MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-307H03
Chromosome	8 (Build37)
Map Location	106,576,934 - 106,611,866
singlet/doublet	doublet
Overlap gene	LOC667656
Upstream gene	1600027J07Rik, LOC100041397
Downstream gene	Cdh5, Bean, Tk2, Cklf, Cmtm2a, Cmtm2b, Cmtm3, Cmtm4, Dync1li2, Ccdc79, Appbp1, Car7, LOC628007, 4833426J09Rik, Cdh16, Rrad, 1110019N10Rik, EG637550, LOC382052, LOC100041473, Ces6, LOC628050, 4932416K20Rik, BC015286, Matr3-ps2, Ces2, LOC667754, LOC667760, Ces5, 2310038E17Rik, 2210023G05Rik, LOC436058, EG436059, Es31, EG13909
Link	Open Mouse BAC browser

Click to get alignment info.

name	1600027J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69794 MGI:1917044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100041397 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC667656 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Cdh5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12562 MGI:105057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bean (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65115 MGI:1929597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein

name	Tk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57813 MGI:1913266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cklf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75458 MGI:1922708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Cmtm2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73381 MGI:2447160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75502 MGI:2447311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68119 MGI:2447162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97487 MGI:2142888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dync1li2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234663 MGI:107738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc79 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320022 MGI:2443187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Appbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234664 MGI:2384561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12354 MGI:103100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 4 Proteins pseudo : _no_value

name	4833426J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382051 MGI:1918878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdh16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12556 MGI:106671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56437 MGI:1930943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110019N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68523 MGI:1915773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG637550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637550 MGI:3648500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 16 Proteins pseudo : _no_value

name	LOC382052 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	LOC100041473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ces6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102022 MGI:2142491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins pseudo : _no_value

name	4932416K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442809 MGI:3045271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC015286 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234669 MGI:2448547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matr3-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17186 MGI:1298410
definition	note : matrin 3, pseudogene 2 pseudo : _no_value

name	Ces2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234671 MGI:2385905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667754 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 49 ESTs, 38 Proteins pseudo : _no_value

name	LOC667760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 27 Proteins pseudo : _no_value

name	Ces5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234673 MGI:2443170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310038E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71903 MGI:1919153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210023G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72361 MGI:1919611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG436059 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436059 MGI:3648740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	Es31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 81 ESTs, 12 Proteins

name	EG13909 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13909 MGI:3644960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1600027J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259009 GeneID:69794 MGI:1917044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1600027J07 gene transcript_id : XM_001476265.1

name	LOC100041397 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259011 GeneID:100041397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to retinitis pigmentosa GTPase regulator transcript_id : XM_001476323.1

name	Cdh5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254596 GeneID:12562 MGI:105057
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 5 transcript_id : NM_009868.3

name	Bean (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259014 GeneID:65115 MGI:1929597
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 13 ESTs, 1 Protein product : brain expressed, associated with Nedd4, transcript variant 1 transcript_id : XM_486154.5

name	Tk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10835110 GeneID:57813 MGI:1913266
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymidine kinase 2, mitochondrial transcript_id : NM_021028.2

name	Cklf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368069 GeneID:75458 MGI:1922708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine-like factor transcript_id : NM_029295.2

name	Cklf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074535 GeneID:75458 MGI:1922708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine-like factor transcript_id : NM_001037841.2

name	Cmtm2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157473 GeneID:73381 MGI:2447160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 2A transcript_id : NM_027022.4

name	Cmtm2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366677 GeneID:75502 MGI:2447311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 2B transcript_id : NM_028524.2

name	Cmtm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892608 GeneID:68119 MGI:2447162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 3 transcript_id : NM_024217.3

name	Cmtm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130093 GeneID:97487 MGI:2142888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 4 transcript_id : NM_153582.4

name	Dync1li2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945389 GeneID:234663 MGI:107738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, cytoplasmic 1 light intermediate chain 2 transcript_id : NM_001013380.1

name	Ccdc79 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348021 GeneID:320022 MGI:2443187
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 79 transcript_id : NM_180958.2

name	Appbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369149 GeneID:234664 MGI:2384561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta precursor protein binding protein 1 transcript_id : NM_144931.2

name	Car7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227229 GeneID:12354 MGI:103100
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 7 transcript_id : NM_053070.2

name	4833426J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66841377 GeneID:382051 MGI:1918878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833426J09 gene transcript_id : NM_001024606.1

name	Cdh16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376412 GeneID:12556 MGI:106671
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 16 transcript_id : NM_007663.2

name	Rrad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145496 GeneID:56437 MGI:1930943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras-related associated with diabetes transcript_id : NM_019662.2

name	1110019N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360665 GeneID:68523 MGI:1915773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110019N10 gene transcript_id : NM_026753.2

name	Ces6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352997 GeneID:102022 MGI:2142491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxylesterase 6 transcript_id : NM_133960.3

name	BC015286 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371927 GeneID:234669 MGI:2448547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC015286 transcript_id : NM_198171.2

name	Ces2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704205 GeneID:234671 MGI:2385905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxylesterase 2 transcript_id : NM_145603.1

name	Ces5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802881 GeneID:234673 MGI:2443170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxylesterase 5 transcript_id : NM_172759.2

name	2310038E17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120474986 GeneID:71903 MGI:1919153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310038E17 gene transcript_id : NM_001079865.2

name	2210023G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574079 GeneID:72361 MGI:1919611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210023G05 gene transcript_id : NM_197999.1

name	EG436059 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51764432 GeneID:436059 MGI:3648740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG436059, transcript variant 1 transcript_id : XM_488149.1

name	Es31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259059 GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs, 6 Proteins product : esterase 31, transcript variant 5 transcript_id : XM_001003935.2

name	Es31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383764 GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 81 ESTs, 10 Proteins product : esterase 31, transcript variant 1 transcript_id : XM_356125.5

name	Es31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383767 GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 72 ESTs, 5 Proteins product : esterase 31, transcript variant 4 transcript_id : XM_901994.2

name	EG13909 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362300 GeneID:13909 MGI:3644960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG13909 transcript_id : NM_144511.1

name	1600027J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259010 GeneID:69794 MGI:1917044
definition	codon_start : 1 product : hypothetical protein LOC69794 protein_id : XP_001476315.1

name	LOC100041397 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259012 GeneID:100041397
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476373.1

name	Cdh5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38490561 CCDS:CCDS22572.1 GeneID:12562 MGI:105057
definition	GO_component : GO:0005911 - intercellular junction [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0001955 - blood vessel maturation [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0016337 - cell-cell adhesion [Evidence IC]; GO:0007156 - homophilic cell adhesion [Evidence IEA]; GO:0008285 - negative regulation of cell proliferation [Evidence IGI] codon_start : 1 note : VE-cadherin; 7B4/cadherin-5 product : cadherin 5 protein_id : NP_033998.2

name	Bean (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259015 GeneID:65115 MGI:1929597
definition	codon_start : 1 product : brain expressed, associated with Nedd4 isoform 1 protein_id : XP_486154.5

name	Tk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10835111 CCDS:CCDS22573.1 GeneID:57813 MGI:1913266
definition	EC_number : 2.7.1.21 GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0004797 - thymidine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006139 - nucleobase, nucleoside, nucleotide and nucleic acid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation function : phosphorylate pyrimidine nucleosides to their 5' monophosphate product : thymidine kinase 2, mitochondrial protein_id : NP_066356.2

name	Cklf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83745101 GeneID:75458 MGI:1922708
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019031 - viral envelope [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; chemokine-like factor 2; chemokine-like factor 4; chemokine-like factor 6 product : chemokine-like factor isoform 4 protein_id : NP_001032930.1

name	Cklf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312956 GeneID:75458 MGI:1922708
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019031 - viral envelope [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; chemokine-like factor 2; chemokine-like factor 4; chemokine-like factor 6 product : chemokine-like factor isoform 1 protein_id : NP_083571.1

name	Cmtm2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729761 GeneID:73381 MGI:2447160
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IPI] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : chemokine-like factor superfamily 2-1b product : chemokine-like factor super family 2A protein_id : NP_081298.1

name	Cmtm2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729765 CCDS:CCDS22576.1 GeneID:75502 MGI:2447311
definition	codon_start : 1 note : chemokine-like factor superfamily protein 2-2 product : chemokine-like factor super family 2B protein_id : NP_082800.1

name	Cmtm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195644 CCDS:CCDS22577.1 GeneID:68119 MGI:2447162
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 3 protein_id : NP_077179.1

name	Cmtm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27312023 CCDS:CCDS22578.1 GeneID:97487 MGI:2142888
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 4 protein_id : NP_705810.2

name	Dync1li2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945390 CCDS:CCDS22579.1 GeneID:234663 MGI:107738
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005868 - cytoplasmic dynein complex [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dynein, cytoplasmic, light intermediate chain 2 product : dynein, cytoplasmic, light intermediate polypeptide 2 protein_id : NP_001013398.1

name	Ccdc79 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725843 CCDS:CCDS22580.1 GeneID:320022 MGI:2443187
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 79 protein_id : NP_851289.1

name	Appbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450341 GeneID:234664 MGI:2384561
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : amyloid beta precursor protein binding protein 1, 59kDa product : amyloid beta precursor protein binding protein 1 protein_id : NP_659180.1

name	Car7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28269695 CCDS:CCDS22581.1 GeneID:12354 MGI:103100
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : carbonic anhydrase VII product : carbonic anhydrase 7 protein_id : NP_444300.1

name	4833426J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66841378 CCDS:CCDS22582.1 GeneID:382051 MGI:1918878
definition	GO_component : GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : pyruvate dehydrogenase phosphatase isoenzyme 2 protein_id : NP_001019777.1

name	Cdh16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680900 CCDS:CCDS22583.1 GeneID:12556 MGI:106671
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : KSP-cadherin product : cadherin 16 protein_id : NP_031689.1

name	Rrad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145497 CCDS:CCDS22584.1 GeneID:56437 MGI:1930943
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : Ras-like GTP-binding protein rad product : Ras-related associated with diabetes protein_id : NP_062636.2

name	1110019N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312046 GeneID:68523 MGI:1915773
definition	codon_start : 1 product : hypothetical protein LOC68523 protein_id : NP_081029.1

name	Ces6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527178 CCDS:CCDS22585.1 GeneID:102022 MGI:2142491
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004091 - carboxylesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 product : carboxylesterase 6 protein_id : NP_598721.1

name	BC015286 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718991 CCDS:CCDS22586.1 GeneID:234669 MGI:2448547
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234669 protein_id : NP_937814.1

name	Ces2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704206 CCDS:CCDS22587.1 GeneID:234671 MGI:2385905
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 note : carboxylesterase ML3; acylcarnitine hydrolase M1 product : carboxylesterase 2 protein_id : NP_663578.1

name	Ces5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370126 CCDS:CCDS22588.1 GeneID:234673 MGI:2443170
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004091 - carboxylesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 product : carboxylesterase 5 protein_id : NP_766347.1

name	2310038E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120474987 GeneID:71903 MGI:1919153
definition	codon_start : 1 product : hypothetical protein LOC71903 protein_id : NP_001073334.2

name	2210023G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574080 CCDS:CCDS22589.1 GeneID:72361 MGI:1919611
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72361 protein_id : NP_932116.1

name	EG436059 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51764433 GeneID:436059 MGI:3648740
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_488149.1

name	Es31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63578904 GeneID:382053 MGI:102773
definition	codon_start : 1 product : esterase 31 isoform 1 protein_id : XP_356125.2

name	Es31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383766 GeneID:382053 MGI:102773
definition	codon_start : 1 product : esterase 31 isoform 5 protein_id : XP_001003935.1

name	Es31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82918240 GeneID:382053 MGI:102773
definition	codon_start : 1 product : esterase 31 isoform 4 protein_id : XP_907087.1

name	EG13909 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362301 CCDS:CCDS22590.1 GeneID:13909 MGI:3644960
definition	codon_start : 1 product : esterase 31-like protein_id : NP_653094.1

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 12 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 11 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 10 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 9 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 8 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 7 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 6 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 5 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 4 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 3 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 2 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 1 pseudo : _no_value

name	LOC100041473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041473
definition	number : 1 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 1 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 2 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 3 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 4 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 5 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 6 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 7 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 8 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 9 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 10 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 11 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 12 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 1 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 2 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 3 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 4 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 5 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 6 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 7 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 8 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 9 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 10 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 11 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 12 pseudo : _no_value

name	LOC667656 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259013 GeneID:667656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to ribosomal protein S7 pseudo : _no_value transcript_id : XR_032680.1

name	LOC628007 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259055 GeneID:628007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 4 Proteins product : similar to guanine nucleotide binding protein (G protein), gamma 5 subunit pseudo : _no_value transcript_id : XR_033668.1

name	EG637550 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149259018 GeneID:637550 MGI:3648500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 16 Proteins product : predicted gene, EG637550 pseudo : _no_value transcript_id : XR_002064.2

name	4932416K20Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149259019 GeneID:442809 MGI:3045271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4932416K20 gene transcript_id : XR_035314.1

name	LOC667754 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94383778 GeneID:667754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 49 ESTs, 38 Proteins product : similar to Carboxylesterase 2 pseudo : _no_value transcript_id : XR_002069.1

name	LOC667760 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259058 GeneID:667760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 27 Proteins product : similar to Carboxylesterase 2 pseudo : _no_value transcript_id : XR_033757.1

clone name	MSMg01-159K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304E19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-197I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-348L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424L09
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-434D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120E03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178B03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366K08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-422J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-076F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079H12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-412O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339M14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217E12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-237B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-127N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079G03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-408A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-377F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509P03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-098H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-002J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-307H03.b	B6Ng01-307H03.g
ACC	GA100216	GA100217
length	564	657
definition	B6Ng01-307H03.b	B6Ng01-307H03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(106,611,322 - 106,611,866)	(106,576,934 - 106,577,590)
sequence	accaacttgcttctattatgcaatgtagtctgccatacctgactgtagtg aagattctaagtatactctgctaagcttgccctgagatttctaactctta gccagtaaaatactataagaaagcatgcaagaccctccacaatatttcag ggacaaatctggggcattcgagctatgggaatgccaaggttccaagaggc tgagtttccttgaaattctttgcctcaggactgcttccaggtttccaaac ctgtaatgcgagtcactactggagtggatgtagcaccccaccacccatgt cagtatgaaatctagaccaattaagccctatgcctccatcttaacatctg tggagaaagcacacttccctcaggcattccttgtgcaagatgctgggaca gcatgctccgcagccagtgtccctgcatgtggcagctgtgacagtgacta tccctttacaagtgaaaggagaaactgtcttcaaggttttcagactgtag aaggcattgaataagggtttctgctatctgcagatacatcaaggggtttt ggggggtggggtgg	gaattcttggagactgagccccacccaacctgccagactacctgggtccc ttatgtagactaagagcattgcctcctactgatgatggtggggctcagcc ctctgctgagtcactagacacctagacctggcttaacaccatcaaacata ttggaagggcctcctcctccacaaactacactaattaatttgtgatcccc ggcagggggtcctcagcatcctgcatctgccaacctaattatgaaatagc cctggcaggcagcttcatggccttgggtgatcccagcacaggcaccaaca gctggaggggacaacaactaccacctacaaccagatgataaaatgaagtc atcagcactgctaatgacaaaaatgataaccacaccagccagcatgtatt gagctcctaggaggtggcacatacttagagaactatctcccacatttcta cgagctcagaaggtatcaagagcatcctgtttctcaacaggaaatgaagg ctcagagaggatggagaatttgtcaagcctgtaatagatctaaggtacaa atgcaagaatgccttcctccaaggcttgttatcatcatagtctacattcc atagcagggagagggcttgtaccactgtgtgtgtgtgtgtgtgtgtgtgt gtgtgtg
quality values	Open. Hide. 27 54 41 42 62 62 62 62 62 62 62 62 62 54 56 62 54 62 47 54 47 62 62 62 62 62 59 43 56 59 59 43 38 35 46 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 54 62 62 62 62 62 62 62 49 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 58 58 54 54 58 58 58 58 58 58 49 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 50 58 58 47 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 49 51 53 58 58 49 58 58 54 58 58 58 58 58 58 58 58 58 58 58 49 41 31 31 19 49 41 41 38 39 43 9	Open. Hide. 62 47 35 44 62 62 62 62 62 62 59 43 46 43 56 38 29 23 34 56 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 59 59 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 59 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 59 59 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 54 54 58 58 58 54 58 58 58 58 58 54 58 40 54 42 58 45 38 58 49 58 51 58 49 47 58 58 58 54 53 51 58 58 58 58 58 58 58 58 58 58 54 50 58 49 58 58 58 58 47 58 51 58 53 51 58 58 58 58 58 58 58 48 58 54 51 58 47 58 58 58 58 58 58 58 37 33 44 48 58 49 58 51 58 50 58 51 51 58 51 58 58 51 58 58 51 58 58 58 58 52 53 58 58 58 47 50 58 54 42 51 51 33 49 54 51 37 54 32 54 54 51 54 54 54 51 39 41 51 38 54 54 54 53 54 54 54 54 54 51 54 51 54 54 54 53 54 53 54 52 54 51 54 54 54 44 46 39 39 44 44 15 7

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_106611322_106611866
seq2: B6Ng01-307H03.b_72_616 (reverse)

seq1  CCACCCCACCCCCCAAAACCCCTTGATGTATCTGCAGATAGCAGAAACCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCCCACCCCCCAAAACCCCTTGATGTATCTGCAGATAGCAGAAACCC  50

seq1  TTATTCAATGCCTTCTACAGTCTGAAAACCTTGAAGACAGTTTCTCCTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATTCAATGCCTTCTACAGTCTGAAAACCTTGAAGACAGTTTCTCCTTT  100

seq1  CACTTGTAAAGGGATAGTCACTGTCACAGCTGCCACATGCAGGGACACTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTTGTAAAGGGATAGTCACTGTCACAGCTGCCACATGCAGGGACACTG  150

seq1  GCTGCGGAGCATGCTGTCCCAGCATCTTGCACAAGGAATGCCTGAGGGAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCGGAGCATGCTGTCCCAGCATCTTGCACAAGGAATGCCTGAGGGAA  200

seq1  GTGTGCTTTCTCCACAGATGTTAAGATGGAGGCATAGGGCTTAATTGGTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGCTTTCTCCACAGATGTTAAGATGGAGGCATAGGGCTTAATTGGTC  250

seq1  TAGATTTCATACTGACATGGGTGGTGGGGTGCTACATCCACTCCAGTAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGATTTCATACTGACATGGGTGGTGGGGTGCTACATCCACTCCAGTAGT  300

seq1  GACTCGCATTACAGGTTTGGAAACCTGGAAGCAGTCCTGAGGCAAAGAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCGCATTACAGGTTTGGAAACCTGGAAGCAGTCCTGAGGCAAAGAAT  350

seq1  TTCAAGGAAACTCAGCCTCTTGGAACCTTGGCATTCCCATAGCTCGAATG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAGGAAACTCAGCCTCTTGGAACCTTGGCATTCCCATAGCTCGAATG  400

seq1  CCCCAGATTTGTCCCTGAAATATTGTGGAGGGTCTTGCATGCTTTCTTAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGATTTGTCCCTGAAATATTGTGGAGGGTCTTGCATGCTTTCTTAT  450

seq1  AGTATTTTACTGGCTAAGAGTTAGAAATCTCAGGGCAAGCTTAGCAGAGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATTTTACTGGCTAAGAGTTAGAAATCTCAGGGCAAGCTTAGCAGAGT  500

seq1  ATACTTAGAATCTTCACTACAGTCAGGTATGGCAGACTACATTGC  545
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTTAGAATCTTCACTACAGTCAGGTATGGCAGACTACATTGC  545

seq1: chr8_106576934_106577590
seq2: B6Ng01-307H03.g_64_720

seq1  GAATTCTTGGAGACTGAGCCCCACCCAACCTGCCAGACTACCTGGGTCCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGGAGACTGAGCCCCACCCAACCTGCCAGACTACCTGGGTCCC  50

seq1  TTATGTAGACTAAGAGCATTGCCTCCTACTGATGATGGTGGGGCTCAGCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTAGACTAAGAGCATTGCCTCCTACTGATGATGGTGGGGCTCAGCC  100

seq1  CTCTGCTGAGTCACTAGACACCTAGACCTGGCTTAACACCATCAAACATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCTGAGTCACTAGACACCTAGACCTGGCTTAACACCATCAAACATA  150

seq1  TTGGAAGGGCCTCCTCCTCCACAAACTACACTAATTAATTTGTGATCCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGAAGGGCCTCCTCCTCCACAAACTACACTAATTAATTTGTGATCCCC  200

seq1  GGCAGGGGGTCCTCAGCATCCTGCATCTGCCAACCTAATTATGAAATAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGGGGGTCCTCAGCATCCTGCATCTGCCAACCTAATTATGAAATAGC  250

seq1  CCTGGCAGGCAGCTTCATGGCCTTGGGTGATCCCAGCACAGGCACCAACA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGCAGGCAGCTTCATGGCCTTGGGTGATCCCAGCACAGGCACCAACA  300

seq1  GCTGGAGGGGACAACAACTACCACCTACAACCAGATGATAAAATGAAGTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGGAGGGGACAACAACTACCACCTACAACCAGATGATAAAATGAAGTC  350

seq1  ATCAGCACTGCTAATGACAAAAATGATAACCACACCAGCCAGCATGTATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGCACTGCTAATGACAAAAATGATAACCACACCAGCCAGCATGTATT  400

seq1  GAGCTCCTAGGAGGTGGCACATACTTAGAGAACTATCTCCCACATTTCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTCCTAGGAGGTGGCACATACTTAGAGAACTATCTCCCACATTTCTA  450

seq1  CGAGCTCAGAAGGTATCAAGAGCATCCTGTTTCTCAACAGGAAATGAAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGCTCAGAAGGTATCAAGAGCATCCTGTTTCTCAACAGGAAATGAAGG  500

seq1  CTCAGAGAGGATGGAGAATTTGTCAAGCCTGTAATAGATCTAAGGTACAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGAGAGGATGGAGAATTTGTCAAGCCTGTAATAGATCTAAGGTACAA  550

seq1  ATGCAAGAATGCCTTCCTCCAAGGCTTGTTATCATCATAGTCTACATTCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCAAGAATGCCTTCCTCCAAGGCTTGTTATCATCATAGTCTACATTCC  600

seq1  ATAGCAGGGAGAGGGCTTGTACCACTGTGTGTGTGTGTGTGTGTGTGTGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGCAGGGAGAGGGCTTGTACCACTGTGTGTGTGTGTGTGTGTGTGTGT  650

seq1  GTGTGTG  657
      |||||||
seq2  GTGTGTG  657

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information