MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-319A05
Chromosome	8 (Build37)
Map Location	122,646,503 - 122,818,950
singlet/doublet	doublet
Overlap gene	6430548M08Rik, 1700120B06Rik
Upstream gene	Cdh13, Hsbp1, Mlycd, Osgin1, Efcbp2, Gm587, Mbtps1, Hsdl1, Lrrc50, Taf1c, EG628061, 4930403J07Rik, Kcng4, Wfdc1, Atp2c2, 4632415K11Rik, Cotl1, BC025816, Usp10, Crispld2, Zdhhc7
Downstream gene	Gse1, 4833427B12Rik, LOC668301, 1190005I06Rik, Cox4nb, Cox4i1, Irf8, LOC100042333, Foxf1a, Mthfsd, Foxc2, Foxl1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cdh13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12554 MGI:99551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68196 MGI:1915446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlycd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56690 MGI:1928485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osgin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71839 MGI:1919089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117148 MGI:2152211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm587 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234788 MGI:2685433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbtps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56453 MGI:1927235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsdl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72552 MGI:1919802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68270 MGI:1915520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21341 MGI:109576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628061 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628061 MGI:3648822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1213 ESTs, 6 Proteins

name	4930403J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75773 MGI:1923023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	Kcng4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66733 MGI:1913983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67866 MGI:1915116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69047 MGI:1916297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 38 ESTs, 7 Proteins

name	4632415K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74347 MGI:1921597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cotl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72042 MGI:1919292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025816 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234796 MGI:2385305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22224 MGI:894652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crispld2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78892 MGI:1926142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102193 MGI:2142662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430548M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234797 MGI:2443793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700120B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436062 MGI:3588213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gse1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382034 MGI:1098275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833427B12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272551 MGI:1921019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	1190005I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68918 MGI:1916168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox4nb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18117 MGI:1343095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox4i1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12857 MGI:88473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15900 MGI:96395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Foxf1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15227 MGI:1347470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mthfsd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234814 MGI:2679252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14234 MGI:1347481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14241 MGI:1347469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdh13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351346 GeneID:12554 MGI:99551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 13 transcript_id : NM_019707.3

name	Hsbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311872 GeneID:68196 MGI:1915446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock factor binding protein 1 transcript_id : NM_024219.1

name	Mlycd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56797738 GeneID:56690 MGI:1928485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : malonyl-CoA decarboxylase transcript_id : NM_019966.2

name	Osgin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794397 GeneID:71839 MGI:1919089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidative stress induced growth inhibitor 1 transcript_id : NM_027950.1

name	Efcbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131117 GeneID:117148 MGI:2152211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF hand calcium binding protein 2 transcript_id : NM_054095.2

name	Gm587 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57977292 GeneID:234788 MGI:2685433
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 587, (NCBI) transcript_id : NM_001009950.1

name	Mbtps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476184 GeneID:56453 MGI:1927235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-bound transcription factor peptidase, site 1 transcript_id : NM_019709.3

name	Hsdl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802950 GeneID:72552 MGI:1919802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid dehydrogenase like 1 transcript_id : NM_175185.3

name	Lrrc50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803422 GeneID:68270 MGI:1915520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 50 transcript_id : NM_026648.2

name	Taf1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778984 GeneID:21341 MGI:109576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C transcript_id : NM_021441.2

name	EG628061 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383838 GeneID:628061 MGI:3648822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1213 ESTs, 6 Proteins product : predicted gene, EG628061 transcript_id : XM_895061.2

name	4930403J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383839 GeneID:75773 MGI:1923023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : RIKEN cDNA 4930403J07 gene, transcript variant 2 transcript_id : XM_915766.2

name	4930403J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383841 GeneID:75773 MGI:1923023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : RIKEN cDNA 4930403J07 gene, transcript variant 1 transcript_id : XM_486166.3

name	Kcng4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076886 GeneID:66733 MGI:1913983
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily G, member 4 transcript_id : NM_025734.2

name	Wfdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816975 GeneID:67866 MGI:1915116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 1 transcript_id : NM_023395.2

name	Atp2c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259105 GeneID:69047 MGI:1916297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 38 ESTs, 7 Proteins product : ATPase, Ca++ transporting, type 2C, member 2, transcript variant 1 transcript_id : XM_486167.5

name	4632415K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130538 GeneID:74347 MGI:1921597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632415K11 gene transcript_id : NM_028883.2

name	Cotl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383258 GeneID:72042 MGI:1919292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coactosin-like 1 (Dictyostelium) transcript_id : NM_028071.2

name	BC025816 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122778 GeneID:234796 MGI:2385305
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025816 transcript_id : NM_146219.1

name	Usp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678492 GeneID:22224 MGI:894652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 10 transcript_id : NM_009462.1

name	Crispld2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592999 GeneID:78892 MGI:1926142
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich secretory protein LCCL domain containing 2 transcript_id : NM_030209.2

name	Zdhhc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054240 GeneID:102193 MGI:2142662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 7 transcript_id : NM_133967.3

name	6430548M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377690 GeneID:234797 MGI:2443793
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430548M08 gene transcript_id : NM_172286.3

name	1700120B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702174 GeneID:436062 MGI:3588213
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700120B06 gene transcript_id : NM_001033980.1

name	Gse1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559413 GeneID:382034 MGI:1098275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : genetic suppressor element 1 transcript_id : NM_198671.1

name	4833427B12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249059 GeneID:272551 MGI:1921019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833427B12 gene transcript_id : NM_178856.1

name	1190005I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574065 GeneID:68918 MGI:1916168
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190005I06 gene transcript_id : NM_197988.1

name	Cox4nb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802224 GeneID:18117 MGI:1343095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COX4 neighbor transcript_id : NM_010926.3

name	Cox4i1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038139 GeneID:12857 MGI:88473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase subunit IV isoform 1 transcript_id : NM_009941.2

name	Irf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130835 GeneID:15900 MGI:96395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 8 transcript_id : NM_008320.3

name	LOC100042333 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259056 GeneID:100042333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001477969.1

name	Foxf1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753901 GeneID:15227 MGI:1347470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box F1a transcript_id : NM_010426.1

name	Mthfsd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372291 GeneID:234814 MGI:2679252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methenyltetrahydrofolate synthetase domain containing transcript_id : NM_172761.2

name	Foxc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850212 GeneID:14234 MGI:1347481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box C2 transcript_id : NM_013519.1

name	Foxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952617 GeneID:14241 MGI:1347469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box L1 transcript_id : NM_008024.2

name	Cdh13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625609 GeneID:12554 MGI:99551
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : cadherin 13 protein_id : NP_062681.2

name	Hsbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311873 GeneID:68196 MGI:1915446
definition	codon_start : 1 product : heat shock factor binding protein 1 protein_id : NP_077181.1

name	Mlycd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56797739 CCDS:CCDS22703.1 GeneID:56690 MGI:1928485
definition	GO_function : GO:0050080 - malonyl-CoA decarboxylase activity [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 product : malonyl-CoA decarboxylase protein_id : NP_064350.2

name	Osgin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794398 CCDS:CCDS22704.1 GeneID:71839 MGI:1919089
definition	codon_start : 1 note : pregnancy-induced growth inhibitor product : oxidative stress induced growth inhibitor 1 protein_id : NP_082226.1

name	Efcbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905129 CCDS:CCDS22705.1 GeneID:117148 MGI:2152211
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0017000 - antibiotic biosynthesis [Evidence IEA] codon_start : 1 note : neuronal calcium binding 2 product : neuronal calcium-binding protein 2 protein_id : NP_473436.1

name	Gm587 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57977293 CCDS:CCDS22706.1 GeneID:234788 MGI:2685433
definition	codon_start : 1 product : hypothetical protein LOC234788 protein_id : NP_001009950.1

name	Mbtps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476185 CCDS:CCDS22707.1 GeneID:56453 MGI:1927235
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005795 - Golgi stack [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004175 - endopeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IDA]; GO:0004289 - subtilase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042990 - regulation of transcription factor import into nucleus [Evidence IDA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : site-1 protease; subtilisin/kexin isozyme-1; subtilisin/kexin isozyme SKI-1 product : membrane-bound transcription factor protease, site 1 protein_id : NP_062683.2

name	Hsdl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424792 CCDS:CCDS22708.1 GeneID:72552 MGI:1919802
definition	codon_start : 1 product : hydroxysteroid dehydrogenase like 1 protein_id : NP_780394.1

name	Lrrc50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386136 CCDS:CCDS22709.1 GeneID:68270 MGI:1915520
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 50 protein_id : NP_080924.1

name	Taf1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778985 GeneID:21341 MGI:109576
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000120 - RNA polymerase I transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence TAS] GO_process : GO:0006350 - transcription [Evidence IEA]; GO:0006360 - transcription from RNA polymerase I promoter [Evidence TAS] codon_start : 1 note : transcription factor TAFI95; TBP-associated factor RNA polymerase I 95 kDa product : TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C protein_id : NP_067416.2

name	EG628061 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82918395 GeneID:628061 MGI:3648822
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900154.1

name	4930403J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383842 GeneID:75773 MGI:1923023
definition	codon_start : 1 product : hypothetical protein LOC75773 isoform 1 protein_id : XP_486166.3

name	4930403J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383840 GeneID:75773 MGI:1923023
definition	codon_start : 1 product : hypothetical protein LOC75773 isoform 2 protein_id : XP_920859.2

name	Kcng4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076887 CCDS:CCDS22710.1 GeneID:66733 MGI:1913983
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : voltage-gated potassium channel subunit Kv6.3 protein_id : NP_080010.2

name	Wfdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963659 CCDS:CCDS22711.1 GeneID:67866 MGI:1915116
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : WAP four-disulfide core domain 1 protein_id : NP_075884.1

name	Atp2c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259106 GeneID:69047 MGI:1916297
definition	codon_start : 1 product : ATPase, Ca++ transporting, type 2C, member 2 isoform 1 protein_id : XP_486167.5

name	4632415K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077021 GeneID:74347 MGI:1921597
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC74347 protein_id : NP_083159.1

name	Cotl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19482160 CCDS:CCDS22712.1 GeneID:72042 MGI:1919292
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0019899 - enzyme binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0050832 - defense response to fungus [Evidence IDA] codon_start : 1 note : coactosin-like protein product : coactosin-like 1 protein_id : NP_082347.1

name	BC025816 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122779 CCDS:CCDS22713.1 GeneID:234796 MGI:2385305
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234796 protein_id : NP_666331.1

name	Usp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678493 GeneID:22224 MGI:894652
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquintin c-terminal hydrolase related polypeptide product : ubiquitin specific protease 10 protein_id : NP_033488.1

name	Crispld2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229267 CCDS:CCDS22714.1 GeneID:78892 MGI:1926142
definition	codon_start : 1 product : LCCL domain containing cysteine-rich secretory protein 2 protein_id : NP_084485.1

name	Zdhhc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527186 CCDS:CCDS22715.1 GeneID:102193 MGI:2142662
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA] codon_start : 1 note : GABA-A receptor-associated membrane protein 2 product : zinc finger, DHHC domain containing 7 protein_id : NP_598728.1

name	6430548M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982038 CCDS:CCDS22716.1 GeneID:234797 MGI:2443793
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC234797 protein_id : NP_758490.2

name	1700120B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702175 CCDS:CCDS22717.1 GeneID:436062 MGI:3588213
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC436062 protein_id : NP_001029152.1

name	Gse1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559414 GeneID:382034 MGI:1098275
definition	codon_start : 1 product : genetic suppressor element 1 protein_id : NP_941073.1

name	4833427B12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249060 GeneID:272551 MGI:1921019
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : DNA replication complex GINS protein PSF2 protein_id : NP_849187.1

name	1190005I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574066 GeneID:68918 MGI:1916168
definition	codon_start : 1 product : RIKEN cDNA 1190005I06 protein_id : NP_932105.1

name	Cox4nb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754870 CCDS:CCDS22719.1 GeneID:18117 MGI:1343095
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : neighbor of Cox4 protein_id : NP_035056.1

name	Cox4i1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753498 GeneID:12857 MGI:88473
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome c oxidase, subunit IVa product : cytochrome c oxidase subunit IV isoform 1 protein_id : NP_034071.1

name	Irf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680339 CCDS:CCDS22721.1 GeneID:15900 MGI:96395
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006955 - immune response [Evidence IMP]; GO:0030099 - myeloid cell differentiation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : interferon consensus sequence binding protein 1 protein_id : NP_032346.1

name	LOC100042333 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259057 GeneID:100042333
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478019.1

name	Foxf1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753902 CCDS:CCDS22722.1 GeneID:15227 MGI:1347470
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048566 - embryonic gut development [Evidence IGI]; GO:0045198 - establishment of epithelial cell polarity [Evidence IGI]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0030324 - lung development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : HNF-3/forkhead homolog 8 product : forkhead box F1a protein_id : NP_034556.1

name	Mthfsd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370130 CCDS:CCDS22723.1 GeneID:234814 MGI:2679252
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : methenyltetrahydrofolate synthetase domain containing protein_id : NP_766349.1

name	Foxc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850213 GeneID:14234 MGI:1347481
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IC]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0048468 - cell development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IGI]; GO:0001656 - metanephros development [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IGI]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : forkhead homolog 14 product : forkhead box C2 protein_id : NP_038547.1

name	Foxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952618 GeneID:14241 MGI:1347469
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0030166 - proteoglycan biosynthesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0030111 - regulation of Wnt receptor signaling pathway [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0007495 - visceral mesoderm-endoderm interaction [Evidence IMP] codon_start : 1 note : forkhead homolog 6 product : forkhead box L1 protein_id : NP_032050.2

name	LOC668301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668301
definition	number : 2 pseudo : _no_value

name	LOC668301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668301
definition	number : 1 pseudo : _no_value

clone name	MSMg01-294N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131E04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-216K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-319A05.b	B6Ng01-319A05.g
ACC	GA108753	GA108754
length	1,135	1,107
definition	B6Ng01-319A05.b	B6Ng01-319A05.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(122,646,503 - 122,647,632)	(122,817,838 - 122,818,950)
sequence	gaattctgctcggtaacccagtgggcatgtggccaagcacataaagaatc cactaagcatgtcgaggcagctcagtagtcagtgcctattggtgactttt ctaacagggctgcttaatgtccaggcttccttgccaccaaaaaaataata cccactttacccaacagttgtatcaaggaccatcctgattattctactga tggggttttggggaacagcaaaacaagggaagaattcaacgtgaaacaac tcaaagggtcggggttctttggagtttctgttgcttaggtctaatgtaga tgaggcatgtgtagtgtcacagtggctctaagcacccgacactagacagg gaagctcttgctctacagatctatagtgagaaacctggctgtgatcaaag gagagtgatagacagcctaaagatccaatgtgcagtggagagatgccctg ctctgttgtaatccatggtgcctggtctgtcacctctggtgacattggga aagtccttatctaggagcttggcaactccatacagacccacactctcact ccctcttgtcccaggttggaggctcccaacctaatgtttcttcctctcag aggactgagcaatgggagcagtctccactgagagcagttgatctgagaga agggaagacacctgtacagtgaactagagctctgctgtaggcagcagagg ggctgcgtctgtgcacacagagtggtcctcgcactggttaggtgtcctga gtgctgggttggagggagccttcttccccattcactagccagtgtcacac gcggactcttcgcctccatgattctgaagaacgtgtttatgttccaaagt aagagaaggctggggaccgagcgggtttacctcctgttgtatgtgactgc ctgtaagggagttccaagctgattttattatggtttaaacagttgtcagt tattatacacgctgacatgtacagtttggggaaatacttgcaatgtaagc tgaagctttgctaggcttcagtgtctttatccctcccagtttccagctta ggtctggagtagtcttgcattagcgaatatagggaacatcaagttccaac tcgatcttctgccaccttttatggctatctgcttt	gaattctgagtcactgtcagaggtgggggctgacagaggagatcatgccc tgtggccctaacactcatccctcactctttaggcctcagtttccccagta agctccgcattatggtgtgacacacacccggggcctccgttggatcagga agggatcatacagccccagggtgctaggtagccaacagttccctcctcct acaaggaactcctggcataggtgggctgcgtctccctccccacagtagcc acctacttcttccctcggagccagtgccacagcctggaatccttcattcc caacagccagagttcacattataaaccctcccaacacagcaaagactagg cctccaaatgccacggccggggtgcagagactcagcccttcactgtcacc ctgagactggctgacgcctcttggcttggccccagtggctcctcacttat atgacatgaccctcaaggcctctgggatttggtgaccctcagacacctgt tttctgtgcttagctgtgtgctccaggcccaatacgagcttatcttctgc agaaattcaggactctctatggattgtggtctttcagctctgtcctcatt gcagaggaacttggcggtctagaacctgccatttacaggcccagtggggt tcaggccctggttgatctgaccttgctcgcctctgaccaacaagggtctg atggactggccctgagctggcttgccactgcctacttcctcagaggcctt tacagactacctcacatcaacaagcctgccacaccagaggctggtgcaga gacgtgcgctaattagctgtcatgagcgaagcacaggcctgtcccccccc ctccccagcaatctcacccggtcaccctctgccaccgtgtgtcaccatgc gataaaaggagttgtgttcaaagacggctcactgacaagaggctgggcag cccgtggaggcagaggacgcctgtctgcactcgctcgtcaggagggcaga cacaggagagcacaaagcacaattagctctgcagttttttcagaggcaga ctctgcactggctcttctgagtgacagggggggctaggggcacagttgaa ctctgga
quality values	Open. Hide. 54 31 25 25 58 54 47 47 62 62 62 62 54 62 62 47 47 62 54 41 56 62 62 62 62 62 62 47 56 56 43 25 28 29 34 51 41 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 51 59 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 43 43 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 47 49 62 47 47 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 54 58 49 58 54 58 58 58 58 58 54 58 58 58 58 58 58 52 58 58 58 49 54 58 54 58 58 54 58 58 58 58 58 58 58 54 58 58 58 49 49 58 58 58 58 58 58 58 58 54 45 52 58 54 54 58 58 58 29 58 50 58 58 58 51 49 51 53 58 54 58 53 51 58 50 58 58 54 58 58 51 58 58 58 58 51 42 52 58 36 49 28 30 58 58 51 32 54 58 50 51 58 58 58 58 46 58 51 50 58 54 51 50 51 46 46 58 51 51 47 54 40 58 51 39 51 58 54 35 37 52 58 58 58 32 58 37 58 50 33 58 43 44 58 50 51 31 40 43 54 49 58 51 50 50 29 51 53 58 33 32 38 53 42 50 58 40 52 53 45 54 49 40 54 54 45 53 32 51 42 49 38 52 50 32 54 19 49 49 34 44 51 51 51 45 53 53 51 54 52 51 49 27 49 42 53 52 53 53 32 52 54 49 33 47 47 53 53 52 52 40 45 38 49 40 47 41 38 30 46 31 46 31 53 51 40 52 53 32 32 47 31 45 45 49 47 37 32 46 53 35 16 53 52 37 25 38 46 34 32 45 42 53 36 46 46 52 40 34 41 29 29 41 36 42 25 46 30 32 31 30 51 31 39 28 31 36 41 31 46 24 33 26 26 32 40 30 29 41 33 25 46 43 33 32 26 36 43 31 27 34 32 43 27 42 38 22 42 37 24 31 31 42 28 46 42 31 30 43 31 34 34 31 26 46 37 29 32 21 32 21 39 29 32 19 13 22 16 36 36 46 46 31 18 15 37 21 31 17 37 32 46 32 25 48 11 25 30 31 22 26 31 31 36 25 33 31 20 32 33 37 30 24 38 28 33 37 20 32 30 31 24 17 22 12 44 31 5 10 24 30 18 21 14 21 21 34 33 32 32 21 43 43 23 15 32 34 32 20 22 23 7 39 14 31 37 13 6 14 11 19 18 34 32 32 31 24 31 13 12 10 13 19 25 23 30 17 28 14 30 32 32 16 9 7 15 21 9 18 20 14 8 20 40 20 18 34 30 22 10 34 21 13 18 21 13 13 28 27 27 25 6 21 26 14 19 24 28 28 27 14 18 14 28 28 47 11 13 28 24 11 11 10 24 9 19 5 3 4 6 11 21 10 7 28 10 8 8 14 26 16 10 15 28 23 13 17 16 25 11 3 11 8 16 9 8 6 22 5 5 13 15 15 16 10 22 5 11 17 6 6 10 7 7 13 15 10 16 9 17 7 12 12 19 5 4 5 11 7 11 28 10 3 4 8 15 12 18 7 7 4 4 7 26 21 7 5 13 6 20 5 15 7 16 13 19 8 5 3 3 4 4 4 12 8 12 26 6 6 6 5 6 6 3 6 4 8 9 7 7 13 25 6	Open. Hide. 62 44 51 47 62 62 59 44 56 28 32 44 39 35 34 38 59 59 59 62 49 54 62 62 62 54 54 62 62 62 62 62 59 62 62 59 54 59 62 54 54 59 49 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 54 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 47 49 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 31 39 62 62 62 54 62 62 47 42 62 62 62 62 62 35 62 52 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 54 58 58 58 58 58 58 58 52 54 58 46 41 49 43 58 58 58 45 44 58 52 58 58 54 58 52 54 58 58 58 58 58 54 58 52 58 58 38 42 58 54 53 52 58 54 49 58 58 58 58 58 52 50 58 47 30 37 58 58 50 58 58 51 58 58 58 50 49 38 50 58 58 58 58 58 51 53 58 58 58 50 58 58 58 51 52 37 46 20 58 58 40 40 58 54 51 41 51 54 49 46 58 58 41 32 58 49 40 58 52 58 48 44 46 51 58 50 50 52 39 50 58 40 58 54 53 53 39 44 38 39 43 42 50 50 50 41 58 40 58 58 53 52 51 40 58 53 41 39 50 49 53 41 26 51 50 51 52 50 37 49 41 39 53 51 51 50 50 50 32 39 26 49 39 49 53 37 54 46 42 53 52 39 41 32 54 51 38 26 41 49 47 37 49 49 42 34 32 16 51 47 46 52 33 36 33 47 37 38 31 42 45 40 37 54 40 40 40 53 53 40 39 52 37 42 31 53 22 51 25 38 37 53 47 31 32 31 35 35 31 32 35 32 46 40 34 40 35 35 45 34 26 31 52 31 46 31 34 40 33 51 31 46 27 30 43 30 30 30 24 32 8 40 33 31 30 51 25 30 30 37 28 41 13 27 28 26 31 37 35 30 42 31 31 37 37 31 31 29 30 31 43 31 36 29 31 31 42 31 42 17 31 27 16 33 31 30 27 9 46 29 31 32 31 26 29 43 41 32 38 36 33 32 28 39 27 46 46 23 25 24 38 26 26 27 31 31 32 38 31 41 30 32 36 24 35 30 31 47 33 34 32 32 42 14 25 22 21 22 31 30 36 22 31 19 29 21 24 35 22 33 24 30 20 37 21 31 43 44 21 29 15 31 22 36 18 32 20 31 17 17 20 17 43 24 21 33 23 19 22 16 33 28 27 32 34 23 20 18 22 21 25 33 16 16 24 30 25 43 20 14 32 15 32 37 30 16 8 14 19 10 5 22 24 13 8 27 11 9 16 7 13 20 30 27 22 7 16 26 12 23 4 11 28 24 13 13 23 27 14 15 18 11 9 8 3 3 29 18 10 21 10 22 6 5 9 6 16 6 23 6 9 5 19 3 7 13 38 32 9 6 11 10 12 19 4 17 8 4 20 7 19 18 7 12 9 8 17 28 28 28 28 21 6 6 11 3 3 3 1 4 4 13 7 7 7 7 8 8 16 15 13 21 20 10 6 6 13 7 7 8 7 18 5 11 10 13 6 7 4 4 11 3 19 27 17 3 4 9 20 13 11 7 1 3 4 7 2 1 1 2 1 3 4 5 5 3 2 3 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_122646503_122647632
seq2: B6Ng01-319A05.b_44_1178

seq1  GAATTCTGCTCGGTAACCCAGTGGGCATGTGGCCAAGCACATAAAGAATC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGCTCGGTAACCCAGTGGGCATGTGGCCAAGCACATAAAGAATC  50

seq1  CACTAAGCATGTCGAGGCAGCTCAGTAGTCAGTGCCTATTGGTGACTTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTAAGCATGTCGAGGCAGCTCAGTAGTCAGTGCCTATTGGTGACTTTT  100

seq1  CTAACAGGGCTGCTTAATGTCCAGGCTTCCTTGCCACCAAAAAAATAATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACAGGGCTGCTTAATGTCCAGGCTTCCTTGCCACCAAAAAAATAATA  150

seq1  CCCACTTTACCCAACAGTTGTATCAAGGACCATCCTGATTATTCTACTGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACTTTACCCAACAGTTGTATCAAGGACCATCCTGATTATTCTACTGA  200

seq1  TGGGGTTTTGGGGAACAGCAAAACAAGGGAAGAATTCAACGTGAAACAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGTTTTGGGGAACAGCAAAACAAGGGAAGAATTCAACGTGAAACAAC  250

seq1  TCAAAGGGTCGGGGTTCTTTGGAGTTTCTGTTGCTTAGGTCTAATGTAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAGGGTCGGGGTTCTTTGGAGTTTCTGTTGCTTAGGTCTAATGTAGA  300

seq1  TGAGGCATGTGTAGTGTCACAGTGGCTCTAAGCACCCGACACTAGACAGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCATGTGTAGTGTCACAGTGGCTCTAAGCACCCGACACTAGACAGG  350

seq1  GAAGCTCTTGCTCTACAGATCTATAGTGAGAAACCTGGCTGTGATCAAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCTCTTGCTCTACAGATCTATAGTGAGAAACCTGGCTGTGATCAAAG  400

seq1  GAGAGTGATAGACAGCCTAAAGATCCAATGTGCAGTGGAGAGATGCCCTG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGTGATAGACAGCCTAAAGATCCAATGTGCAGTGGAGAGATGCCCTG  450

seq1  CTCTGTTGTAATCCATGGTGCCTGGTCTGTCACCTCTGGTGACATTGGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTTGTAATCCATGGTGCCTGGTCTGTCACCTCTGGTGACATTGGGA  500

seq1  AAGTCCTTATCTAGGAGCTTGGCAACTCCATACAGACCCACACTCTCACT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCCTTATCTAGGAGCTTGGCAACTCCATACAGACCCACACTCTCACT  550

seq1  CCCTCTTGTCCCAGGTTGGAGGCTCCCAACCTAATGTTTCTTCCTCTCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCTTGTCCCAGGTTGGAGGCTCCCAACCTAATGTTTCTTCCTCTCAG  600

seq1  AGGACTGAGCAATGGGAGCAGTCTCCACTGAGAGCAGTTGATCTGAGAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGACTGAGCAATGGGAGCAGTCTCCACTGAGAGCAGTTGATCTGAGAGA  650

seq1  AGGGAAGACACCTGTACAGTGAACTAGAGCTCTGCTGTAGGCAGCAGAGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAAGACACCTGTACAGTGAACTAGAGCTCTGCTGTAGGCAGCAGAGG  700

seq1  GGCTGCGTCTGTGCACACAGAGTGGTCCTCGCACTGGTTAGGTGTCCTGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCGTCTGTGCACACAGAGTGGTCCTCGCACTGGTTAGGTGTCCTGA  750

seq1  GTGCTGGGTTGGAGGGAGCCTTCTTCCCCATTCACTAGCCAGTGTCACAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGCTGGGTTGGAGGGAGCCTTCTTCCCCATTCACTAGCCAGTGTCACAC  800

seq1  GCGGACTCTTCGCCTCCATGATTCTGAAGAACGTGTTTATGTTCCAAAGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGGACTCTTCGCCTCCATGATTCTGAAGAACGTGTTTATGTTCCAAAGT  850

seq1  AAGAGAAGGCTGGGGACCGAGCGGGTTTACCTCCTGTTGTATGTGACTGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAAGGCTGGGGACCGAGCGGGTTTACCTCCTGTTGTATGTGACTGC  900

seq1  CTGTAAGGGAGTTCCAAGCTGATTTTATTATGGTTAAAACAGTTGTCAGT  950
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  CTGTAAGGGAGTTCCAAGCTGATTTTATTATGGTTTAAACAGTTGTCAGT  950

seq1  TA-TATACACGCTGACATGTACAGTTTGGGGAAATACTTGCAAATGTAAG  999
      || |||||||||||||||||||||||||||||||||||||| ||||||||
seq2  TATTATACACGCTGACATGTACAGTTTGGGGAAATACTTGC-AATGTAAG  999

seq1  CTGAAGCTTTGCTAGGCTTCCAGTGTTCTTTATCCCTCCCAGTTTTCCAG  1049
      ||||||||||||||||||| ||||| |||||||||||||||| |||||||
seq2  CTGAAGCTTTGCTAGGCTT-CAGTG-TCTTTATCCCTCCCAG-TTTCCAG  1046

seq1  C-TAAGTCT-GAGTAAGTC-TGCATTAGCG-ATATAGGGAACATC-AGT-  1093
      | || |||| |||| |||| |||||||||| |||||||||||||| ||| 
seq2  CTTAGGTCTGGAGT-AGTCTTGCATTAGCGAATATAGGGAACATCAAGTT  1095

seq1  -CCACTCGATCTTCTTGCCAC--TTTAT-GCTATCTGCTTT  1130
       | ||||||||||| ||||||  ||||| ||||||||||||
seq2  CCAACTCGATCTTC-TGCCACCTTTTATGGCTATCTGCTTT  1135

seq1: chr8_122817838_122818950
seq2: B6Ng01-319A05.g_70_1176 (reverse)

seq1  TCCAGAG--CCACTGTGCCCCCTACCCCCCACTGTCACTCAGAAGAGCCC  48
      |||||||  | |||||| |||||| ||||| |||||||||||||||| ||
seq2  TCCAGAGTTCAACTGTG-CCCCTAGCCCCCCCTGTCACTCAGAAGAG-CC  48

seq1  AGTGCAGAGTCTGCCCTTCTGAAAAAACTGGCAGAGGCTAATTGTGCTTT  98
      |||||||||||||||  |||||||||||| ||||| ||||||||||||||
seq2  AGTGCAGAGTCTGCC--TCTGAAAAAACT-GCAGA-GCTAATTGTGCTTT  94

seq1  GTGGCTCTCCTGTGTCTGCCCTCCCTGACGAGCGAGTGGCAGACAGGCGT  148
      || ||||||||||||||||||| |||||||||||||| ||||||||||||
seq2  GT-GCTCTCCTGTGTCTGCCCT-CCTGACGAGCGAGT-GCAGACAGGCGT  141

seq1  CCTCTGCCTCCACGGGCTGCCCAGCCTCTTGTCAGTGAGCCGTCTTTGAA  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGCCTCCACGGGCTGCCCAGCCTCTTGTCAGTGAGCCGTCTTTGAA  191

seq1  CACAACTCCTTTTATCGCATGGTGACACACGGTGGCAGAGGGTGACCGGG  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAACTCCTTTTATCGCATGGTGACACACGGTGGCAGAGGGTGACCGGG  241

seq1  TGAGATTGCTGGGGA-GGGGGGGGACAGGCCTGTGCTTCGCTCATGACAG  297
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  TGAGATTGCTGGGGAGGGGGGGGGACAGGCCTGTGCTTCGCTCATGACAG  291

seq1  CTAATTAGCGCACGTCTCTGCACCAGCCTCTGGTGTGGCAGGCTTGTTGA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATTAGCGCACGTCTCTGCACCAGCCTCTGGTGTGGCAGGCTTGTTGA  341

seq1  TGTGAGGTAGTCTGTAAAGGCCTCTGAGGAAGTAGGCAGTGGCAAGCCAG  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGAGGTAGTCTGTAAAGGCCTCTGAGGAAGTAGGCAGTGGCAAGCCAG  391

seq1  CTCAGGGCCAGTCCATCAGACCCTTGTTGGTCAGAGGCGAGCAAGGTCAG  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGGCCAGTCCATCAGACCCTTGTTGGTCAGAGGCGAGCAAGGTCAG  441

seq1  ATCAACCAGGGCCTGAACCCCACTGGGCCTGTAAATGGCAGGTTCTAGAC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAACCAGGGCCTGAACCCCACTGGGCCTGTAAATGGCAGGTTCTAGAC  491

seq1  CGCCAAGTTCCTCTGCAATGAGGACAGAGCTGAAAGACCACAATCCATAG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCCAAGTTCCTCTGCAATGAGGACAGAGCTGAAAGACCACAATCCATAG  541

seq1  AGAGTCCTGAATTTCTGCAGAAGATAAGCTCGTATTGGGCCTGGAGCACA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGTCCTGAATTTCTGCAGAAGATAAGCTCGTATTGGGCCTGGAGCACA  591

seq1  CAGCTAAGCACAGAAAACAGGTGTCTGAGGGTCACCAAATCCCAGAGGCC  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTAAGCACAGAAAACAGGTGTCTGAGGGTCACCAAATCCCAGAGGCC  641

seq1  TTGAGGGTCATGTCATATAAGTGAGGAGCCACTGGGGCCAAGCCAAGAGG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGGGTCATGTCATATAAGTGAGGAGCCACTGGGGCCAAGCCAAGAGG  691

seq1  CGTCAGCCAGTCTCAGGGTGACAGTGAAGGGCTGAGTCTCTGCACCCCGG  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGTCAGCCAGTCTCAGGGTGACAGTGAAGGGCTGAGTCTCTGCACCCCGG  741

seq1  CCGTGGCATTTGGAGGCCTAGTCTTTGCTGTGTTGGGAGGGTTTATAATG  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGTGGCATTTGGAGGCCTAGTCTTTGCTGTGTTGGGAGGGTTTATAATG  791

seq1  TGAACTCTGGCTGTTGGGAATGAAGGATTCCAGGCTGTGGCACTGGCTCC  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAACTCTGGCTGTTGGGAATGAAGGATTCCAGGCTGTGGCACTGGCTCC  841

seq1  GAGGGAAGAAGTAGGTGGCTACTGTGGGGAGGGAGACGCAGCCCACCTAT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGGAAGAAGTAGGTGGCTACTGTGGGGAGGGAGACGCAGCCCACCTAT  891

seq1  GCCAGGAGTTCCTTGTAGGAGGAGGGAACTGTTGGCTACCTAGCACCCTG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAGGAGTTCCTTGTAGGAGGAGGGAACTGTTGGCTACCTAGCACCCTG  941

seq1  GGGCTGTATGATCCCTTCCTGATCCAACGGAGGCCCCGGGTGTGTGTCAC  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCTGTATGATCCCTTCCTGATCCAACGGAGGCCCCGGGTGTGTGTCAC  991

seq1  ACCATAATGCGGAGCTTACTGGGGAAACTGAGGCCTAAAGAGTGAGGGAT  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATAATGCGGAGCTTACTGGGGAAACTGAGGCCTAAAGAGTGAGGGAT  1041

seq1  GAGTGTTAGGGCCACAGGGCATGATCTCCTCTGTCAGCCCCCACCTCTGA  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTGTTAGGGCCACAGGGCATGATCTCCTCTGTCAGCCCCCACCTCTGA  1091

seq1  CAGTGACTCAGAATTC  1113
      ||||||||||||||||
seq2  CAGTGACTCAGAATTC  1107

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information