MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-263H23
Chromosome	8 (Build37)
Map Location	26,162,181 - 26,298,602
singlet/doublet	doublet
Overlap gene	Plekha2, LOC100042390, Tacc1
Upstream gene	Zmat4, 1810011O10Rik, Indol1, Indo, Adam18, Adam3, Adam5, Adam32, Adam9, Tm2d2, Htra4
Downstream gene	LOC670822, LOC100040998, Fgfr1, D030041N04Rik, LOC100042416, Whsc1l1, Ppapdc1, Bag4, Lsm1, Star, Ash2l, Kcnu1, Hgsnat, 4930444A02Rik, Fnta, Hook3, 1700047A11Rik, Rnf170, Thap1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zmat4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320158 MGI:2443497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810011O10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69068 MGI:1916318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Indol1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209176 MGI:2142489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Indo (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15930 MGI:96416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13524 MGI:105986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11497 MGI:102518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11499 MGI:104730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353188 MGI:2653822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11502 MGI:105376
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tm2d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69742 MGI:1916992
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330723 MGI:3036260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekha2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83436 MGI:1928144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042390 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Tacc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320165 MGI:2443510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC670822 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100040998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 2 Proteins

name	Fgfr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	D030041N04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270035 MGI:2444979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs

name	Whsc1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234135 MGI:2142581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ppapdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71910 MGI:1919160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bag4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67384 MGI:1914634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lsm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67207 MGI:1914457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Star (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20845 MGI:102760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ash2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23808 MGI:1344416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Kcnu1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16532 MGI:1202300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hgsnat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52120 MGI:1196297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930444A02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74653 MGI:1921903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fnta (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14272 MGI:104683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hook3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320191 MGI:2443554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700047A11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76604 MGI:1923854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rnf170 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77733 MGI:1924983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Thap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73754 MGI:1921004
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmat4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130346 GeneID:320158 MGI:2443497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, matrin type 4 transcript_id : NM_177086.2

name	1810011O10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802249 GeneID:69068 MGI:1916318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810011O10 gene transcript_id : NM_026931.2

name	Indol1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122378 GeneID:209176 MGI:2142489
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : indoleamine-pyrrole 2,3 dioxygenase-like 1 transcript_id : NM_145949.1

name	Indo (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680346 GeneID:15930 MGI:96416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : indoleamine-pyrrole 2,3 dioxygenase transcript_id : NM_008324.1

name	Adam18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753683 GeneID:13524 MGI:105986
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 18 transcript_id : NM_010084.1

name	Adam3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949803 GeneID:11497 MGI:102518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 3 (cyritestin) transcript_id : NM_009619.4

name	Adam5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677439 GeneID:11499 MGI:104730
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 5 transcript_id : NM_007401.2

name	Adam32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510258 GeneID:353188 MGI:2653822
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 32 transcript_id : NM_153397.1

name	Adam9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680643 GeneID:11502 MGI:105376
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 9 (meltrin gamma) transcript_id : NM_007404.1

name	Tm2d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802111 GeneID:69742 MGI:1916992
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TM2 domain containing 2 transcript_id : NM_027194.2

name	Htra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487142 GeneID:330723 MGI:3036260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HtrA serine peptidase 4 transcript_id : NM_001081187.1

name	Plekha2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543492 GeneID:83436 MGI:1928144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 transcript_id : NM_031257.2

name	LOC100042390 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258563 GeneID:100042390
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042390 transcript_id : XM_001478131.1

name	Tacc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681725 GeneID:320165 MGI:2443510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming, acidic coiled-coil containing protein 1 transcript_id : NM_199323.2

name	Tacc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110681726 GeneID:320165 MGI:2443510
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transforming, acidic coiled-coil containing protein 1 transcript_id : NM_177089.4

name	LOC100040998 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258527 GeneID:100040998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 74 ESTs, 2 Proteins product : hypothetical protein LOC100040998 transcript_id : XM_001475629.1

name	Fgfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952640 GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 1 transcript_id : NM_010206.2

name	Fgfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952697 GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 1 transcript_id : NM_001079908.1

name	Fgfr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952632 GeneID:14182 MGI:95522
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor receptor 1 transcript_id : NM_001079909.1

name	D030041N04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345806 GeneID:270035 MGI:2444979
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D030041N04 gene transcript_id : NM_173012.2

name	LOC100042416 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258565 GeneID:100042416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs product : hypothetical protein LOC100042416 transcript_id : XM_001478167.1

name	Whsc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48958536 GeneID:234135 MGI:2142581
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 1-like 1 (human) transcript_id : NM_001001735.1

name	Whsc1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486902 GeneID:234135 MGI:2142581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wolf-Hirschhorn syndrome candidate 1-like 1 (human) transcript_id : NM_001081269.1

name	Ppapdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487351 GeneID:71910 MGI:1919160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidic acid phosphatase type 2 domain containing 1 transcript_id : NM_028000.1

name	Bag4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686110 GeneID:67384 MGI:1914634
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL2-associated athanogene 4 transcript_id : NM_026121.3

name	Lsm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625666 GeneID:67207 MGI:1914457
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) transcript_id : NM_026032.1

name	Star (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130138 GeneID:20845 MGI:102760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : steroidogenic acute regulatory protein transcript_id : NM_011485.4

name	Ash2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248549 GeneID:23808 MGI:1344416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ash2 (absent, small, or homeotic)-like (Drosophila) transcript_id : NM_001080793.1

name	Ash2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248551 GeneID:23808 MGI:1344416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ash2 (absent, small, or homeotic)-like (Drosophila) transcript_id : NM_011791.2

name	Kcnu1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120300927 GeneID:16532 MGI:1202300
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel, subfamily U, member 1 transcript_id : NM_008432.3

name	Hgsnat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115292432 GeneID:52120 MGI:1196297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan-alpha-glucosaminide N-acetyltransferase transcript_id : NM_029884.1

name	4930444A02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372410 GeneID:74653 MGI:1921903
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930444A02 gene transcript_id : NM_029037.3

name	Fnta (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803059 GeneID:14272 MGI:104683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : farnesyltransferase, CAAX box, alpha transcript_id : NM_008033.3

name	Hook3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131070 GeneID:320191 MGI:2443554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hook homolog 3 (Drosophila) transcript_id : NM_207659.2

name	1700047A11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258567 GeneID:76604 MGI:1923854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 1700047A11 gene transcript_id : XM_001478344.1

name	Rnf170 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186462 GeneID:77733 MGI:1924983
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 170 transcript_id : NM_029965.2

name	Thap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40068501 GeneID:73754 MGI:1921004
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing, apoptosis associated protein 1 transcript_id : NM_199042.1

name	Zmat4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893005 CCDS:CCDS22192.1 GeneID:320158 MGI:2443497
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : zinc finger, matrin type 4 protein_id : NP_796060.1

name	1810011O10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312200 CCDS:CCDS22194.1 GeneID:69068 MGI:1916318
definition	codon_start : 1 product : thyroid cancer-1 protein_id : NP_081207.1

name	Indol1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122379 GeneID:209176 MGI:2142489
definition	GO_function : GO:0020037 - heme binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : indoleamine-pyrrole 2,3 dioxygenase-like 1 protein_id : NP_666061.1

name	Indo (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680347 GeneID:15930 MGI:96416
definition	GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0004426 - indoleamine-pyrrole 2,3-dioxygenase activity [Evidence IDA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence TAS]; GO:0006955 - immune response [Evidence IEA]; GO:0019441 - tryptophan catabolism to kynurenine [Evidence IDA] codon_start : 1 note : indole 2,3-dioxygenase product : indoleamine-pyrrole 2,3 dioxygenase protein_id : NP_032350.1

name	Adam18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753684 CCDS:CCDS22195.1 GeneID:13524 MGI:105986
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005178 - integrin binding [Evidence ISS]; GO:0004222 - metalloendopeptidase activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : disintegrin 3 product : a disintegrin and metalloprotease domain 18 protein_id : NP_034214.1

name	Adam3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949804 CCDS:CCDS22196.1 GeneID:11497 MGI:102518
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0045121 - lipid raft [Evidence IDA] GO_process : GO:0007339 - binding of sperm to zona pellucida [Evidence IMP] [Evidence IDA] codon_start : 1 note : cyritestin product : a disintegrin and metalloprotease domain 3 (cyritestin) protein_id : NP_033749.2

name	Adam5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677440 GeneID:11499 MGI:104730
definition	GO_function : GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 note : a disintegrin and metalloprotease domain (ADAM) 5 product : a disintegrin and metalloprotease domain 5 protein_id : NP_031427.2

name	Adam32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510259 GeneID:353188 MGI:2653822
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : a disintegrin and metalloprotease domain 32 protein_id : NP_700446.1

name	Adam9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680644 GeneID:11502 MGI:105376
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 exception : mismatches in translation note : meltrin gamma; a disintegrin and metalloproteinase domain 9 (meltrin gamma) product : a disintegrin and metalloprotease domain 9 (meltrin gamma) protein_id : NP_031430.1

name	Tm2d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312394 CCDS:CCDS22197.1 GeneID:69742 MGI:1916992
definition	codon_start : 1 exception : mismatches in translation product : BBP-like protein 1 protein_id : NP_081470.1

name	Htra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487143 GeneID:330723 MGI:3036260
definition	codon_start : 1 product : HtrA serine peptidase 4 protein_id : NP_001074656.1

name	Plekha2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752587 CCDS:CCDS22198.1 GeneID:83436 MGI:1928144
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005545 - phosphatidylinositol binding [Evidence IDA] codon_start : 1 note : pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2andem PH Domain containing protein 2 product : pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 protein_id : NP_112547.1

name	LOC100042390 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258564 GeneID:100042390
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478181.1

name	Tacc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40556391 GeneID:320165 MGI:2443510
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : short isoform is encoded by transcript variant 2 product : transforming acidic coiled-coil containing protein 1 short isoform protein_id : NP_955355.1

name	Tacc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110681727 GeneID:320165 MGI:2443510
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : long isoform is encoded by transcript variant 1 product : transforming acidic coiled-coil containing protein 1 long isoform protein_id : NP_796063.3

name	LOC100040998 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258528 GeneID:100040998
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475679.1

name	Fgfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952641 GeneID:14182 MGI:95522
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence TAS]; GO:0008201 - heparin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IGI]; GO:0001759 - induction of an organ [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IGI] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0002053 - positive regulation of mesenchymal cell proliferation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007435 - salivary gland morphogenesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : fibroblast growth factor receptor 1 isoform 1 protein_id : NP_034336.2

name	Fgfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952698 GeneID:14182 MGI:95522
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence TAS]; GO:0008201 - heparin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IGI]; GO:0001759 - induction of an organ [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IGI] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0002053 - positive regulation of mesenchymal cell proliferation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007435 - salivary gland morphogenesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : fibroblast growth factor receptor 1 isoform 2 protein_id : NP_001073377.1

name	Fgfr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952633 GeneID:14182 MGI:95522
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005007 - fibroblast growth factor receptor activity [Evidence TAS]; GO:0008201 - heparin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IGI]; GO:0048514 - blood vessel morphogenesis [Evidence IMP]; GO:0007420 - brain development [Evidence IMP]; GO:0048754 - branching morphogenesis of a tube [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0008543 - fibroblast growth factor receptor signaling pathway [Evidence IGI]; GO:0001759 - induction of an organ [Evidence IMP]; GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0030324 - lung development [Evidence IGI] [Evidence IMP]; GO:0043066 - negative regulation of apoptosis [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0002053 - positive regulation of mesenchymal cell proliferation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007435 - salivary gland morphogenesis [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : fibroblast growth factor receptor 1 isoform 3 protein_id : NP_001073378.1

name	D030041N04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370518 GeneID:270035 MGI:2444979
definition	codon_start : 1 product : hypothetical protein LOC270035 protein_id : NP_766600.1

name	LOC100042416 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258566 GeneID:100042416
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478217.1

name	Whsc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486903 GeneID:234135 MGI:2142581
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Wolf-Hirschhorn syndrome candidate 1-like 1 product : Wolf-Hirschhorn syndrome candidate 1-like 1 isoform 2 protein_id : NP_001074738.1

name	Whsc1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:48958537 GeneID:234135 MGI:2142581
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Wolf-Hirschhorn syndrome candidate 1-like 1 product : Wolf-Hirschhorn syndrome candidate 1-like 1 isoform 1 protein_id : NP_001001735.1

name	Ppapdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487352 GeneID:71910 MGI:1919160
definition	codon_start : 1 product : phosphatidic acid phosphatase type 2 domain containing 1 protein_id : NP_082276.1

name	Bag4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17975504 CCDS:CCDS22201.1 GeneID:67384 MGI:1914634
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : BCL2-associated athanogene 4 protein_id : NP_080397.1

name	Lsm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625667 CCDS:CCDS22202.1 GeneID:67207 MGI:1914457
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016071 - mRNA metabolism [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 product : LSM1 homolog, U6 small nuclear RNA associated protein_id : NP_080308.1

name	Star (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543776 CCDS:CCDS22203.1 GeneID:20845 MGI:102760
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0015485 - cholesterol binding [Evidence IEA]; GO:0017127 - cholesterol transporter activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA] GO_process : GO:0006700 - C21-steroid hormone biosynthesis [Evidence IEA]; GO:0044255 - cellular lipid metabolism [Evidence IMP]; GO:0008211 - glucocorticoid metabolism [Evidence IMP]; GO:0006869 - lipid transport [Evidence IEA]; GO:0050810 - regulation of steroid biosynthesis [Evidence IDA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : steroidogenic acute regulatory protein protein_id : NP_035615.2

name	Ash2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248552 GeneID:23808 MGI:1344416
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030097 - hemopoiesis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : ash2-like isoform a protein_id : NP_035921.2

name	Ash2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248550 GeneID:23808 MGI:1344416
definition	GO_component : GO:0035097 - histone methyltransferase complex [Evidence ISS] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030097 - hemopoiesis [Evidence ISS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] [Evidence ISS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : ash2-like isoform b protein_id : NP_001074262.1

name	Kcnu1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120300928 GeneID:16532 MGI:1202300
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005267 - potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 note : potassium large conductance pH-sensitive channel, subfamily M, alpha member 3 product : potassium channel, subfamily U, member 1 protein_id : NP_032458.3

name	Hgsnat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115292433 GeneID:52120 MGI:1196297
definition	codon_start : 1 product : heparan-alpha-glucosaminide N-acetyltransferase protein_id : NP_084160.1

name	4930444A02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312828 CCDS:CCDS22204.1 GeneID:74653 MGI:1921903
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : hypothetical protein LOC74653 protein_id : NP_083313.1

name	Fnta (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679821 CCDS:CCDS22205.1 GeneID:14272 MGI:104683
definition	GO_function : GO:0030548 - acetylcholine receptor regulator activity [Evidence IMP]; GO:0004662 - CAAX-protein geranylgeranyltransferase activity [Evidence IEA]; GO:0004659 - prenyltransferase activity [Evidence IEA]; GO:0004660 - protein farnesyltransferase activity [Evidence IEA]; GO:0008318 - protein prenyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045213 - neurotransmitter receptor metabolism [Evidence IMP]; GO:0018346 - protein amino acid prenylation [Evidence IEA] codon_start : 1 product : farnesyltransferase, CAAX box, alpha protein_id : NP_032059.1

name	Hook3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559745 CCDS:CCDS22206.1 GeneID:320191 MGI:2443554
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0008017 - microtubule binding [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : hook homolog 3 protein_id : NP_997542.1

name	1700047A11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258568 GeneID:76604 MGI:1923854
definition	codon_start : 1 product : hypothetical protein LOC76604 protein_id : XP_001478394.1

name	Rnf170 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037503 CCDS:CCDS22207.1 GeneID:77733 MGI:1924983
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 170 protein_id : NP_084241.1

name	Thap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40068502 CCDS:CCDS22208.1 GeneID:73754 MGI:1921004
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : THAP domain containing, apoptosis associated protein 1 protein_id : NP_950243.1

name	LOC670822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670822
definition	number : 1 pseudo : _no_value

name	LOC670822 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670822
definition	number : 2 pseudo : _no_value

clone name	MSMg01-505H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294J10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-526A14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-205E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-420P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-123C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-493K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-060K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-413L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-193I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015A07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-263H23.b	B6Ng01-263H23.g
ACC	GA067650	GA067651
length	854	1,117
definition	B6Ng01-263H23.b	B6Ng01-263H23.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(26,162,181 - 26,163,027)	(26,297,494 - 26,298,602)
sequence	gaattcagtaggggaaagagaaaaaagggagatggatgttcctaaaaccc cacgcgggaaagctgcgaattttaaggctcagaatctcacatcagcctct ccctgtactggctctgtggtcttctaggcagcccaggcggaggacttggc tctagctgtctttgcgctgcttggaaatctgccttgctagctgctgtgac ctcatagggattgggagagctccagatctgggggtggggggaaggtcctg gtaagggaactgtcagaggccaaacaatggctttctctgtgcaggctgcc tgtgcacctgtgccggcaaagggccctctatgcttctgtcttgtctgcac acagtaatgtccatacataggcgggacttataaataccctccagagcaga agtgaaaccatccaccagttctccttttctctgcttagttggagctctgc agcccagtgcagctgctacagaggctggcatcctcccgcacctcccgcac agcggatagacctgcttgtagtatcccagggtagggaagcatctaaccaa caccctccttagaatgagatgggacactgggtgctggagggagcggaggc atccactcacatttcacagagaggaaacgctggtctgggggtggacattt acctgtacgtagaaacgtcctggaggtggttatgatttcaaaacaggttg tccctcattaagagatcactaggcaaggagagagagagatacccattaca ctaagcattgtgagaacttttttttttccacgttatttccctacagtttc caggtcacccactaatgcaactcaagactttctcctttcttgtggattaa ggca	gaattcaggacctctggaagagcagccagttttcttaaccactgagccat ctgtccagcccgacagacatctctactcttagccttgtgtttatagtctg ttcaccttttaataaaagcccacacccatgccctgcagagtgcatcttaa ttctgtaccccgcctctcttaacccttgtgtctaaatgtttactgacata gctttattgaactcaactttaaaaaatagaattgaaaaccatatccaaag ttaggccaaagtagaggcaggaggattatgagtttgatgccagtgtaggc tgtatacttgagaccctgttccccagaaagcaaataaagcgcaaagcccc caaaacagaaggaggaggaggaggaggaggaaaaaagcgcctcgggctca gcagccttcctaagctgcttcacatgcatggttattcttgtcagagaagg aaatgatgatgtcatgtttttcacttctctgtaaatagaacctatctagc acatgtgggcttcctccagaaggattcacgatccaaaagtggtgggtgcg atccaccacctcaagcgtgggttcctgcaagtgacacacgagagctcact tagaacgctttctgaacggcgaatctgcatacaggcctcatcggttcctg caggacaggagccattttgttcttgtccagtagttttcgtgtgctccgag tccggcgctgtcagcgaagcacttgcattgcaagtgtgaagatctgagtt cgagcccccgaacacacagtgcatagtggtgtgcgcttcagggatggggg tttggagagagaaggattcctctatggtcagtttagcctgccaataagct tttatctcagcactcagaaaggcaacggtgattctgtgttgtcttttttg tttgtatgtttgttgttcatttgtatagccctgactaccaggagcccttt ctgtagatcaggctgggacttgaactcatagagatcaacctgcttctgcc tgagtgcagcttaaggtggtgccaccaccgcactcagctctatctgagcc cttgggagcctgctgtcagcaggcttcttaacagatggggaattgccctt tagctctgagctctctg
quality values	Open. Hide. 58 17 41 39 58 39 21 48 58 58 58 62 62 62 47 62 62 62 62 62 62 62 62 62 62 54 62 62 62 53 42 44 15 38 38 20 28 37 38 50 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 56 56 59 44 25 42 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 59 59 56 56 59 59 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 59 62 62 59 62 56 62 59 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 50 54 56 56 62 59 54 59 59 62 59 62 62 62 59 62 59 62 62 62 62 62 62 59 56 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 43 56 59 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 59 54 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 51 56 51 50 45 51 59 59 59 59 59 59 59 51 62 62 62 62 59 62 62 62 62 59 59 59 62 62 59 59 62 59 62 62 59 44 62 59 59 62 62 62 62 49 62 62 62 62 44 62 56 62 62 62 62 62 62 56 62 62 51 56 56 51 56 51 56 62 51 56 56 38 37 37 38 42 56 56 38 56 62 62 62 62 56 62 51 62 62 62 62 51 62 62 62 62 23 19 14 20 18 21 62 62 62 24 62 56 47 56 56 56 56 38 10 41 33 37 38 56 40 38 32 39 39 22 32 24 43 31 30 40 26 50 33 37 36 21 62 56 62 56 41 33 40 33 50 56 43 47 47 47 56 52 52 47 52 52 48 62 39 52 42 42 48 41 31 42 41 46 42 41 41 42 50 17 48 52 24 38 62 21 38 47 52 42 22 52 52 35 41 9 47 28 38 25 10 24 14 12 11 27 30 32 9 17 12 21 14 39 52 39 26 54 48 50 52 52 52 17 13 9 13 13 18 30 27 17 13 46 25 29 35 42 50 42 39 21 17 23 33 35 26 31 46 42 22 39 23 25 16 25 8 23 7 17 25 20 10 47 18 13 39 41 29 32 27 27 37 35 42 34 18 30 31 18 22 13 33 35 25 25 27 20 22 15 50 47 37 46 42 34 33 16 40 27 16 28 20 15 12 50 18 40 19 14 42 13 21 20 17 9 9 14 19 15 8 18 10 9 19 13 28 30 21 33 29 40 28 9 15 12 10 25 19 10 16 16 16 12 9 16 21 41 18 42 16 12 18 10 21 13 14 37 21 22 7 27 29 21 16 25 15 11 9 30 21 22 29 13 11	Open. Hide. 62 47 42 47 62 47 59 62 62 43 34 39 34 28 27 29 32 27 28 40 38 56 59 56 62 62 59 59 62 62 62 62 62 54 62 59 62 62 62 59 59 62 59 59 59 59 62 59 59 62 62 62 62 62 51 49 49 50 48 54 49 49 59 59 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 54 62 62 54 49 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 59 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 53 62 62 47 62 54 42 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 52 58 54 58 58 52 58 54 52 54 54 52 58 58 58 54 54 54 58 58 58 54 58 58 58 54 54 49 58 58 58 58 54 58 54 58 58 54 50 54 54 58 58 54 54 41 42 49 58 58 54 52 53 58 49 58 41 58 54 50 51 58 58 58 50 54 58 51 58 40 42 58 58 41 51 58 58 50 53 58 58 50 42 51 50 58 40 41 58 53 58 51 51 50 50 51 39 49 50 53 50 49 49 58 49 46 25 58 51 31 50 39 58 36 33 58 40 32 48 58 58 42 51 52 50 39 50 49 51 49 50 50 42 50 39 49 52 58 58 58 50 53 41 50 58 50 51 51 49 50 51 50 49 39 41 50 53 30 49 26 49 51 41 49 41 47 42 43 53 39 54 51 31 53 33 34 54 49 47 41 39 51 49 44 47 50 35 51 53 53 49 50 39 41 39 42 33 45 39 51 46 19 36 41 37 33 53 34 34 44 51 49 39 30 54 46 36 35 51 37 53 40 35 24 49 28 33 53 52 39 32 53 40 31 47 32 47 32 31 35 35 32 39 28 6 49 38 9 16 26 52 52 52 45 19 46 12 9 24 41 13 28 16 41 19 31 51 22 33 31 15 36 28 33 33 32 31 28 26 31 48 28 31 33 28 48 51 30 30 26 38 32 31 33 46 21 21 31 27 31 30 17 23 31 46 46 26 24 25 27 35 32 33 17 25 27 22 37 30 24 26 35 46 9 27 25 13 33 26 27 6 25 16 33 41 19 21 44 21 46 18 46 14 29 46 22 35 31 41 46 46 41 31 44 18 39 27 46 6 35 26 35 25 31 12 44 44 28 25 11 25 32 31 30 44 27 33 16 37 21 31 32 25 44 31 12 19 19 19 32 24 23 25 8 10 26 20 20 31 41 31 18 47 22 31 27 25 8 17 22 25 27 24 20 26 26 23 12 17 39 12 19 19 33 20 9 18 23 31 32 26 19 31 21 10 31 24 21 31 14 24 8 17 13 20 32 27 32 29 27 13 12 13 9 5 12 18 6 7 5 13 6 10 25 8 18 11 5 9 8 10 18 7 7 14 10 9 10 25 9 14 12 21 11 6 10 16 20 18 27 16 11 31 12 6 5 11 8 5 6 7 5 6 28 7 24 10 19 26 10 23 12 11 12 20 23 17 17 14 6 13 16 4 6 5 7 5 6 12 7 13 6 9 23 7 4 9 8 13 13 16 22 26 15 4 7 8 10 23 5 16 17 8 25 11 10 6 12 4 6 11 6 4 1 2 1 4 8 6 6 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_26162181_26163027
seq2: B6Ng01-263H23.b_48_901

seq1  GAATTCAGTAGGGGAAAGAGAAAAAAGGGAGATGGATGTTCCTAAAACCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTAGGGGAAAGAGAAAAAAGGGAGATGGATGTTCCTAAAACCC  50

seq1  CACGCGGGAAAGCTGCGAATTTTAAGGCTCAGAATCTCACATCAGCCTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACGCGGGAAAGCTGCGAATTTTAAGGCTCAGAATCTCACATCAGCCTCT  100

seq1  CCCTGTACTGGCTCTGTGGTCTTCTAGGCAGCCCAGGCGGAGGACTTGGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGTACTGGCTCTGTGGTCTTCTAGGCAGCCCAGGCGGAGGACTTGGC  150

seq1  TCTAGCTGTCTTTGCGCTGCTTGGAAATCTGCCTTGCTAGCTGCTGTGAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAGCTGTCTTTGCGCTGCTTGGAAATCTGCCTTGCTAGCTGCTGTGAC  200

seq1  CTCATAGGGATTGGGAGAGCTCCAGATCTGGGGGTGGGGGGAAGGTCCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATAGGGATTGGGAGAGCTCCAGATCTGGGGGTGGGGGGAAGGTCCTG  250

seq1  GTAAGGGAACTGTCAGAGGCCAAACAATGGCTTTCTCTGTGCAGGCTGCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGGGAACTGTCAGAGGCCAAACAATGGCTTTCTCTGTGCAGGCTGCC  300

seq1  TGTGCACCTGTGCCGGCAAAGGGCCCTCTATGCTTCTGTCTTGTCTGCAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCACCTGTGCCGGCAAAGGGCCCTCTATGCTTCTGTCTTGTCTGCAC  350

seq1  ACAGTAATGTCCATACATAGGCGGGACTTATAAATACCCTCCAGAGCAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTAATGTCCATACATAGGCGGGACTTATAAATACCCTCCAGAGCAGA  400

seq1  AGTGAAACCATCCACCAGTTCTCCTTTTCTCTGCTTAGTTGGAGCTCTGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAAACCATCCACCAGTTCTCCTTTTCTCTGCTTAGTTGGAGCTCTGC  450

seq1  AGCCCAGTGCAGCTGCTACAGAGGCTGGCATCCTCCCGCACCTCCCGCAC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCCAGTGCAGCTGCTACAGAGGCTGGCATCCTCCCGCACCTCCCGCAC  500

seq1  AGCGGATAGACCTGCTTGTAGTATCCCAGGGTAGGGAAGCATCTAACCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCGGATAGACCTGCTTGTAGTATCCCAGGGTAGGGAAGCATCTAACCAA  550

seq1  CACCCTCCTTAGAATGAGATGGGACACTGGGTGCTGGAGGGAGCGGAGGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCCTCCTTAGAATGAGATGGGACACTGGGTGCTGGAGGGAGCGGAGGC  600

seq1  ATCCACTCACA-TTCACAGAGAGGAAACGCTGGTCTGGGGGTGGACATTT  649
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  ATCCACTCACATTTCACAGAGAGGAAACGCTGGTCTGGGGGTGGACATTT  650

seq1  ACCTGTACGTAG-AACGTCCTGGAGGTGGTTATGATTTC-AAACAGGTTG  697
      |||||||||||| |||||||||||||||||||||||||| ||||||||||
seq2  ACCTGTACGTAGAAACGTCCTGGAGGTGGTTATGATTTCAAAACAGGTTG  700

seq1  TCCCTCATTAAGAGATCACTAGGCAAGGAGAGAGAGAGATA-CCATTACA  746
      ||||||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TCCCTCATTAAGAGATCACTAGGCAAGGAGAGAGAGAGATACCCATTACA  750

seq1  CTAAGCATTGTGAGAAC-TTTTTTTTTCCACGTTATTT-CCTACAGTTTT  794
      ||||||||||||||||| |||||||||||||||||||| |||||||||| 
seq2  CTAAGCATTGTGAGAACTTTTTTTTTTCCACGTTATTTCCCTACAGTTTC  800

seq1  CACGGTCACCCACTAATGCAACTCAAGACTTTCTCC-TTCCTGTGGA-TA  842
      || ||||||||||||||||||||||||||||||||| ||| |||||| ||
seq2  CA-GGTCACCCACTAATGCAACTCAAGACTTTCTCCTTTCTTGTGGATTA  849

seq1  AGGCA  847
      |||||
seq2  AGGCA  854

seq1: chr8_26297494_26298602
seq2: B6Ng01-263H23.g_63_1179 (reverse)

seq1  CAGAG-GCTCAGAGCT-AAGGGCA--TTCCCATCTGTT-AGA--GCTGCT  43
      ||||| |||||||||| |||||||  | |||||||||| |||   |||||
seq2  CAGAGAGCTCAGAGCTAAAGGGCAATTCCCCATCTGTTAAGAAGCCTGCT  50

seq1  GACAGCAGGCTCC--AAGGCTCAGAATAGAAGCTGAGTGCGGTGGT-GCA  90
      |||||||||||||  | ||||||| |||| |||||||||||||||| |||
seq2  GACAGCAGGCTCCCAAGGGCTCAG-ATAG-AGCTGAGTGCGGTGGTGGCA  98

seq1  CACCTTTAAGCTGGCACTCAGGGCAGAAGCAGGTTGATCTCTATGAGTTC  140
      |  | ||||||| ||||||| |||||||||||||||||||||||||||||
seq2  CCACCTTAAGCT-GCACTCA-GGCAGAAGCAGGTTGATCTCTATGAGTTC  146

seq1  AAGT-CCAGCCTGATCTACAGAAAGGGCTCCTGGTAGTCAGGGCTATACA  189
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCCCAGCCTGATCTACAGAAAGGGCTCCTGGTAGTCAGGGCTATACA  196

seq1  AATGAACAAACAAACATACAAACAAAAAAGACAACACAGAATCACCGTTG  239
      ||||||| ||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAC-AACAAACATACAAACAAAAAAGACAACACAGAATCACCGTTG  245

seq1  CC-TTCTGAGTGCTGAGATAAAAGCTTATTGGCAGGCTAAACTGACCATA  288
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTCTGAGTGCTGAGATAAAAGCTTATTGGCAGGCTAAACTGACCATA  295

seq1  GAGGAATCCTTCTCTCTCCAAA-CCCCATCCCTGAAGCGCACACCACTAT  337
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  GAGGAATCCTTCTCTCTCCAAACCCCCATCCCTGAAGCGCACACCACTAT  345

seq1  GCACTGTGTGTTCGGGGGCTCGAACTCAGATCTTCACACTTGCAATGCAA  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGTGTGTTCGGGGGCTCGAACTCAGATCTTCACACTTGCAATGCAA  395

seq1  GTGCTTCGCTGACAGCGCCGGACTCGGAGCACACGAAAACTACTGGACAA  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTTCGCTGACAGCGCCGGACTCGGAGCACACGAAAACTACTGGACAA  445

seq1  GAACAAAATGGCTCCTGTCCTGCAGGAACCGATGAGGCCTGTATGCAGAT  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAAAATGGCTCCTGTCCTGCAGGAACCGATGAGGCCTGTATGCAGAT  495

seq1  TCGCCGTTCAGAAAGCGTTCTAAGTGAGCTCTCGTGTGTCACTTGCAGGA  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGCCGTTCAGAAAGCGTTCTAAGTGAGCTCTCGTGTGTCACTTGCAGGA  545

seq1  ACCCACGCTTGAGGTGGTGGATCGCACCCACCACTTTTGGATCGTGAATC  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCACGCTTGAGGTGGTGGATCGCACCCACCACTTTTGGATCGTGAATC  595

seq1  CTTCTGGAGGAAGCCCACATGTGCTAGATAGGTTCTATTTACAGAGAAGT  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGGAGGAAGCCCACATGTGCTAGATAGGTTCTATTTACAGAGAAGT  645

seq1  GAAAAACATGACATCATCATTTCCTTCTCTGACAAGAATAACCATGCATG  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAACATGACATCATCATTTCCTTCTCTGACAAGAATAACCATGCATG  695

seq1  TGAAGCAGCTTAGGAAGGCTGCTGAGCCCGAGGCGCTTTTTTCCTCCTCC  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCAGCTTAGGAAGGCTGCTGAGCCCGAGGCGCTTTTTTCCTCCTCC  745

seq1  TCCTCCTCCTCCTTCTGTTTTGGGGGCTTTGCGCTTTATTTGCTTTCTGG  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCCTCCTCCTTCTGTTTTGGGGGCTTTGCGCTTTATTTGCTTTCTGG  795

seq1  GGAACAGGGTCTCAAGTATACAGCCTACACTGGCATCAAACTCATAATCC  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACAGGGTCTCAAGTATACAGCCTACACTGGCATCAAACTCATAATCC  845

seq1  TCCTGCCTCTACTTTGGCCTAACTTTGGATATGGTTTTCAATTCTATTTT  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGCCTCTACTTTGGCCTAACTTTGGATATGGTTTTCAATTCTATTTT  895

seq1  TTAAAGTTGAGTTCAATAAAGCTATGTCAGTAAACATTTAGACACAAGGG  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGTTGAGTTCAATAAAGCTATGTCAGTAAACATTTAGACACAAGGG  945

seq1  TTAAGAGAGGCGGGGTACAGAATTAAGATGCACTCTGCAGGGCATGGGTG  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGAGAGGCGGGGTACAGAATTAAGATGCACTCTGCAGGGCATGGGTG  995

seq1  TGGGCTTTTATTAAAAGGTGAACAGACTATAAACACAAGGCTAAGAGTAG  1037
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTTTTATTAAAAGGTGAACAGACTATAAACACAAGGCTAAGAGTAG  1045

seq1  AGATGTCTGTCGGGCTGGACAGATGGCTCAGTGGTTAAGAAAACTGGCTG  1087
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGTCTGTCGGGCTGGACAGATGGCTCAGTGGTTAAGAAAACTGGCTG  1095

seq1  CTCTTCCAGAGGTCCTGAATTC  1109
      ||||||||||||||||||||||
seq2  CTCTTCCAGAGGTCCTGAATTC  1117

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information