MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-269C16
Chromosome	8 (Build37)
Map Location	13,656,991 - 13,658,101
singlet/doublet	singlet
Overlap gene	Rasa3
Upstream gene	Tubgcp3, Atp11a, LOC100040229, Mcf2l, F7, F10, Proz, Pcid2, Cul4a, Lamp1, Grtp1, Adprhl1, Dcun1d2, Tmco3, Tfdp1, Atp4b, Grk1, Gm687, Gas6, LOC434282, 1700029H14Rik
Downstream gene	4932443I19Rik, LOC665516, Cdc16, Upf3a, AF366264, D8Ertd457e, 2410022L05Rik, EG665536, Fbxo25, LOC100041103, 2610019F03Rik, EG546036, Erich1, Dlgap2, LOC100041140
Link	Open Mouse BAC browser

Click to get alignment info.

name	Tubgcp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259279 MGI:2183752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50770 MGI:1354735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040229 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Mcf2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17207 MGI:103263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14068 MGI:109325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14058 MGI:103107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Proz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66901 MGI:1860488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234069 MGI:2443003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cul4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:99375 MGI:1914487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lamp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16783 MGI:96745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grtp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66790 MGI:1914040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adprhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234072 MGI:2442168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dcun1d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102323 MGI:2142792
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Tmco3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234076 MGI:2444946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tfdp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21781 MGI:101934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11945 MGI:88114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Grk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24013 MGI:1345146
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm687 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272465 MGI:2685533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	Gas6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14456 MGI:95660
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434282 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	1700029H14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66501 MGI:1913751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rasa3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19414 MGI:1197013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4932443I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:403185 MGI:2685952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC665516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 220 ESTs, 7 Proteins pseudo : _no_value

name	Cdc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69957 MGI:1917207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upf3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67031 MGI:1914281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AF366264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:231201 MGI:2667157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D8Ertd457e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101994 MGI:1196398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410022L05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66423 MGI:1913673
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665536 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665536 MGI:3644053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 57 ESTs, 11 Proteins

name	Fbxo25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66822 MGI:1914072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041103 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs

name	2610019F03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72148 MGI:1919398
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546036 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546036 MGI:3643437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Erich1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234086 MGI:3588201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlgap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244310 MGI:2443181
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041140 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs, 21 Proteins

name	Tubgcp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930566 GeneID:259279 MGI:2183752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tubulin, gamma complex associated protein 3 transcript_id : NM_198031.1

name	Atp11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131089 GeneID:50770 MGI:1354735
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, class VI, type 11A transcript_id : NM_015804.2

name	LOC100040229 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258363 GeneID:100040229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040229 transcript_id : XM_001474320.1

name	Mcf2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849759 GeneID:17207 MGI:103263
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mcf.2 transforming sequence-like transcript_id : NM_178076.2

name	F7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802834 GeneID:14068 MGI:109325
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor VII transcript_id : NM_010172.2

name	F10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625993 GeneID:14058 MGI:103107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor X transcript_id : NM_007972.3

name	Proz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130262 GeneID:66901 MGI:1860488
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein Z, vitamin K-dependent plasma glycoprotein transcript_id : NM_025834.3

name	Pcid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119372295 GeneID:234069 MGI:2443003
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PCI domain containing 2 transcript_id : NM_178708.3

name	Cul4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22164789 GeneID:99375 MGI:1914487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cullin 4A transcript_id : NM_146207.1

name	Lamp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195677 GeneID:16783 MGI:96745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated membrane protein 1 transcript_id : NM_010684.2

name	Grtp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861225 GeneID:66790 MGI:1914040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GH regulated TBC protein 1 transcript_id : NM_025768.2

name	Adprhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802921 GeneID:234072 MGI:2442168
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ADP-ribosylhydrolase like 1 transcript_id : NM_172750.2

name	Dcun1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111162656 GeneID:102323 MGI:2142792
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) transcript_id : NM_001042650.1

name	Dcun1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111162654 GeneID:102323 MGI:2142792
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) transcript_id : NM_001042649.1

name	Dcun1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111162660 GeneID:102323 MGI:2142792
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) transcript_id : NM_001042651.1

name	Dcun1d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111162658 GeneID:102323 MGI:2142792
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) transcript_id : NM_001024504.2

name	Tmco3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861263 GeneID:234076 MGI:2444946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane and coiled-coil domains 3 transcript_id : NM_172282.2

name	Tfdp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130413 GeneID:21781 MGI:101934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription factor Dp 1 transcript_id : NM_009361.2

name	Atp4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892578 GeneID:11945 MGI:88114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+/K+ exchanging, beta polypeptide transcript_id : NM_009724.2

name	Grk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:67514550 GeneID:24013 MGI:1345146
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor kinase 1 transcript_id : NM_011881.2

name	Gas6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506714 GeneID:14456 MGI:95660
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest specific 6 transcript_id : NM_019521.1

name	LOC434282 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258380 GeneID:434282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical gene supported by AK089977 transcript_id : XM_001475714.1

name	1700029H14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244071 GeneID:66501 MGI:1913751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029H14 gene transcript_id : NM_025601.2

name	1700029H14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244074 GeneID:66501 MGI:1913751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700029H14 gene transcript_id : NM_001080781.1

name	Rasa3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120444917 GeneID:19414 MGI:1197013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS p21 protein activator 3 transcript_id : NM_009025.2

name	4932443I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383036 GeneID:403185 MGI:2685952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4932443I19 gene, transcript variant 1 transcript_id : XM_620624.3

name	Cdc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:68448514 GeneID:69957 MGI:1917207
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CDC16 cell division cycle 16 homolog (S. cerevisiae) transcript_id : NM_027276.2

name	Upf3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249088 GeneID:67031 MGI:1914281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UPF3 regulator of nonsense transcripts homolog A (yeast) transcript_id : NM_025924.2

name	AF366264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83281196 GeneID:231201 MGI:2667157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AF366264 transcript_id : NM_153093.2

name	D8Ertd457e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469496 GeneID:101994 MGI:1196398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 8, ERATO Doi 457, expressed transcript_id : NM_181854.1

name	2410022L05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802113 GeneID:66423 MGI:1913673
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410022L05 gene transcript_id : NM_025556.2

name	EG665536 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258383 GeneID:665536 MGI:3644053
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 57 ESTs, 11 Proteins product : predicted gene, EG665536 transcript_id : XM_977607.2

name	Fbxo25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368939 GeneID:66822 MGI:1914072
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 25 transcript_id : NM_025785.2

name	LOC100041103 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258384 GeneID:100041103
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs product : hypothetical protein LOC100041103 transcript_id : XM_001476013.1

name	2610019F03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801738 GeneID:72148 MGI:1919398
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610019F03 gene transcript_id : NM_173744.3

name	EG546036 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383044 GeneID:546036 MGI:3643437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : predicted gene, EG546036 transcript_id : XM_898878.2

name	Erich1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893029 GeneID:234086 MGI:3588201
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutamate-rich 1 transcript_id : NM_001034862.2

name	Dlgap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359060 GeneID:244310 MGI:2443181
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large (Drosophila) homolog-associated protein 2 transcript_id : NM_172910.2

name	LOC100041140 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258386 GeneID:100041140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 67 ESTs, 21 Proteins product : similar to high-mobility group box 1 transcript_id : XM_001476097.1

name	Tubgcp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930567 CCDS:CCDS22103.1 GeneID:259279 MGI:2183752
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005815 - microtubule organizing center [Evidence IEA]; GO:0000922 - spindle pole [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 product : tubulin, gamma complex associated protein 3 protein_id : NP_932148.1

name	Atp11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7656914 GeneID:50770 MGI:1354735
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004012 - phospholipid-translocating ATPase activity [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : ATPase, class 1, member h; ATPase 11A, p type; ATPase 11A, class VI product : ATPase, class VI, type 11A protein_id : NP_056619.1

name	LOC100040229 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258364 GeneID:100040229
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474370.1

name	Mcf2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559374 GeneID:17207 MGI:103263
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0016020 - membrane [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005545 - phosphatidylinositol binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IDA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007266 - Rho protein signal transduction [Evidence IDA] codon_start : 1 note : exchange factor for RhoA and Cdc42; guanine nucleotide exchange factor OSTIII product : mcf.2 transforming sequence-like protein_id : NP_835177.1

name	F7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753806 CCDS:CCDS22104.1 GeneID:14068 MGI:109325
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003802 - coagulation factor VIIa activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : coagulation factor VII protein_id : NP_034302.1

name	F10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625994 GeneID:14058 MGI:103107
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003804 - coagulation factor Xa activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA] codon_start : 1 product : coagulation factor X protein_id : NP_031998.3

name	Proz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385306 CCDS:CCDS22105.1 GeneID:66901 MGI:1860488
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IMP] [Evidence IDA] codon_start : 1 product : protein Z, vitamin K-dependent plasma glycoprotein protein_id : NP_080110.1

name	Pcid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119372296 GeneID:234069 MGI:2443003
definition	codon_start : 1 product : PCI domain containing 2 protein_id : NP_848823.2

name	Cul4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22164790 GeneID:99375 MGI:1914487
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : cullin 4A protein_id : NP_666319.1

name	Lamp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195678 CCDS:CCDS22106.1 GeneID:16783 MGI:96745
definition	GO_component : GO:0005770 - late endosome [Evidence IDA] [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005771 - multivesicular body [Evidence IDA]; GO:0042383 - sarcolemma [Evidence IDA] codon_start : 1 note : Lamp I product : lysosomal membrane glycoprotein 1 protein_id : NP_034814.2

name	Grtp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861226 CCDS:CCDS22107.1 GeneID:66790 MGI:1914040
definition	codon_start : 1 product : GH regulated TBC protein 1 protein_id : NP_080044.2

name	Adprhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370110 CCDS:CCDS22108.1 GeneID:234072 MGI:2442168
definition	GO_function : GO:0003875 - ADP-ribosylarginine hydrolase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 note : ADP-ribosylhydrolase 2 product : ADP-ribosylhydrolase like 1 protein_id : NP_766338.1

name	Dcun1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111162657 GeneID:102323 MGI:2142792
definition	codon_start : 1 note : isoform d is encoded by transcript variant 4 product : DCN1, defective in cullin neddylation 1, domain containing 2 isoform d protein_id : NP_001036115.1

name	Dcun1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111162659 GeneID:102323 MGI:2142792
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1 product : DCN1, defective in cullin neddylation 1, domain containing 2 isoform a protein_id : NP_001019675.2

name	Dcun1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111162661 GeneID:102323 MGI:2142792
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2 product : DCN1, defective in cullin neddylation 1, domain containing 2 isoform b protein_id : NP_001036116.1

name	Dcun1d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111162655 GeneID:102323 MGI:2142792
definition	codon_start : 1 note : isoform c is encoded by transcript variant 3 product : DCN1, defective in cullin neddylation 1, domain containing 2 isoform c protein_id : NP_001036114.1

name	Tmco3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986589 GeneID:234076 MGI:2444946
definition	GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0031177 - phosphopantetheine binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : transmembrane and coiled-coil domains 3 protein_id : NP_758486.1

name	Tfdp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678305 CCDS:CCDS22110.1 GeneID:21781 MGI:101934
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0008544 - epidermis development [Evidence IMP]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0000084 - S phase of mitotic cell cycle [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription factor Dp 1 protein_id : NP_033387.1

name	Atp4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753142 CCDS:CCDS22111.1 GeneID:11945 MGI:88114
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : H+,K+-ATPase; H,K-ATPase-Beta product : ATPase, H+/K+ transporting, beta polypeptide, gastric specific protein_id : NP_033854.1

name	Grk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67514551 CCDS:CCDS22112.1 GeneID:24013 MGI:1345146
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004703 - G-protein coupled receptor kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G-Protein receptor kinase 1; rhodopsin kinase product : G protein-coupled receptpr kinase 1 protein_id : NP_036011.2

name	Gas6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506715 GeneID:14456 MGI:95660
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : GAS 6; growth arrest-specific product : growth arrest specific 6 protein_id : NP_062394.1

name	LOC434282 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258381 GeneID:434282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475764.1

name	1700029H14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385056 GeneID:66501 MGI:1913751
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : hypothetical protein LOC66501 isoform 1 protein_id : NP_079877.1

name	1700029H14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124244075 GeneID:66501 MGI:1913751
definition	codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : hypothetical protein LOC66501 isoform 2 protein_id : NP_001074250.1

name	Rasa3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120444918 GeneID:19414 MGI:1197013
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0051056 - regulation of small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : GAPIII activator 3; Ras GTPase-activating protein III product : RAS p21 protein activator 3 protein_id : NP_033051.2

name	4932443I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63572059 GeneID:403185 MGI:2685952
definition	codon_start : 1 product : hypothetical protein LOC403185 isoform 1 protein_id : XP_620624.1

name	Cdc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:68448515 CCDS:CCDS22114.1 GeneID:69957 MGI:1917207
definition	GO_component : GO:0005813 - centrosome [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA]; GO:0005876 - spindle microtubule [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : anaphase-promoting complex subunit 6 product : CDC16 cell division cycle 16 homolog protein_id : NP_081552.2

name	Upf3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313164 GeneID:67031 MGI:1914281
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0003729 - mRNA binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006986 - response to unfolded protein [Evidence ISS] codon_start : 1 product : UPF3 regulator of nonsense transcripts homolog A protein_id : NP_080200.1

name	AF366264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83281197 GeneID:231201 MGI:2667157
definition	GO_function : GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : SUMO-1-specific protease product : SUMO-1 specific protease 4 protein_id : NP_694733.2

name	D8Ertd457e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469497 CCDS:CCDS22116.1 GeneID:101994 MGI:1196398
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC101994 protein_id : NP_862902.1

name	2410022L05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384986 GeneID:66423 MGI:1913673
definition	codon_start : 1 product : hypothetical protein LOC66423 protein_id : NP_079832.1

name	EG665536 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383043 GeneID:665536 MGI:3644053
definition	codon_start : 1 product : similar to Interferon induced transmembrane protein 1 protein_id : XP_982701.1

name	Fbxo25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385252 CCDS:CCDS22118.1 GeneID:66822 MGI:1914072
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box only protein 25 protein_id : NP_080061.1

name	LOC100041103 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258385 GeneID:100041103
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476063.1

name	2610019F03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424579 CCDS:CCDS22119.1 GeneID:72148 MGI:1919398
definition	codon_start : 1 product : hypothetical protein LOC72148 protein_id : NP_776105.1

name	EG546036 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383045 GeneID:546036 MGI:3643437
definition	codon_start : 1 product : hypothetical protein protein_id : XP_903971.2

name	Erich1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133893030 GeneID:234086 MGI:3588201
definition	codon_start : 1 product : glutamate-rich 1 protein_id : NP_001030034.2

name	LOC100041140 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258387 GeneID:100041140
definition	codon_start : 1 product : similar to high-mobility group box 1 protein_id : XP_001476147.1

name	Dlgap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370396 GeneID:244310 MGI:2443181
definition	GO_process : GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 exception : mismatches in translation note : PSD-95/SAP90-binding protein 2; SAP90/PSD-95-associated protein 2 product : SAP90/PSD-95 associated protein 2 protein_id : NP_766498.1

name	Gm687 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149258379 GeneID:272465 MGI:2685533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : gene model 687, (NCBI) transcript_id : XR_032384.1

name	LOC665516 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258382 GeneID:665516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 220 ESTs, 7 Proteins product : similar to 3-phosphoglycerate dehydrogenase pseudo : _no_value transcript_id : XR_032429.1

clone name	MSMg01-368B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505P24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-104O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237B06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-473O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443B16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-309I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142N12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289E03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-269C16.b	B6Ng01-269C16.g
ACC	GA071837	GA071838
length	1,160	1,103
definition	B6Ng01-269C16.b	B6Ng01-269C16.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaactgaggaataccgaatggctgagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgaaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctacgatcaaaaattcaggtgacagc agatgctggcaaggatgtggagaaagaggatcactcctccattgttggtg ggattgcaagcttgttcaaccactctggaaatcagtctggcagttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagatgtcccaaccggtaagaaggacacatgctctactat gttcatagcagccttatttataatagccagaaggtggaaagaacccagat gccgctcaacagaggaatgaatacagaaaatgtggtacatttacacactg gagtactactcagctattaaaaagaatgaatttatgaaattcctaggcaa atggatggaccttgagggcatcatactgagtgaggtaacccaatcacaaa agaactcacatgatatgtattcactgataagtggatgttagcccagaaac ttagaatacccaagatataagttacaatttgcaaaacacatgaaactcaa gaacgaagatcaaagtgtggacactttgccccttcttcgaattggtaaca aaacacccatggaaggagttacaaagtttggagctgagacaaaaggatgg accatatagagactaccatatccagggttccatcccataatcagcctcca aacactgacaccatcgcatatactagcaaggttttgctgaaaggaccctg atatagctgtctcttgtgagactatgccggggcctagcaaacacataagt ggatgctcacagtcagctattggatggatcacaggggcccccagtgggag gagctacagaaagtacccaaggagctaaagggatctgcacctataggtag aacaacattatgaactaactacgaccccggagctcttactctagctgcat aaggtaatcaaagatggcctagtagccatcactgcaagagagccttgact gcaaactttatatgcccaatacaggcaacacaaggttcaatggtattggt gggggatacg	gaattcctgcccatcaggaagcctgacccctatgtccaacgtgaaaaact gaccacaggtacatcccaagacagtgtgcaaaacacaaagtccacctggt tccttgcaactgtgtcacctttcagagcttctggctataagacccaactt ccaatcagaatcagcacgagcccaaacaattggactggcaagatggctcc atggttaataacgctggctcttccagagggccaggttgattctcagcacc cacaatgtgattaacaactgtctataactctagttcctgcatatctgata ttttctcctggcctcgaagggcaatgtattcacgtggtgcacagacattg catgcacaggaaatgaaaacaaaatcttttttttaaaaaaggttctcaat atttttttaacgtttaaacagagctaataatcaagatttagagtgttctt cacttcactgcaatttaaagtaatcgcgtctacctaactgcgcactgctt gattaaagaagggtcccgcagcccacgggtggccattttctctagctctg cgccaacagaaccatttcgccctgaatcttgctccctggggtttcatctt catctcctccttctggaaatgattctctccccgacaccggttctattttt agctcgcagaaccagagccttcacccagtggagactcatttactgtccaa ccagcaagtgaccttaatcttctgtgaattacaatcaactggacaggaaa tccccagctcggacgtccaccagtccatctaagaaacgacctcctggggc tccaggcctgactaaggaccccaaatcccaccaagcccaggcaaaaagaa aggcagagggcgggagaagtcagtatgtgtaaggagacagtgccatggtt acatggggctcacagcggcagacaccgtgctctgtcaaagtgtcccggtg tagaagggttttcctgcatctgcctgttgcatagcttgggaatctgaccc tctcactgtcaacctgctggaggagaggtggtgtggtctctctcgtctcc tcccacatccagtgtgagctctggacggtttcctggccaatcctgttata tac
quality values	Open. Hide. 41 22 13 32 58 52 58 30 32 45 58 58 40 36 36 62 47 43 35 54 47 62 62 49 62 62 62 62 62 62 56 47 20 25 32 21 36 38 44 56 56 62 44 62 62 62 62 56 59 62 62 62 59 59 62 62 62 62 62 62 49 43 62 62 62 59 62 62 62 59 62 62 59 54 62 62 59 62 62 59 56 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 54 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 54 47 54 62 62 45 47 62 62 62 62 62 62 52 62 62 62 62 62 58 58 54 58 58 58 52 54 58 58 58 49 54 58 58 58 58 58 58 58 58 52 58 58 58 58 54 54 58 54 58 58 58 58 42 54 58 54 58 52 58 58 46 54 51 58 58 39 58 58 58 58 46 58 41 49 52 49 58 54 52 58 54 54 54 53 53 54 58 54 58 54 52 54 48 58 58 58 58 54 54 58 58 58 58 49 51 58 51 58 58 58 58 48 49 58 46 40 47 48 58 43 45 50 58 58 46 41 33 52 50 58 58 52 53 54 39 58 44 48 40 50 51 58 58 58 50 58 58 58 58 54 51 51 58 52 49 50 58 32 50 54 58 46 39 52 46 50 27 58 58 46 53 46 41 58 50 50 50 54 48 54 39 22 58 51 30 54 50 33 53 29 58 58 47 50 58 58 51 33 53 31 52 53 50 58 25 41 39 30 58 58 43 33 58 28 20 54 54 31 34 41 32 53 42 53 42 45 40 35 33 45 42 39 51 50 35 51 38 39 24 30 28 50 54 51 33 49 40 52 31 35 33 54 45 32 41 29 53 40 37 34 32 54 53 52 45 52 37 54 47 32 37 39 42 47 31 37 31 37 40 24 37 37 13 32 43 52 40 40 29 37 34 29 31 39 24 32 32 53 40 53 49 40 32 36 52 30 45 52 36 33 34 28 15 52 46 33 30 26 24 28 31 34 31 31 42 31 35 45 43 30 27 21 28 29 29 42 24 41 22 39 31 31 31 25 46 31 48 46 30 24 31 31 31 17 31 30 40 38 28 25 32 23 30 15 30 25 42 34 31 30 22 31 36 43 34 31 26 24 9 14 31 27 33 38 33 21 33 23 27 27 10 15 27 35 13 24 26 27 29 26 11 46 46 9 10 32 46 46 25 26 24 11 13 44 11 36 24 7 31 13 32 33 24 34 23 22 31 38 26 23 29 24 31 48 33 13 25 25 23 34 24 35 33 16 43 16 25 48 32 22 24 27 32 34 22 31 21 28 16 13 19 11 19 14 25 21 32 34 11 20 13 30 29 18 34 32 24 16 10 30 22 32 32 20 31 29 32 27 28 12 27 11 33 26 18 9 6 21 11 26 14 6 9 15 21 9 12 16 15 19 19 28 26 24 27 16 16 9 9 22 27 15 6 9 9 16 18 15 13 4 9 11 9 21 10 11 24 11 4 3 3 5 3 9 9 16 21 6 14 18 2 1 5 5 5 15 10 14 14 5 7 11 11 8 3 7 24 11 9 14 10 10 13 20 28 22 7 5 13 23 6 17 19 16 7 5 13 10 17 4 11 5 3 3 7 8 4 21 4 4 20 25 6 6 3 3 5 1 2 7 3 11 4 4 19 5 1 2 9 16 7 1 3 6 6 5 17	Open. Hide. 46 35 37 44 62 62 62 62 62 62 45 44 39 32 28 27 25 49 33 46 51 62 54 62 62 59 59 62 62 62 59 62 62 62 62 62 54 49 62 62 62 59 59 59 62 62 62 62 59 62 62 59 62 59 59 62 62 59 62 42 54 62 54 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 58 54 52 58 58 58 58 58 58 58 58 58 58 58 46 54 54 58 58 58 58 58 58 58 58 54 54 58 58 54 58 58 58 54 58 36 41 58 58 54 54 58 54 45 39 44 54 58 58 58 49 54 41 41 58 58 58 58 54 54 58 58 58 54 58 54 54 47 46 54 58 58 58 58 58 58 51 50 58 58 58 58 50 50 58 50 52 50 48 50 50 48 54 51 51 51 58 58 58 58 50 47 58 41 41 51 52 51 49 51 48 48 50 49 50 58 50 50 48 43 42 50 58 48 42 50 52 49 58 58 58 54 50 49 50 58 53 58 52 53 37 58 40 25 49 50 47 39 32 51 44 51 51 50 42 50 44 44 50 46 42 54 50 53 31 39 29 58 40 52 41 58 31 40 49 54 58 52 51 28 31 51 44 49 35 50 49 51 51 49 49 39 39 25 44 54 52 30 40 52 37 47 51 53 50 49 49 38 51 32 40 53 37 37 18 54 51 37 24 51 40 44 51 54 33 22 36 37 54 51 54 47 42 33 35 34 27 32 42 42 35 31 36 46 31 24 31 37 37 32 32 32 32 32 31 40 35 52 31 36 32 27 19 47 29 44 45 42 34 28 42 29 36 34 24 33 32 26 46 47 31 29 42 21 30 28 28 33 24 34 31 31 42 34 31 31 18 8 22 28 16 41 40 23 27 40 17 29 23 37 29 25 20 28 24 32 31 28 32 32 31 19 22 29 32 46 48 48 42 25 42 46 31 32 42 15 30 19 30 6 46 29 28 11 38 7 39 8 33 33 13 31 35 31 30 27 29 31 31 32 33 26 28 31 22 28 32 30 31 23 30 31 31 31 18 39 19 26 31 31 32 10 14 29 17 31 27 43 44 31 17 31 21 12 17 31 19 31 18 25 21 31 21 26 6 20 26 21 25 21 33 31 28 31 30 25 23 31 33 48 12 4 7 21 20 24 36 19 26 32 22 27 8 8 14 33 19 5 32 6 22 43 43 24 15 17 8 21 34 24 23 10 29 10 8 24 24 22 15 11 19 17 23 28 7 11 9 27 23 9 28 7 25 18 10 15 20 17 24 9 27 6 30 9 19 13 6 23 4 10 7 19 19 16 19 7 24 28 22 16 18 6 27 21 16 24 5 5 11 27 10 20 21 5 7 15 7 4 6 9 19 8 12 4 7 5 1 2 13 9 5 16 12 9 28 18 6 6 4 1 11 11 6 4 3 4 4 6 13 17 6 16 9 15 6 15 11 5 13 13 10 28 19 4 8 3 3 16 5 7 7 5 28 5 9 9 22 5 14 7 6 7 17 6 3

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_13656991_13658101
seq2: B6Ng01-269C16.g_66_1168

seq1  GAATTCCTGCCCATCAGGAAGCCTGACCCCTATGTCCAACGTGAAAAACT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTGCCCATCAGGAAGCCTGACCCCTATGTCCAACGTGAAAAACT  50

seq1  GACCACAGGTACATCCCAAGACAGTGTGCAAAACACAAAGTCCACCTGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCACAGGTACATCCCAAGACAGTGTGCAAAACACAAAGTCCACCTGGT  100

seq1  TCCTTGCAACTGTGTCACCTTTCAGAGCTTCTGGCTATAAGACCCAACTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTGCAACTGTGTCACCTTTCAGAGCTTCTGGCTATAAGACCCAACTT  150

seq1  CCAATCAGAATCAGCACGAGCCCAAACAATTGGACTGGCAAGATGGCTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAATCAGAATCAGCACGAGCCCAAACAATTGGACTGGCAAGATGGCTCC  200

seq1  ATGGTTAATAACGCTGGCTCTTCCAGAGGGCCAGGTTGATTCTCAGCACC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTTAATAACGCTGGCTCTTCCAGAGGGCCAGGTTGATTCTCAGCACC  250

seq1  CACAATGTGATTAACAACTGTCTATAACTCTAGTTCCTGCATATCTGATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAATGTGATTAACAACTGTCTATAACTCTAGTTCCTGCATATCTGATA  300

seq1  TTTTCTCCTGGCCTCGAAGGGCAATGTATTCACGTGGTGCACAGACATTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCTCCTGGCCTCGAAGGGCAATGTATTCACGTGGTGCACAGACATTG  350

seq1  CATGCACAGGAAATGAAAACAAAATCTTTTTTTTAAAAAAGGTTCTCAAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGCACAGGAAATGAAAACAAAATCTTTTTTTTAAAAAAGGTTCTCAAT  400

seq1  ATTTTTTTAACGTTTAAACAGAGCTAATAATCAAGATTTAGAGTGTTCTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTTTAACGTTTAAACAGAGCTAATAATCAAGATTTAGAGTGTTCTT  450

seq1  CACTTCACTGCAATTTAAAGTAATCGCGTCTACCTAACTGCGCACTGCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTCACTGCAATTTAAAGTAATCGCGTCTACCTAACTGCGCACTGCTT  500

seq1  GATTAAAGAAGGGTCCCGCAGCCCACGGGTGGCCATTTTCTCTAGCTCTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTAAAGAAGGGTCCCGCAGCCCACGGGTGGCCATTTTCTCTAGCTCTG  550

seq1  CGCCAACAGAACCATTTCGCCCTGAATCTTGCTCCCTGGGGTTTCATCTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCAACAGAACCATTTCGCCCTGAATCTTGCTCCCTGGGGTTTCATCTT  600

seq1  CATCTCCTCCTTCTGGAAATGATTCTCTCCCCGACACCGGTTCTATTTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTCCTCCTTCTGGAAATGATTCTCTCCCCGACACCGGTTCTATTTTT  650

seq1  AGCTCGCAGAACCAGAGCCTTCACCCAGTGGAGACTCATTTACTGTCCAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTCGCAGAACCAGAGCCTTCACCCAGTGGAGACTCATTTACTGTCCAA  700

seq1  CCAGCAAGTGACCTTAATCTTCTGTGAATTACAATCAACTGGACAGGAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCAAGTGACCTTAATCTTCTGTGAATTACAATCAACTGGACAGGAAA  750

seq1  TCCCCAGCTCGGACGTCCACCAGTCCATCTAAGAAACGACCTCCTGGGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCCAGCTCGGACGTCCACCAGTCCATCTAAGAAACGACCTCCTGGGGC  800

seq1  TCCAGGCCTGACTAAGGACCCCAAATCCCACCAAGCCCAGGCAAAAAGAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGCCTGACTAAGGACCCCAAATCCCACCAAGCCCAGGCAAAAAGAA  850

seq1  AGGCAGAGGGC-GGAGAAGTCAGTATGTGTAAGGAGACAGTGCCATGGTT  899
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGAGGGCGGGAGAAGTCAGTATGTGTAAGGAGACAGTGCCATGGTT  900

seq1  ACATGGGGCTCACAGCGGCAGACACCGTGCTCTGTCAAAGGTGTCCCGGT  949
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  ACATGGGGCTCACAGCGGCAGACACCGTGCTCTGTCAAA-GTGTCCCGGT  949

seq1  GTAGAAGGGTTTTCCTGCATCTTGCCTGTTGCATAGGCTTTGGAATCTGA  999
      ||||||||||||||||||||| ||||||||||||| |||| |||||||||
seq2  GTAGAAGGGTTTTCCTGCATC-TGCCTGTTGCATA-GCTTGGGAATCTGA  997

seq1  CCTTCTCACCTGTCAACCTGCTGGAGGAGAGGTGGTGTGTGTCTTCTCTC  1049
      || ||||| ||||||||||||||||||||||||||||||     ||||||
seq2  CCCTCTCA-CTGTCAACCTGCTGGAGGAGAGGTGGTGTG----GTCTCTC  1042

seq1  CCTCCTCCTCCCCACACCCAGTGTGAGGCTCTGGACGGTTTCCTTGGC-A  1098
       |  ||||| |||||| ||||||||| ||||||||||||||||| | | |
seq2  TCGTCTCCT-CCCACATCCAGTGTGA-GCTCTGGACGGTTTCCTGGCCAA  1090

seq1  TTCTGTTATATAC  1111
      | |||||||||||
seq2  TCCTGTTATATAC  1103

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information