MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-281H04
Chromosome	8 (Build37)
Map Location	75,731,501 - 75,732,677
singlet/doublet	singlet
Overlap gene	Large
Upstream gene	Cib3, 2510049I19Rik, Ap1m1, LOC384840, LOC100042405, Klf2, Eps15l1, Calr3, LOC100042421, 1700030K09Rik, Cherp, Slc35e1, Crsp7, LOC100042439, 9130011J15Rik, Tmem38a, Nwd1, Sin3b, F2rl3
Downstream gene	LOC100039001, LOC666134, Crry-ps, LOC666146
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cib3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234421 MGI:2685953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins

name	2510049I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67922 MGI:1915172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1m1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11767 MGI:102776
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384840 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 844 ESTs, 1 Protein pseudo : _no_value

name	LOC100042405 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 908 ESTs, 10 Proteins

name	Klf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16598 MGI:1342772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eps15l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13859 MGI:104582
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73316 MGI:1920566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042421 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 22 Proteins

name	1700030K09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72254 MGI:1919504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cherp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27967 MGI:106417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35e1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270066 MGI:2142403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crsp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70625 MGI:1917875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042439 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	9130011J15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66818 MGI:1914068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem38a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74166 MGI:1921416
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nwd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319555 MGI:2442268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sin3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20467 MGI:107158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F2rl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14065 MGI:1298207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Large (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16795 MGI:1342270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC666134 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 Proteins pseudo : _no_value

name	Crry-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12947 MGI:88514
definition	gene_synonym : Crrx; Mcp-ps; mCRX note : complement receptor related protein, pseudogene pseudo : _no_value

name	LOC666146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Cib3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258911 GeneID:234421 MGI:2685953
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 6 Proteins product : calcium and integrin binding family member 3, transcript variant 1 transcript_id : XM_356089.5

name	2510049I19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359461 GeneID:67922 MGI:1915172
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2510049I19 gene transcript_id : NM_026455.3

name	Ap1m1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372671 GeneID:11767 MGI:102776
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex AP-1, mu subunit 1 transcript_id : NM_007456.2

name	LOC100042405 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258914 GeneID:100042405
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 908 ESTs, 10 Proteins product : similar to high mobility group nucleosomal binding domain 2 transcript_id : XM_001478555.1

name	Klf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680579 GeneID:16598 MGI:1342772
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 2 (lung) transcript_id : NM_008452.1

name	Eps15l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349898 GeneID:13859 MGI:104582
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epidermal growth factor receptor pathway substrate 15-like 1 transcript_id : NM_007944.2

name	Calr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803185 GeneID:73316 MGI:1920566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calreticulin 3 transcript_id : NM_029782.3

name	Calr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387566 GeneID:73316 MGI:1920566
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calreticulin 3 transcript_id : NM_028500.2

name	LOC100042421 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258916 GeneID:100042421
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 22 Proteins product : similar to H3 histone, family 3A transcript_id : XM_001478604.1

name	1700030K09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:39930438 GeneID:72254 MGI:1919504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700030K09 gene transcript_id : NM_028170.1

name	Cherp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119672911 GeneID:27967 MGI:106417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium homeostasis endoplasmic reticulum protein transcript_id : NM_138585.3

name	Slc35e1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343073 GeneID:270066 MGI:2142403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35, member E1 transcript_id : NM_177766.2

name	Crsp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350326 GeneID:70625 MGI:1917875
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 7 transcript_id : NM_027485.2

name	LOC100042439 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258918 GeneID:100042439
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : hypothetical protein LOC100042439 transcript_id : XM_001478638.1

name	9130011J15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922668 GeneID:66818 MGI:1914068
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9130011J15 gene transcript_id : NM_172396.3

name	Tmem38a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362330 GeneID:74166 MGI:1921416
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 38a transcript_id : NM_144534.1

name	Nwd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381392 GeneID:319555 MGI:2442268
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NACHT and WD repeat domain containing 1 transcript_id : NM_176940.3

name	Sin3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94158896 GeneID:20467 MGI:107158
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcriptional regulator, SIN3B (yeast) transcript_id : NM_009188.2

name	F2rl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803010 GeneID:14065 MGI:1298207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor II (thrombin) receptor-like 3 transcript_id : NM_007975.3

name	Large (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754505 GeneID:16795 MGI:1342270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : like-glycosyltransferase transcript_id : NM_010687.1

name	LOC100039001 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258922 GeneID:100039001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100039001 transcript_id : XM_001472068.1

name	Cib3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258912 GeneID:234421 MGI:2685953
definition	codon_start : 1 product : calcium and integrin binding family member 3 isoform 1 protein_id : XP_356089.2

name	2510049I19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385950 GeneID:67922 MGI:1915172
definition	codon_start : 1 product : hypothetical protein LOC67922 protein_id : NP_080731.1

name	Ap1m1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671557 CCDS:CCDS22411.1 GeneID:11767 MGI:102776
definition	GO_component : GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0005905 - coated pit [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence TAS] GO_process : GO:0006886 - intracellular protein transport [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 product : adaptor-related protein complex AP-1, mu subunit 1 protein_id : NP_031482.1

name	LOC100042405 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258915 GeneID:100042405
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478605.1

name	Klf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680580 CCDS:CCDS22412.1 GeneID:16598 MGI:1342772
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence ISS]; GO:0030528 - transcription regulator activity [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation function : transcription factor; zinc finger protein product : Kruppel-like factor 2 (lung) protein_id : NP_032478.1

name	Eps15l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679669 GeneID:13859 MGI:104582
definition	GO_component : GO:0005905 - coated pit [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : epidermal growth factor receptor pathway substrate 15, related sequence product : epidermal growth factor receptor pathway substrate 15, related protein_id : NP_031970.1

name	Calr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21624619 CCDS:CCDS22413.1 GeneID:73316 MGI:1920566
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : calreticulin 3 isoform 1 protein_id : NP_082776.1

name	Calr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41462328 GeneID:73316 MGI:1920566
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : calreticulin 3 isoform 2 protein_id : NP_084058.2

name	LOC100042421 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258917 GeneID:100042421
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478654.1

name	1700030K09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39930439 CCDS:CCDS22414.1 GeneID:72254 MGI:1919504
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72254 protein_id : NP_082446.1

name	Cherp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119672912 GeneID:27967 MGI:106417
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS]; GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : SR-related CTD associated factor 6 protein_id : NP_613051.3

name	Slc35e1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244270 CCDS:CCDS22415.1 GeneID:270066 MGI:2142403
definition	codon_start : 1 product : solute carrier family 35, member E1 protein_id : NP_808434.1

name	Crsp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28466971 CCDS:CCDS22416.1 GeneID:70625 MGI:1917875
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006952 - defense response [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa product : transcriptional co-activator CRSP7 homolog protein_id : NP_081761.1

name	LOC100042439 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258919 GeneID:100042439
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478688.1

name	9130011J15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369485 GeneID:66818 MGI:1914068
definition	codon_start : 1 product : hypothetical protein LOC66818 protein_id : NP_765984.1

name	Tmem38a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362331 CCDS:CCDS22417.1 GeneID:74166 MGI:1921416
definition	codon_start : 1 note : Mitsugumin33A product : transmembrane protein 38a protein_id : NP_653117.1

name	Nwd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892747 CCDS:CCDS22418.1 GeneID:319555 MGI:2442268
definition	codon_start : 1 exception : mismatches in translation product : NACHT and WD repeat domain containing 1 protein_id : NP_795914.1

name	Sin3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28212270 GeneID:20467 MGI:107158
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IDA]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcriptional regulator, SIN3 yeast homolog B product : transcriptional regulator, SIN3B protein_id : NP_033214.1

name	F2rl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982379 CCDS:CCDS22419.1 GeneID:14065 MGI:1298207
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : coagulation factor II (thrombin) receptor-like 3 protein_id : NP_032001.2

name	Large (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754506 CCDS:CCDS22420.1 GeneID:16795 MGI:1342270
definition	GO_component : GO:0030173 - integral to Golgi membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0016051 - carbohydrate biosynthesis [Evidence IEA]; GO:0009101 - glycoprotein biosynthesis [Evidence NAS]; GO:0006688 - glycosphingolipid biosynthesis [Evidence NAS]; GO:0046716 - muscle maintenance [Evidence IMP]; GO:0042552 - myelination [Evidence TAS]; GO:0007605 - sensory perception of sound [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP] codon_start : 1 note : myodystrophy product : like-glycosyltransferase protein_id : NP_034817.1

name	LOC100039001 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258923 GeneID:100039001
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472118.1

name	LOC666134 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666134
definition	number : 2 pseudo : _no_value

name	LOC666134 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666134
definition	number : 1 pseudo : _no_value

name	LOC666146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666146
definition	number : 1 pseudo : _no_value

name	LOC384840 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258913 GeneID:384840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 844 ESTs, 1 Protein product : similar to ribosomal protein L23a pseudo : _no_value transcript_id : XR_033743.1

clone name	MSMg01-438G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-099I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155L12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-063J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-186G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-179G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-468N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-207N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-385C18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197H08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284C12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-281H04.b	B6Ng01-281H04.g
ACC	GA080922	GA080923
length	1,119	1,163
definition	B6Ng01-281H04.b	B6Ng01-281H04.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctacacaaaatccatcctaactccagggaggaaggtcaggagttc aatggcattcttgaatccacagcaagttcatggttagcctcagatacatg agaccttgcctcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaggaaaatgaaatactgtagtaaatgtgtgaaaagaagaatccttct aaaaaaataattattaaggactcataaagagttaacattggactgggcac tggtaataagatgatgagatcaacaggcctttcctacaaggaactgagag acacataatggcagaaatctcaaaggagcaaatgctacttgttctatgct gatcacagtgtctccacatagggcagccattgggcagaaacgacaacaaa catggacactgaaggcacagtttgagaagatgtctatgggcaaagagcta cacacagaacagaaaaaacacaatgaagcctaagaaacaaggagctcaat gaagcagcagaacaccaatgaacacaaaaatggtaaatttcaggggaaag gaagaaatatcaggatcattgtaatggtcagaagtttgacaagaaaacag aggtgagatctgccaggactcagagctagaggagtgtgggtatactcacc cctctgcttagcaaacatgtgaacactgacagtaagcctgaagaccaact cctctcctgatactgtaatagctgctagatgtcaacaatagagtcacttg aggacaagaaagggaaacaagaagctctgagtaagaatgggaagcagagc aagggaaggggaacatgcagcctaatggaaagtcgtgagccctgaggctg agatccaaagatattagtcaggtggactgagaagcaaagagaggatgaaa gtgtcttgaagaaagagcagagtgtacagacactacagcatagccaggct atgagacagtgactatgggaggacagtgactatgcaagagcagtcagaca gacagagtgagatgctagctccagtagaggaggatgaatagcatgtgata agagatagactagtattacaacacaacaacccctacccctcccgttagca tccttctagctatcatgct	gaattcatgctctttccaagacttttatcatgaatggtgttggattttgt caaatgctttttcccgcatctaacgagatgatcatgtggtttttgtcttt gagtttgtttacatactggattacattgatggatttccgtatattgaacc atccctgcatccctgggatgaaacctacttggtcaggatggatgattgtt ttgatgtgttcttggattccgttagcaagaactttattgaggatttttgc attgatattcataagggaaattggtctgaatttctctatctttattgggt ctttttgtggtttaggtatcagagtaattgtggcttcataaaatgagttg ggtagagtaccttccatttctattttgtggaattgtttgggaagaactga aattaggtcttctttgaaggtctgatagaactctgcactaaacccatctg gtcctgggcttttttttttgactgggagattattaatgacggtttctatt tctttaggggatataggactgtttagatcattaacctgatcttgatttag ctttggtacctggtatctgtctagaaacttgtccatttcatccaggtttt ccagttttgttgagtatagccttttgtagaaggatctgatcgtgttttgg atttcttcgcgatctgttgttatttctcctttttcatttctgattttgtt aattaggatgctttccctgtgccctctagtgagtctggctaagggtttat caatcttgttgattttctcaaagaaccagctccttgattggttgattctt tgaatagttcttcttgtttccacttggttgatttcacccctgagtttgat tattcctgccttctacttctcttgggtgaatttgcttccctttgttctag agctttaggtgtgttgtcagctgctatgtgtggtctctctagtttctttt ggaggcactcagagctatgagtttccttctagaatgctttcatgtgtgcc atagttgggtatgttgtgctcatttcataactcaaaagtctaatttcttc ttatccttccttgaaccagttatcatgagagagtgctgttcagttccatg tgcagttagccttggataatcaatttgtattgagcatcacgcctgagctc taatcggacgtca
quality values	Open. Hide. 58 31 22 22 58 42 62 52 47 42 42 42 62 62 28 47 62 38 26 62 62 62 62 62 62 62 62 62 59 36 62 62 59 59 59 62 49 62 54 54 59 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 54 62 59 48 59 62 62 62 59 62 62 59 54 54 62 62 62 62 59 62 62 62 62 43 32 54 62 54 62 62 62 62 62 56 59 59 56 50 56 56 48 43 48 59 62 56 56 56 48 54 43 43 43 59 59 59 54 54 54 54 54 31 34 34 23 50 43 34 45 50 28 28 32 31 45 28 45 30 34 28 32 27 34 34 31 37 37 34 34 34 30 34 23 28 36 38 40 34 19 34 27 13 28 23 30 51 46 43 43 34 34 30 35 54 50 46 50 43 46 36 23 34 34 23 37 27 27 39 49 56 43 39 38 39 24 40 43 34 31 30 45 34 49 49 41 43 41 30 48 46 50 43 36 27 34 48 46 46 27 27 29 34 50 41 34 41 40 43 30 30 18 28 34 34 40 39 34 34 23 35 39 30 34 45 46 39 48 48 37 46 50 56 51 51 50 48 43 49 41 35 50 59 31 45 41 46 34 34 17 35 23 28 28 23 34 23 43 30 30 34 48 35 18 19 13 28 13 28 34 24 34 31 18 13 46 31 43 49 24 34 34 39 39 43 48 35 37 30 39 34 37 43 37 34 40 39 34 43 46 34 34 38 38 50 34 30 39 18 23 25 43 30 30 34 41 41 18 34 18 29 39 49 62 56 35 45 34 45 43 30 45 45 50 45 59 24 30 18 45 28 30 51 28 45 45 34 45 51 38 34 39 34 28 45 51 38 27 34 30 43 43 59 59 46 38 59 34 30 35 24 22 56 56 51 42 38 20 27 27 16 27 24 27 35 32 35 24 38 39 56 56 51 34 38 31 21 36 24 38 50 27 50 22 38 27 38 27 38 56 38 33 32 22 30 38 39 56 38 38 38 27 30 23 21 27 43 39 56 38 56 56 33 42 32 20 47 36 27 52 40 41 43 46 22 27 34 46 35 28 23 46 50 46 52 43 52 30 35 33 17 12 46 28 35 26 34 40 26 25 42 40 40 32 37 27 46 32 32 29 34 32 47 52 47 32 37 40 40 42 52 52 47 29 41 58 52 52 47 52 52 52 52 47 34 25 52 37 33 34 26 34 26 32 42 52 30 41 47 40 50 48 51 39 46 34 40 41 30 35 40 33 19 50 41 37 50 50 47 47 47 40 37 33 21 47 46 50 34 34 22 18 43 36 49 37 40 41 32 39 42 42 50 49 41 19 32 28 34 31 33 46 46 30 24 50 28 42 44 40 19 33 29 31 41 32 35 49 31 51 58 50 42 28 33 32 50 51 54 35 58 58 58 43 53 39 32 50 36 54 54 31 39 40 51 54 50 39 35 47 42 39 53 52 45 42 28 38 42 50 35 36 25 40 39 42 39 36 54 41 42 45 54 37 21 30 31 37 23 20 34 38 39 47 35 41 34 53 52 38 45 33 23 24 33 33 54 26 47 37 33 40 33 52 37 53 40 37 32 28 33 21 41 32 32 31 31 40 32 30 32 33 29 53 29 35 39 29 31 33 37 40 39 31 32 31 22 29 33 14 28 51 11 27 51 17 35 51 30 31 33 29 22 24 25 26 35 43 32 38 34 51 19 34 28 32 13 31 30 31 35 47 32 30 42 24 31 31 13 24 14 43 25 27 25 48 12 32 16 33 48 48 31 21 21 34 23 34 36 38 23 26 35 31 31 22 19 31 43 33 24 48 30 27 31 38 33 24 31 31 35 31 48 28 22 27 30 23 18 16 26 30 30 8 26 32 31 25 31 41 22 16 32 24 14 8 29 21 12 31 34 8 8 5 9 21 15 15 21 35 32 31 19 27 10 8 6 17 44 25 13 32 7 17 7 26 14 17 26 28 47 26 17 22 23 18 32 32 33 34 23 28 12 30 43 16 14 24 11 32 28 10 29 8 21 32 17 19 26 17 13 23 12 20 18 32 28 6 12 16 23 17 30 19 7 16 24 23 26 17 24 29 20 28 10 3 3 5 3 5 15 14 18 18 24 23 12 22 11 34 21 25 21 21 8 17 9 14 18 27 24 24 18 9 28 10 13 6 8 6 21 12 15 25 11 28 16 23 6 19 9 7 15 17 6 18 5 20 7 25 11 5 5 17 17 20 19 21 16 10 20 16 6 17 5 3 5 17 4 4 5 16 15 4 5 18 5 8 23 12 3 2 10 23 6 3 8 7 5 24 5 10 15 5 12 5 16 16 5 6 19 12 7 3 5 3 3 3 18 17 3 8 17 5 3 3 6 10 14 17 17 12 25 28 5 5 1 7 6 25 17 9 5 17 16 7 8 7 11 19 16 6 5 2 2 6 21 6 7 13 9 12 4 13 18 5 3 5 12 4 9	Open. Hide. 62 47 42 44 62 44 32 54 62 62 62 59 56 38 33 56 46 26 33 49 59 59 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 54 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 48 58 58 49 58 58 47 42 41 58 58 53 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 54 53 58 49 39 54 42 54 53 54 54 58 58 48 58 58 58 58 58 58 54 54 49 54 54 58 58 58 58 51 58 58 58 42 48 58 58 58 58 58 47 58 50 58 51 58 58 58 58 58 49 50 53 46 58 58 58 58 51 53 50 51 51 58 52 58 53 51 52 58 58 49 51 49 58 58 52 50 44 40 58 58 58 53 52 51 49 50 50 54 52 53 58 58 48 51 51 39 53 54 58 58 58 53 52 58 49 58 52 52 53 53 53 46 43 39 42 51 58 58 58 50 50 38 58 39 16 58 35 39 51 43 58 44 40 58 50 50 58 54 58 58 50 58 44 40 31 49 49 47 35 41 52 42 53 42 53 50 47 50 58 26 46 51 31 41 39 41 54 51 50 40 50 54 37 54 54 54 42 40 30 49 54 52 53 39 37 53 26 54 54 24 54 31 32 39 51 39 53 53 25 41 41 26 45 37 39 54 46 41 54 54 45 53 32 39 38 54 54 33 33 42 37 42 42 51 53 40 40 39 37 49 46 24 39 37 41 37 54 47 32 53 52 42 32 40 25 41 32 45 52 32 40 26 25 27 31 20 52 53 32 32 32 31 26 52 46 31 53 20 21 52 29 26 53 39 33 35 32 30 33 33 24 31 31 11 9 19 23 27 14 38 37 33 51 36 32 33 32 33 42 33 35 31 33 36 25 32 30 30 45 18 46 30 31 35 22 30 35 26 30 46 24 23 31 20 13 47 41 32 32 31 46 46 34 23 31 38 21 38 46 33 26 30 12 33 31 18 12 21 46 28 32 15 37 13 24 31 24 32 35 25 32 31 27 30 28 25 41 39 39 31 32 37 22 32 46 15 28 31 17 44 13 46 11 48 48 31 16 14 25 29 29 31 24 35 17 31 11 47 43 38 24 15 9 25 17 38 21 14 25 6 8 23 14 31 31 32 27 25 25 14 38 20 31 21 27 21 19 29 27 32 20 26 23 32 21 20 48 19 21 23 43 43 26 17 11 33 11 23 10 9 12 32 31 11 5 12 11 34 31 27 24 11 24 9 43 43 33 24 21 12 6 6 16 5 7 4 19 21 28 19 20 34 21 14 7 23 10 10 23 14 23 7 15 20 21 24 23 14 19 8 31 14 3 3 6 6 5 18 7 3 4 6 18 12 13 10 9 25 5 6 27 26 27 14 12 20 10 11 19 22 14 12 17 8 3 8 4 26 16 6 4 8 8 17 13 6 16 7 6 21 4 8 8 7 7 12 7 6 13 4 23 15 17 7 5 7 13 16 25 7 6 1 3 2 16 8 4 6 7 11 9 4 10 20 8 7 24 15 24 5 6 5 26 5 3 3 3 2 1 4 2 7 6 6 8 18 6 3 2 3 4 8 6 4 8 5 9 12 4 19 3 2 5 1 3 3 4 5 22 6 4 3 4 1 2 10 12 7 19 6 10 8 9 5 5 9 4 4 14 17 5 4 3 4 4 8

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_75731501_75732677
seq2: B6Ng01-281H04.b_32_1150

seq1  GAATTCTACACAAAATCCATCCTAACTCCAGGGAGGAAGGTCAGGAGTTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTACACAAAATCCATCCTAACTCCAGGGAGGAAGGTCAGGAGTTC  50

seq1  AATGGCATTCTTGAATCCACAGCAAGTTCATGGTTAGCCTCAGATACATG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGCATTCTTGAATCCACAGCAAGTTCATGGTTAGCCTCAGATACATG  100

seq1  AGACCTTGCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCTTGCCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA  150

seq1  AAAAGGAAAATGAAATACTGTAGTAAATGTGTGAAAAGAAGAATCCTTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGAAAATGAAATACTGTAGTAAATGTGTGAAAAGAAGAATCCTTCT  200

seq1  AAAAAAATAATTATTAAGGACTCATAAAGAGTTAACATTGGACTGGGCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAAATAATTATTAAGGACTCATAAAGAGTTAACATTGGACTGGGCAC  250

seq1  TGGTAATAAGATGATGAGATCAACAGGCCTTTCCTACAAGGAACTGAGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTAATAAGATGATGAGATCAACAGGCCTTTCCTACAAGGAACTGAGAG  300

seq1  ACACATAATGGCAGAGATCTCAGAGGAGCAAATGCTACTTGTTCTATGCT  350
      ||||||||||||||| |||||| |||||||||||||||||||||||||||
seq2  ACACATAATGGCAGAAATCTCAAAGGAGCAAATGCTACTTGTTCTATGCT  350

seq1  GATCACAGTGTCTCCACATAGGGCAGCCATTGGGCAGAAACGACAACAAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCACAGTGTCTCCACATAGGGCAGCCATTGGGCAGAAACGACAACAAA  400

seq1  CATGGACACTGAAGGCACAGTTTGAGAAGATGTCTATGGGCAAAGAGCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGACACTGAAGGCACAGTTTGAGAAGATGTCTATGGGCAAAGAGCTA  450

seq1  CACACAGAACAGAAAAAACACAATGAAGCCTAAGAAACAAGGAGCTCAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACAGAACAGAAAAAACACAATGAAGCCTAAGAAACAAGGAGCTCAAT  500

seq1  GAAGCAGCAGAACACCAATGAACACAAAAATGGTAAATTTCAGGGGAAAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCAGCAGAACACCAATGAACACAAAAATGGTAAATTTCAGGGGAAAG  550

seq1  GAAGAAATATCAGGATCATTGTAATGGTCAGAAGTTTGACAAGAAAACAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGAAATATCAGGATCATTGTAATGGTCAGAAGTTTGACAAGAAAACAG  600

seq1  AGGTGAGATCTGCCAGGACTCAGAGCTAGAGGAGTGTGGGTATACTCACC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGAGATCTGCCAGGACTCAGAGCTAGAGGAGTGTGGGTATACTCACC  650

seq1  CCTCTGCTTAGCAAACATGTGAACACTGACAGTAAGCCTGAAGACCAACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGCTTAGCAAACATGTGAACACTGACAGTAAGCCTGAAGACCAACT  700

seq1  CCTCTCCTGATACTGTAATAGCTGCTAGATGTCAACAATAGAGTCACTTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTCCTGATACTGTAATAGCTGCTAGATGTCAACAATAGAGTCACTTG  750

seq1  AGGACAAG-AAGGGAAACAAGAAGCTCTGAGTAAGAATGGGAAGCAGAGC  799
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AGGACAAGAAAGGGAAACAAGAAGCTCTGAGTAAGAATGGGAAGCAGAGC  800

seq1  AA-GGAAGGGGAACATGCAGCCTAATGGAAAGTCGTGAGCCCTGAGGCTG  848
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGAAGGGGAACATGCAGCCTAATGGAAAGTCGTGAGCCCTGAGGCTG  850

seq1  AGATCCAAAGATATTAGTCAGGTGGACTGAGAAGGCAAAGAGAGGATGAA  898
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  AGATCCAAAGATATTAGTCAGGTGGACTGAGAA-GCAAAGAGAGGATGAA  899

seq1  AGTGTCTTGAAGAAAGAGCAGAGTGTACAGACAACTAACAGCATAAGCCA  948
      |||||||||||||||||||||||||||||||| ||| ||||||| |||||
seq2  AGTGTCTTGAAGAAAGAGCAGAGTGTACAGAC-ACT-ACAGCAT-AGCCA  946

seq1  GGCTATGAAGGAACAGTGACTATGGGAGGGACAGTGACTATGCCAAAGAG  998
      ||||||||    ||||||||||||||| |||||||||||||||  |||||
seq2  GGCTATGA---GACAGTGACTATGGGA-GGACAGTGACTATGC--AAGAG  990

seq1  CAAGTCAAGACAGACAAGAGTTGGAGATGCTAGCTCCCAAGGTAGAGGAA  1048
      | |||| |||||||| |||||  ||||||||||||||    |||||||| 
seq2  C-AGTC-AGACAGAC-AGAGT--GAGATGCTAGCTCC---AGTAGAGGAG  1032

seq1  GAAATGAAAATTAGCAGTGTGAAATAAGAGATTAAGAACCTAAGGGTTAA  1098
      |  |||||   ||||| ||||  |||||||||  |||  |||   ||   
seq2  G--ATGAA---TAGCA-TGTG--ATAAGAGAT--AGA--CTA---GT---  1064

seq1  ATAACAAAAACAAAACAAACAAAACCCCCTACCCCCCCTCCCCCGTTAGC  1148
      || ||   |||| |||||       |||||||||     | |||||||||
seq2  ATTAC---AACACAACAA-------CCCCTACCC-----CTCCCGTTAGC  1099

seq1  ATTTTCCTTCATAGCCTACTTCTCATGCT  1177
      |   |||||| ||||     | |||||||
seq2  A---TCCTTC-TAGC-----TATCATGCT  1119

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information