcript_id : XM_001478046.1

name	LOC100041088 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258987 GeneID:100041088
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041088 transcript_id : XM_001475776.1

name	BC031853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346461 GeneID:234595 MGI:2679005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC031853 transcript_id : NM_172758.2

name	LOC100041972 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259040 GeneID:100041972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs product : hypothetical protein LOC100041972 transcript_id : XM_001478075.1

name	Got2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892509 GeneID:14719 MGI:95792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate oxaloacetate transaminase 2, mitochondrial transcript_id : NM_010325.2

name	Nup93 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369533 CCDS:CCDS22540.1 GeneID:71805 MGI:1919055
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA]; GO:0019867 - outer membrane [Evidence IEA] GO_function : GO:0015288 - porin activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nucleoporin 93 protein_id : NP_765998.1

name	Slc12a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14547897 GeneID:20497 MGI:108114
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005386 - carrier activity [Evidence IEA]; GO:0015377 - cation:chloride symporter activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : solute carrier family 12, member 3 protein_id : NP_062288.1

name	Herpud1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612515 CCDS:CCDS22541.1 GeneID:64209 MGI:1927406
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA]; GO:0006950 - response to stress [Evidence IDA]; GO:0006986 - response to unfolded protein [Evidence IDA] codon_start : 1 product : homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 protein_id : NP_071726.1

name	EG434339 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259023 GeneID:434339 MGI:3646624
definition	codon_start : 1 product : similar to adaptor-related protein complex 3, sigma 1 subunit protein_id : XP_486145.2

name	AI451557 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677506 GeneID:102084 MGI:2142553
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC102084 protein_id : NP_001028379.1

name	Cpne2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23943807 CCDS:CCDS22543.1 GeneID:234577 MGI:2387578
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : copine 2 product : copine II protein_id : NP_705727.1

name	2310065K24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560083 GeneID:102122 MGI:1919637
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC102122 protein_id : NP_082497.2

name	Rspry1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541973 CCDS:CCDS22544.1 GeneID:67610 MGI:1914860
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ring finger and SPRY domain containing 1 protein_id : NP_080550.2

name	Arl2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18859591 CCDS:CCDS22545.1 GeneID:107566 MGI:1349429
definition	GO_component : GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0005096 - GTPase activator activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005083 - small GTPase regulator activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; ADP-ribosylation factor-like 2; ADP-ribosylation-like 2 binding protein product : ADP-ribosylation factor-like 2 binding protein isoform 1 protein_id : NP_077153.1

name	Arl2bp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30348958 GeneID:107566 MGI:1349429
definition	GO_component : GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0005096 - GTPase activator activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0005083 - small GTPase regulator activity [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; ADP-ribosylation factor-like 2; ADP-ribosylation-like 2 binding protein product : ADP-ribosylation factor-like 2 binding protein isoform 2 protein_id : NP_077231.1

name	Pllp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20279132 CCDS:CCDS22546.1 GeneID:67801 MGI:1915051
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 11 product : plasmolipin protein_id : NP_080661.1

name	Ccl22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677879 GeneID:20299 MGI:1306779
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine subfamily A, member 22; small inducible cytokine subfamily A22; dendritic cell and B cell derived chemokine product : chemokine (C-C motif) ligand 22 protein_id : NP_033163.1

name	Cx3cl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982017 CCDS:CCDS22548.1 GeneID:20312 MGI:1097153
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008009 - chemokine activity [Evidence IEA]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : small inducible cytokine subfamily D, 1; fractalkine; neurotactin product : chemokine (C-X3-C motif) ligand 1 protein_id : NP_033168.2

name	1700121C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259027 GeneID:67364 MGI:1914614
definition	codon_start : 1 product : hypothetical protein LOC67364 protein_id : XP_001477798.1

name	Ccl17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7549785 GeneID:20295 MGI:1329039
definition	GO_function : GO:0008009 - chemokine activity [Evidence TAS]; GO:0005125 - cytokine activity [Evidence TAS] GO_process : GO:0006968 - cellular defense response [Evidence TAS]; GO:0006935 - chemotaxis [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS] codon_start : 1 note : small inducible cytokine subfamily A17-like product : chemokine (C-C motif) ligand 17 protein_id : NP_035462.1

name	Ciapin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527376 CCDS:CCDS22549.1 GeneID:109006 MGI:1922083
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_process : GO:0006916 - anti-apoptosis [Evidence IMP]; GO:0006915 - apoptosis [Evidence IEA]; GO:0030097 - hemopoiesis [Evidence IMP] codon_start : 1 product : cytokine induced apoptosis inhibitor 1 protein_id : NP_598902.1

name	LOC664947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258982 GeneID:664947
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475535.1

name	Coq9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859690 CCDS:CCDS22550.1 GeneID:67914 MGI:1915164
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_process : GO:0006744 - ubiquinone biosynthesis [Evidence IEA] codon_start : 1 product : coenzyme Q9 homolog protein_id : NP_080728.1

name	Polr2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336059 GeneID:20021 MGI:109299
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003899 - DNA-directed RNA polymerase activity [Evidence IEA]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : RNA polymerase II 3 product : polymerase (RNA) II (DNA directed) polypeptide C protein_id : NP_033116.2

name	Dok4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716573 GeneID:114255 MGI:2148865
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005158 - insulin receptor binding [Evidence IEA]; GO:0005066 - transmembrane receptor protein tyrosine kinase signaling protein activity [Evidence IPI] GO_process : GO:0000165 - MAPKKK cascade [Evidence IDA]; GO:0007399 - nervous system development [Evidence IDA]; GO:0007169 - transmembrane receptor protein tyrosine kinase signaling pathway [Evidence IPI] codon_start : 1 note : downstream of tyrosine kinase 4 product : docking protein 4 protein_id : NP_444476.1

name	LOC100040942 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258984 GeneID:100040942
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475584.1

name	Ccdc102a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677623 CCDS:CCDS22551.1 GeneID:234582 MGI:2686927
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 102A protein_id : NP_001028705.1

name	Gpr114 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701987 CCDS:CCDS22552.1 GeneID:382045 MGI:2685955
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G-protein coupled receptor 114 product : G protein-coupled receptor 114 protein_id : NP_001028640.1

name	Gpr56 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982718 CCDS:CCDS22553.1 GeneID:14766 MGI:1340051
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : serpentine receptor; secretin receptor product : G protein-coupled receptor 56 protein_id : NP_061370.2

name	Gpr97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40789245 CCDS:CCDS22554.1 GeneID:54672 MGI:1859670
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : pre B-cell transcription factor 1; G 97 product : G protein-coupled receptor 97 protein_id : NP_766624.2

name	Gm770 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111607473 GeneID:330830 MGI:2685616
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC330830 protein_id : NP_001036180.1

name	Katnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84095201 CCDS:CCDS22555.1 GeneID:74187 MGI:1921437
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005813 - centrosome [Evidence IDA]; GO:0008352 - katanin [Evidence ISS]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0045502 - dynein binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 product : katanin p80 (WD40-containing) subunit B 1 protein_id : NP_083081.2

name	Kifc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84042515 GeneID:16582 MGI:109202
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005871 - kinesin complex [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0008569 - minus-end-directed microtubule motor activity [Evidence TAS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007030 - Golgi organization and biogenesis [Evidence IMP]; GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IDA] codon_start : 1 product : kinesin family member C3 protein_id : NP_034761.2

name	BC016201 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704202 GeneID:234586 MGI:2385303
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC234586 protein_id : NP_663576.1

name	1700055M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40804746 CCDS:CCDS22557.1 GeneID:73407 MGI:1920657
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; testis/prostate/placenta-expressed protein, isoform 2 product : testis/prostate/placenta-expressed protein isoform 1 protein_id : NP_955534.1

name	1700055M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40804765 CCDS:CCDS22558.1 GeneID:73407 MGI:1920657
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2; testis/prostate/placenta-expressed protein, isoform 2 product : testis/prostate/placenta-expressed protein isoform 2 protein_id : NP_082808.1

name	Zfp319 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254353 CCDS:CCDS22559.1 GeneID:79233 MGI:1890618
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 319 protein_id : NP_077787.3

name	AA960436 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527176 CCDS:CCDS22560.1 GeneID:101985 MGI:2142454
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC101985 protein_id : NP_598715.1

name	Mmp15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678900 CCDS:CCDS22561.1 GeneID:17388 MGI:109320
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA] [Evidence ISS]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0000270 - peptidoglycan metabolism [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : Membrane type 2-MMP product : matrix metalloproteinase 15 protein_id : NP_032635.1

name	Gtl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680127 GeneID:14894 MGI:107428
definition	codon_start : 1 exception : mismatches in translation product : gene trap locus 3 protein_id : NP_032213.1

name	Csnk2a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753540 CCDS:CCDS22562.1 GeneID:13000 MGI:88547
definition	GO_component : GO:0005956 - protein kinase CK2 complex [Evidence TAS] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004682 - protein kinase CK2 activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : casein kinase II, alpha 2, polypeptide protein_id : NP_034104.1

name	4933406B17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259035 GeneID:71040 MGI:1918290
definition	codon_start : 1 product : hypothetical protein LOC71040 protein_id : XP_001477985.1

name	Ccdc113 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370404 CCDS:CCDS22563.1 GeneID:244608 MGI:3606076
definition	codon_start : 1 product : coiled-coil domain containing 113 protein_id : NP_766502.1

name	4931432M23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625796 GeneID:70993 MGI:1918243
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 function : putative non-peptidase serine protease note : plasma kallikrein-like protein 4 product : RIKEN cDNA 4931432M23 protein_id : NP_081916.1

name	Gins3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313504 CCDS:CCDS22564.1 GeneID:78833 MGI:1926083
definition	codon_start : 1 product : GINS complex subunit 3 (Psf3 homolog) protein_id : NP_084474.1

name	Ndrg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704212 CCDS:CCDS22565.1 GeneID:234593 MGI:2384590
definition	GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : N-myc downstream regulated 1, related sequence; N-myc downstream regulated 4 product : N-myc downstream regulated gene 4 protein_id : NP_663577.1

name	Setd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78097104 CCDS:CCDS22566.1 GeneID:66083 MGI:1913333
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : SET domain containing 6 protein_id : NP_001030295.1

name	Cnot1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383743 GeneID:234594 MGI:2442402
definition	codon_start : 1 product : CCR4-NOT transcription complex, subunit 1 isoform 2 protein_id : XP_899766.2

name	LOC100041953 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259039 GeneID:100041953
definition	codon_start : 1 product : similar to SAP18 protein_id : XP_001478096.1

name	LOC100041088 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258988 GeneID:100041088
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475826.1

name	LOC100041972 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259041 GeneID:100041972
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478125.1

name	BC031853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370116 CCDS:CCDS22567.1 GeneID:234595 MGI:2679005
definition	codon_start : 1 product : amino acid transporter protein_id : NP_766346.1

name	Got2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754036 CCDS:CCDS22568.1 GeneID:14719 MGI:95792
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0004069 - aspartate transaminase activity [Evidence IDA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0008483 - transaminase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 note : mitochondrial aspartate aminotransferase; plasma membrane fatty acid binding protein product : glutamate oxaloacetate transaminase 2, mitochondrial protein_id : NP_034455.1

name	LOC100041040 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041040
definition	number : 1 pseudo : _no_value

name	LOC100041040 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041040
definition	number : 2 pseudo : _no_value

name	LOC547022 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547022
definition	number : 1 pseudo : _no_value

name	LOC667445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667445
definition	number : 1 pseudo : _no_value

name	LOC667445 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667445
definition	number : 2 pseudo : _no_value

clone name	MSMg01-328I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-084P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198N01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-298N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-374H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-199O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-510P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-402E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-264G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-086E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-319M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-096H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-282K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275C12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-258F03.b	B6Ng01-258F03.g
ACC	GA063790	GA063791
length	1,126	134
definition	B6Ng01-258F03.b	B6Ng01-258F03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(97,995,374 - 97,996,506)	(97,828,189 - 97,828,322)
sequence	gaattcatcataggctttctgcttcagtttgctaagcactagggttataa aagtaagcagccatgagcagctttaaacttggttcatggatttgtttatt gtatttattcatgaagcataaaaatagagcctactcatgagggttctggt gttgcaacatacaaaaggaaaacctttttagaacacagtttgaaaacaat ataaaaacaaaatagtgatgttgatttccaagggtctgagaggacttgtg ggtgattacaactctggcaaggaatcagacacttgtgaattgttgaggga gaggctagagataaagccatcttgtcagatgttggtgtccagcatttatg ttgcaggtgaaataaaagatccttatttgcacatgtattttcttagctaa tctctctaagggtatctaatgaaaactaaaagggtacattgacttaaaat gaagtaaattttatatctttcttgtatgtaacaaatgttttattataact cctttacaggtaaaatcagtggccagcattttgtgtttctcagaggtgat atgtgccaggttctgtggggagttaacaaattctaatgtctgggaagcct gtttctctggaatctgaaccattaaaggaagtgttctgaagacatggata gacttttaaagaatatccttttgaaggatatgtttttaaagaaatcatgg gaatcagtcatttttgaaggttgcatatttgggaacatcttttctcctcc tcactcatgtcttcactataattctgtgttgaattcctgatctcttctgt tttgaagagtttgttccagtgtcagcactggtgccattcctgtttgatct aaagatttctctttcctttttctggaagcgtttaggaatttctcttcatt cccagtcttgtgaatgttcaaatgtgtgccttcctgtgggcgcctttcat cctttgttctggattcttgctgcgccttttccatctgaagctcatggctt tccatattttcagtgttctttgatttctccccccctttctgttctcactg tctaagaatatattcaaatgtagactttgtatttagaagtcattcagtcc tctgatttttaaataagtcttctgtt	ctttctaagggttcctgtcactaattcatttatttctattaaggagtagt aagtattctatggcatggatttttgcataccttgcttatctgtttccaag ctgaaggaactgtttgcggtgggggggggggggg
quality values	Open. Hide. 58 33 46 34 58 25 17 47 41 41 62 49 62 62 62 62 62 62 62 54 47 49 62 62 44 26 62 62 62 59 59 51 44 32 33 28 40 56 59 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 46 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 49 58 58 58 54 54 58 58 58 58 58 58 58 52 52 58 58 58 58 58 58 54 58 58 41 49 58 58 58 54 54 58 54 54 58 58 54 58 54 54 49 54 58 58 54 58 58 58 58 47 58 58 50 58 58 50 58 58 49 58 54 51 51 51 58 58 58 49 41 50 58 58 58 53 45 48 50 58 50 51 58 58 58 58 58 58 50 52 58 46 58 53 58 58 58 58 42 54 50 52 58 58 58 46 40 58 50 51 50 53 58 58 39 42 58 51 50 58 47 53 53 39 50 58 53 58 58 58 37 41 58 39 58 46 32 53 39 58 50 58 58 58 38 31 58 58 39 51 58 41 39 53 40 47 58 58 42 58 53 50 53 41 50 53 41 31 51 54 48 54 54 28 39 53 32 54 27 26 40 29 32 52 42 37 49 50 54 54 53 53 52 39 37 53 42 53 54 54 54 45 39 49 33 37 47 54 41 40 37 41 51 40 32 35 54 40 45 41 46 37 26 39 31 37 31 33 53 37 47 37 42 54 37 54 28 38 37 53 34 24 35 28 46 32 41 32 31 30 34 45 32 37 52 39 46 21 51 51 40 28 31 53 31 53 26 32 53 46 37 25 25 32 31 26 32 26 41 28 31 25 30 45 36 31 30 40 41 31 42 31 42 30 31 45 30 31 30 46 30 51 28 25 32 31 39 31 31 51 32 32 33 17 47 31 31 31 36 31 47 31 31 38 36 48 47 47 21 28 31 41 25 31 42 22 31 27 24 46 23 41 31 30 32 46 28 48 31 31 36 32 23 21 31 21 26 36 32 46 32 31 31 30 38 22 22 31 16 29 27 36 25 31 23 27 19 19 46 28 32 31 21 32 28 29 21 22 24 25 17 23 31 42 26 31 33 25 22 25 26 30 28 48 38 32 31 24 20 33 23 36 30 31 11 20 29 20 25 13 31 15 17 29 13 33 35 31 29 32 32 31 30 23 14 43 43 25 14 22 22 21 16 20 21 31 21 18 32 25 20 25 15 19 31 30 34 48 24 4 20 23 27 22 9 43 34 24 6 13 21 7 23 7 26 28 15 40 26 13 27 14 34 6 7 10 20 30 38 32 34 33 21 15 40 14 11 7 8 8 13 25 7 8 7 11 9 11 5 7 4 3 5 8 20 30 13 18 12 25 4 17 28 16 40 15 9 11 30 6 6 8 6 22 14 20 14 15 15 16 18 24 6 4 6 24 7 12 22 12 24 16 12 7 6 6 5 4 5 17 15 15 9 3 3 17 28 13 8 14 12 4 4 6 6 4 8 11 16 19 8 16 7 8	Open. Hide. 62 59 62 62 59 56 56 59 51 62 38 36 62 62 62 59 59 62 59 49 62 62 62 62 62 62 59 43 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 59 59 62 59 62 62 62 59 62 62 59 62 62 62 62 59 62 59 62 62 59 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 49 49 49 42 49 49 62 62 62 62 62 59 26

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_97995374_97996506
seq2: B6Ng01-258F03.b_43_1168 (reverse)

seq1  AACAGAAGACTATTTTTAAAAATTCAGA-GACTGAAATGGACTTCTAAAA  49
      ||||||||||| | |||||||| ||||| |||||||   ||||||| |||
seq2  AACAGAAGACT-TATTTAAAAA-TCAGAGGACTGAA--TGACTTCT-AAA  45

seq1  TACAAAGTCTAACATTTGAATTATATTC-TAGACAGTGAGAACAAGAAAG  98
      |||||||||| ||||||||| ||||||| |||||||||||||| ||||||
seq2  TACAAAGTCT-ACATTTGAA-TATATTCTTAGACAGTGAGAAC-AGAAAG  92

seq1  GGGGGGAGAAATCAAAGAACACTGAAAATATGGAAAGCCATGAGCTTTCA  148
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  GGGGGGAGAAATCAAAGAACACTGAAAATATGGAAAGCCATGAGC-TTCA  141

seq1  GATGGAAAAGGCGCAGCAAGAATCCAGAACAAAGGATGAAAGGCGCCCAC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGGAAAAGGCGCAGCAAGAATCCAGAACAAAGGATGAAAGGCGCCCAC  191

seq1  AGGAAGGCACACATTTGAACATTCACAAGACTGGGAATGAAGAGAAATTC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAAGGCACACATTTGAACATTCACAAGACTGGGAATGAAGAGAAATTC  241

seq1  CTAAACGCTTCCAGAAAAAGGAAAGAGAAATCTTTAGATCAAACAGGAAT  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAACGCTTCCAGAAAAAGGAAAGAGAAATCTTTAGATCAAACAGGAAT  291

seq1  GGCACCAGTGCTGACACTGGAACAAACTCTTCAAAACAGAAGAGATCAGG  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCACCAGTGCTGACACTGGAACAAACTCTTCAAAACAGAAGAGATCAGG  341

seq1  AATTCAACACAGAATTATAGTGAAGACATGAGTGAGGAGGAGAAAAGATG  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCAACACAGAATTATAGTGAAGACATGAGTGAGGAGGAGAAAAGATG  391

seq1  TTCCCAAATATGCAACCTTCAAAAATGACTGATTCCCATGATTTCTTTAA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCAAATATGCAACCTTCAAAAATGACTGATTCCCATGATTTCTTTAA  441

seq1  AAACATATCCTTCAAAAGGATATTCTTTAAAAGTCTATCCATGTCTTCAG  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACATATCCTTCAAAAGGATATTCTTTAAAAGTCTATCCATGTCTTCAG  491

seq1  AACACTTCCTTTAATGGTTCAGATTCCAGAGAAACAGGCTTCCCAGACAT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACTTCCTTTAATGGTTCAGATTCCAGAGAAACAGGCTTCCCAGACAT  541

seq1  TAGAATTTGTTAACTCCCCACAGAACCTGGCACATATCACCTCTGAGAAA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAATTTGTTAACTCCCCACAGAACCTGGCACATATCACCTCTGAGAAA  591

seq1  CACAAAATGCTGGCCACTGATTTTACCTGTAAAGGAGTTATAATAAAACA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAAATGCTGGCCACTGATTTTACCTGTAAAGGAGTTATAATAAAACA  641

seq1  TTTGTTACATACAAGAAAGATATAAAATTTACTTCATTTTAAGTCAATGT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTACATACAAGAAAGATATAAAATTTACTTCATTTTAAGTCAATGT  691

seq1  ACCCTTTTAGTTTTCATTAGATACCCTTAGAGAGATTAGCTAAGAAAATA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTTTTAGTTTTCATTAGATACCCTTAGAGAGATTAGCTAAGAAAATA  741

seq1  CATGTGCAAATAAGGATCTTTTATTTCACCTGCAACATAAATGCTGGACA  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTGCAAATAAGGATCTTTTATTTCACCTGCAACATAAATGCTGGACA  791

seq1  CCAACATCTGACAAGATGGCTTTATCTCTAGCCTCTCCCTCAACAATTCA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAACATCTGACAAGATGGCTTTATCTCTAGCCTCTCCCTCAACAATTCA  841

seq1  CAAGTGTCTGATTCCTTGCCAGAGTTGTAATCACCCACAAGTCCTCTCAG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGTGTCTGATTCCTTGCCAGAGTTGTAATCACCCACAAGTCCTCTCAG  891

seq1  ACCCTTGGAAATCAACATCACTATTTTGTTTTTATATTGTTTTCAAACTG  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTTGGAAATCAACATCACTATTTTGTTTTTATATTGTTTTCAAACTG  941

seq1  TGTTCTAAAAAGGTTTTCCTTTTGTATGTTGCAACACCAGAACCCTCATG  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCTAAAAAGGTTTTCCTTTTGTATGTTGCAACACCAGAACCCTCATG  991

seq1  AGTAGGCTCTATTTTTATGCTTCATGAATAAATACAATAAACAAATCCAT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAGGCTCTATTTTTATGCTTCATGAATAAATACAATAAACAAATCCAT  1041

seq1  GAACCAAGTTTAAAGCTGCTCATGGCTGCTTACTTTTATAACCCTAGTGC  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCAAGTTTAAAGCTGCTCATGGCTGCTTACTTTTATAACCCTAGTGC  1091

seq1  TTAGCAAACTGAAGCAGAAAGCCTATGATGAATTC  1133
      |||||||||||||||||||||||||||||||||||
seq2  TTAGCAAACTGAAGCAGAAAGCCTATGATGAATTC  1126

seq1: chr8_97828189_97828322
seq2: B6Ng01-258F03.g_73_206

seq1  CTTTCTAAGGGTTCCTGTCACTAATTCATTTATTTCTATTAAGGAGTAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCTAAGGGTTCCTGTCACTAATTCATTTATTTCTATTAAGGAGTAGT  50

seq1  AAGTATTCTATGGCATGGATTTTTGCATACCTTGCTTATCTGTTTCCAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTATTCTATGGCATGGATTTTTGCATACCTTGCTTATCTGTTTCCAAG  100

seq1  CTGAAGGAACTGTTTGCGGTGGGGGGGGGGGGGG  134
      ||||||||||||||||||||||||||||||||||
seq2  CTGAAGGAACTGTTTGCGGTGGGGGGGGGGGGGG  134

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information