MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-324P01
Chromosome	8 (Build37)
Map Location	41,715,289 - 41,716,123
singlet/doublet	singlet
Overlap gene	Mtmr7
Upstream gene	Msr1, EG621431, LOC100039072, LOC666959, EG632166, Fgf20, 2900075B16Rik, Zdhhc2, Cnot7, Vps37a
Downstream gene	LOC100039179, Adam24, LOC667019, LOC100039170, LOC436137, Adam25, EG667041, LOC667052, LOC384806, Adam39, LOC384808, EG667077, Slc7a2, Pdgfrl, Mtus1, Fgl1, Pcm1, Asah1, Frg1, LOC100039376
Link	Open Mouse BAC browser

Click to get alignment info.

name	Msr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20288 MGI:98257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621431 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621431 MGI:3646883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039072 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC666959 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666959
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG632166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632166 MGI:3647792
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	Fgf20 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80857 MGI:1891346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900075B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78506 MGI:1925756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 6 Proteins

name	Zdhhc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70546 MGI:1923452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnot7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18983 MGI:1298230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps37a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52348 MGI:1261835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtmr7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54384 MGI:1891693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039179 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Adam24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13526 MGI:105984
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins pseudo : _no_value

name	LOC100039170 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039170
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC436137 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436137
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	Adam25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23793 MGI:1345157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667041 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667041 MGI:3643054
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC667052 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 Proteins pseudo : _no_value

name	LOC384806 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Adam39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546055 MGI:3045694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC384808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:384808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	EG667077 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667077 MGI:3647926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	Slc7a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11988 MGI:99828
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdgfrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68797 MGI:1916047
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtus1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102103 MGI:2142572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Fgl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234199 MGI:102795
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18536 MGI:1277958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asah1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11886 MGI:1277124
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Frg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14300 MGI:893597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039376 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 24 Proteins pseudo : _no_value

name	Msr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85861253 GeneID:20288 MGI:98257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage scavenger receptor 1 transcript_id : NM_031195.2

name	LOC100039072 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258719 GeneID:100039072
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Ubtf protein transcript_id : XM_001472203.1

name	Fgf20 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13447395 GeneID:80857 MGI:1891346
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 20 transcript_id : NM_030610.1

name	2900075B16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149258721 GeneID:78506 MGI:1925756
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 6 Proteins product : RIKEN cDNA 2900075B16 gene, transcript variant 1 transcript_id : XM_357872.6

name	Zdhhc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357536 GeneID:70546 MGI:1923452
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 2 transcript_id : NM_178395.3

name	Cnot7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801824 GeneID:18983 MGI:1298230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 7 transcript_id : NM_011135.3

name	Vps37a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111955226 GeneID:52348 MGI:1261835
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 37A (yeast) transcript_id : NM_033560.3

name	Mtmr7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:103472016 GeneID:54384 MGI:1891693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myotubularin related protein 7 transcript_id : NM_001040699.1

name	LOC100039179 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258723 GeneID:100039179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100039179 transcript_id : XM_001472328.1

name	Adam24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384630 GeneID:13526 MGI:105984
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 24 (testase 1) transcript_id : NM_010086.3

name	Adam25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6752969 GeneID:23793 MGI:1345157
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 25 (testase 2) transcript_id : NM_011781.1

name	LOC384806 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:57222285 GeneID:384806
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : similar to testase-8 transcript_id : NM_001009548.1

name	Adam39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119392067 GeneID:546055 MGI:3045694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : a disintegrin and metallopeptidase domain 39 transcript_id : NM_001025380.3

name	Slc7a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680129 GeneID:11988 MGI:99828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 transcript_id : NM_007514.3

name	Slc7a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680232 GeneID:11988 MGI:99828
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 transcript_id : NM_001044740.1

name	Pdgfrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476141 GeneID:68797 MGI:1916047
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-derived growth factor receptor-like transcript_id : NM_026840.2

name	Mtus1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074533 GeneID:102103 MGI:2142572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial tumor suppressor 1 transcript_id : NM_001005863.2

name	Mtus1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074539 GeneID:102103 MGI:2142572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial tumor suppressor 1 transcript_id : NM_001005864.2

name	Mtus1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111074537 GeneID:102103 MGI:2142572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial tumor suppressor 1 transcript_id : NM_001005865.2

name	Fgl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704195 GeneID:234199 MGI:102795
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibrinogen-like protein 1 transcript_id : NM_145594.1

name	Pcm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803348 GeneID:18536 MGI:1277958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pericentriolar material 1 transcript_id : NM_023662.2

name	Asah1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790018 GeneID:11886 MGI:1277124
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acylsphingosine amidohydrolase 1 transcript_id : NM_019734.1

name	Frg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305068 GeneID:14300 MGI:893597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FSHD region gene 1 transcript_id : NM_013522.1

name	Msr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85861254 GeneID:20288 MGI:98257
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005319 - lipid transporter activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence IEA] codon_start : 1 note : scavenger receptor product : macrophage scavenger receptor 1 protein_id : NP_112472.2

name	LOC100039072 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258720 GeneID:100039072
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472253.1

name	Fgf20 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13447396 GeneID:80857 MGI:1891346
definition	codon_start : 1 exception : unclassified translation discrepancy product : fibroblast growth factor 20 protein_id : NP_085113.1

name	2900075B16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149258722 GeneID:78506 MGI:1925756
definition	codon_start : 1 product : hypothetical protein LOC78506 isoform 1 protein_id : XP_357872.6

name	Zdhhc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30409974 CCDS:CCDS22252.1 GeneID:70546 MGI:1923452
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA] codon_start : 1 product : zinc finger, DHHC domain containing 2 protein_id : NP_848482.1

name	Cnot7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755126 CCDS:CCDS22253.1 GeneID:18983 MGI:1298230
definition	GO_component : GO:0030014 - CCR4-NOT complex [Evidence IPI]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0016563 - transcriptional activator activity [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IEA] GO_process : GO:0016481 - negative regulation of transcription [Evidence IEA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : catabolite repressor protein (CCR4)-associative factor 1; POP2 homolog product : CCR4-NOT transcription complex, subunit 7 protein_id : NP_035265.1

name	Vps37a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981032 CCDS:CCDS22254.1 GeneID:52348 MGI:1261835
definition	GO_function : GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 37A protein_id : NP_291038.2

name	Mtmr7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:103472017 GeneID:54384 MGI:1891693
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IDA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0046839 - phospholipid dephosphorylation [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : myotubularin related protein 7 protein_id : NP_001035789.1

name	LOC100039179 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258724 GeneID:100039179
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472378.1

name	Adam24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981793 CCDS:CCDS22255.1 GeneID:13526 MGI:105984
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005178 - integrin binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : disintegrin 5; testase 1; a disintegrin and metalloprotease domain 24 (testase 1) product : a disintegrin and metalloproteinase domain 24 (testase 1) protein_id : NP_034216.2

name	Adam25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6752970 CCDS:CCDS22256.1 GeneID:23793 MGI:1345157
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005178 - integrin binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA] [Evidence ISS]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : testase 2; a disintegrin and metalloprotease domain 25 (testase 2) product : a disintegrin and metalloprotease domain 25 protein_id : NP_035911.1

name	LOC384806 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:57222286 GeneID:384806
definition	codon_start : 1 function : proteolytic enzyme product : hypothetical protein LOC384806 protein_id : NP_001009548.1

name	Adam39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119392068 GeneID:546055 MGI:3045694
definition	GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : testase 9 protein_id : NP_001020551.3

name	Slc7a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680233 GeneID:11988 MGI:99828
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015359 - amino acid permease activity [Evidence IEA]; GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; amino acid transporter, cationic 2 (low affinity); cationic amino acid transporter 2B; cationic amino acid transporter 2A; cationic transporter CAT2 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 isoform 2 protein_id : NP_001038205.1

name	Slc7a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680130 CCDS:CCDS22258.1 GeneID:11988 MGI:99828
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015359 - amino acid permease activity [Evidence IEA]; GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0043169 - cation binding [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; amino acid transporter, cationic 2 (low affinity); cationic amino acid transporter 2B; cationic amino acid transporter 2A; cationic transporter CAT2 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 isoform 1 protein_id : NP_031540.2

name	Pdgfrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476142 CCDS:CCDS22259.1 GeneID:68797 MGI:1916047
definition	codon_start : 1 exception : mismatches in translation product : platelet-derived growth factor receptor-like protein_id : NP_081116.2

name	Mtus1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54312129 GeneID:102103 MGI:2142572
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; AT2 receptor-interacting protein 1; coiled-coiled tumor supressor gene 1; angiotensin II AT2 receptor-interacting protein 1 product : mitochondrial tumor suppressor 1 isoform 1 protein_id : NP_001005863.1

name	Mtus1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54312135 GeneID:102103 MGI:2142572
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; AT2 receptor-interacting protein 1; coiled-coiled tumor supressor gene 1; angiotensin II AT2 receptor-interacting protein 1 product : mitochondrial tumor suppressor 1 isoform 3 protein_id : NP_001005864.1

name	Mtus1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111074538 GeneID:102103 MGI:2142572
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; AT2 receptor-interacting protein 1; coiled-coiled tumor supressor gene 1; angiotensin II AT2 receptor-interacting protein 1 product : mitochondrial tumor suppressor 1 isoform 4 protein_id : NP_001005865.2

name	Fgl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704196 CCDS:CCDS22260.1 GeneID:234199 MGI:102795
definition	codon_start : 1 exception : mismatches in translation product : fibrinogen-like protein 1 protein_id : NP_663569.1

name	Pcm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13540494 CCDS:CCDS22261.1 GeneID:18536 MGI:1277958
definition	codon_start : 1 exception : mismatches in translation note : pericentriolar material gene 1 protein product : pericentriolar material 1 protein_id : NP_076151.1

name	Asah1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790019 CCDS:CCDS22262.1 GeneID:11886 MGI:1277124
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0017040 - ceramidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 function : catalyzes the hydrolysis of ceramide to fatty acid and sphingosine note : acid ceramidase product : N-acylsphingosine amidohydrolase (acid ceramidase) 1 protein_id : NP_062708.1

name	Frg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305069 CCDS:CCDS22263.1 GeneID:14300 MGI:893597
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation function : unknown product : FSHD region gene 1 protein_id : NP_038550.1

name	EG621431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621431
definition	number : 6 pseudo : _no_value

name	EG621431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621431
definition	number : 5 pseudo : _no_value

name	EG621431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621431
definition	number : 4 pseudo : _no_value

name	EG621431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621431
definition	number : 3 pseudo : _no_value

name	EG621431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621431
definition	number : 2 pseudo : _no_value

name	EG621431 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621431
definition	number : 1 pseudo : _no_value

name	LOC666959 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666959
definition	number : 1 pseudo : _no_value

name	LOC666959 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666959
definition	number : 2 pseudo : _no_value

name	LOC666959 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666959
definition	number : 3 pseudo : _no_value

name	LOC666959 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666959
definition	number : 4 pseudo : _no_value

name	EG632166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632166
definition	number : 1 pseudo : _no_value

name	EG632166 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:632166
definition	number : 2 pseudo : _no_value

name	LOC100039170 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039170
definition	number : 1 pseudo : _no_value

name	LOC436137 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436137
definition	number : 1 pseudo : _no_value

name	EG667041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667041
definition	number : 1 pseudo : _no_value

name	EG667041 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667041
definition	number : 2 pseudo : _no_value

name	LOC667052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667052
definition	number : 1 pseudo : _no_value

name	LOC384808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384808
definition	number : 2 pseudo : _no_value

name	LOC384808 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384808
definition	number : 1 pseudo : _no_value

name	LOC667019 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258725 GeneID:667019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 4 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_030685.1

name	EG667077 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94383445 GeneID:667077 MGI:3647926
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : predicted gene, EG667077 pseudo : _no_value transcript_id : XR_001968.1

name	LOC100039376 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258726 GeneID:100039376
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 60 ESTs, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_030884.1

clone name	MSMg01-050F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516E21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397J06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-184O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128D15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-205J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369A08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356E06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-322F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140N16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537B23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317N15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358O07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351O13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167O02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-288F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-433D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-149C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-091D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281N21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-165D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068I07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-324P01.b	B6Ng01-324P01.g
ACC	GA113124	GA113125
length	888	1,166
definition	B6Ng01-324P01.b	B6Ng01-324P01.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	ctacctacctccacttataggggagaaggatcccgcggaatttcctaatt gcctaggtctaaaatatgaagttactaaaataaagaatactattcattct tgcaattattatttatttagtgcatgcttgcttggtagcaagcactgttg aggtgccatgaatgcaggagtgattacatccaccttcttctgagactccc agttaagacaggaagcttagcattcaacaactaccattcaaatgaatgca gtaatcacagcgaggaacataaaagaacaacaaaatggctccattaaaaa ctacaacaggcaggtctaattcagacaaaggacatgggtgacagcctctc tgagatcacatgtaattgggaactgggactgtgagaaagaaacctagcct ggcaaagaaaataaattagagtgtgcagttcccccactcttcctgagatg ggatgactgcacaaatcctgggacacaagagaacctggcacacttgataa gcctatcaaggccatggccctggtcaggaaatggtcactgaataaagccg ggtaagtgggacaagccagccgaacaaagccccagaatcccctggggatt cttgttttgtatctactaggttcagagaaaatttgctcaaaaaaaaaaaa aaaacactggcagagttaagtaggatggttgactttcaactaatttggat tttaaatacaaaacaaaaacaaaacaatcttaggacattaagaaggcaca gttcagggtgtgtccatgaggaggtttaaccaaagtaggaaaaaactcac actgaatgtgggacctccagggtgaggtttccagactgattgaaaaggga aaagaaggttagtcactaaggctataacattttcctta	gaattctcacctgaggaataccgaatagcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatgtctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggattgcaagcttgtacaaccactctggaaatccgtctggcggttcctca gaaaattggacatagtactactggaggatccagcaaaacctctcctgggc atatatccagaagatgccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacccagat gcccctcaacagagcaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtagcacattcacaaa ggaactcacacaatatgtactcactgataagtggatattagcccaaaacc taggatacccaagatataagatacaatttcctaaacacatgaaactcaag aaaaatgaagactgaagtgtggacactatgcccctccttagaagtgggaa caaaacacccttggaaggagttacagagacaaagtttggagctgagatga aaggatggaacatgtagagactgccttatccagggatccaccccataatc agcatccaaacgctgacaccattgcatacactagcaagattttatcgaaa ggacccagatgtagctgtctcttgtgagactatgccggggcctagcaaac acagaagtggatgcccacagtcagctaatggatggatcacaggctcccaa tggagagctagagaagtacccaagagctaaaggatctgcaacctatagtg atcacatatgactaccagtaccccgagctctgactctagctgcatatgta tcaaagatgctagttcgtcatcactgtaaaggagagtcaatgaccacaca aactttatatgccctgatcgaacgctaggtctataggaattgggctgctt agggatatgtgctgct
quality values	Open. Hide. 2 2 2 5 4 3 4 9 4 5 9 6 9 5 8 11 8 5 5 7 6 11 10 12 8 5 5 9 18 9 7 4 9 9 10 31 35 12 14 9 9 9 13 9 22 25 34 20 12 7 20 40 43 52 62 21 15 25 56 32 20 56 56 36 43 56 47 47 51 29 15 15 13 21 24 21 24 24 25 22 24 34 39 44 43 59 59 59 59 59 59 43 46 59 59 59 54 54 62 59 59 62 59 56 62 62 62 62 54 59 62 62 62 59 59 62 50 46 28 35 48 54 50 50 50 56 62 48 46 59 59 56 59 62 56 54 59 41 49 39 50 50 49 46 46 59 59 59 59 62 62 59 62 59 59 51 44 36 51 46 36 48 46 62 62 56 50 62 54 46 56 54 36 36 44 50 62 43 59 59 59 51 59 59 59 56 59 51 59 59 59 46 59 34 36 49 50 48 59 59 59 59 62 59 59 59 46 62 59 59 59 62 62 56 56 59 62 59 59 51 59 59 59 59 59 46 50 56 56 50 59 46 46 56 43 49 49 43 43 34 43 50 56 48 31 28 40 48 36 30 34 44 43 43 51 51 40 46 35 39 41 30 44 43 43 43 50 49 43 51 49 46 49 50 40 59 50 51 43 43 46 34 38 50 43 43 62 56 56 56 59 59 51 59 59 51 43 49 49 56 51 51 59 59 50 59 59 44 51 62 43 43 43 56 50 50 62 62 59 59 59 59 34 19 59 43 30 37 50 40 51 50 43 43 51 59 51 59 56 62 59 59 59 50 50 50 50 50 36 44 59 59 62 43 46 51 34 34 43 34 62 62 62 59 62 59 62 62 46 40 56 51 49 49 62 59 46 46 38 16 30 11 18 22 50 62 56 46 34 50 36 34 46 62 38 38 19 39 49 39 50 34 34 23 39 49 34 48 46 49 51 49 49 59 56 59 50 56 34 59 51 49 62 56 59 51 56 27 34 50 43 49 49 56 59 43 49 59 59 43 43 36 28 29 43 59 34 54 49 51 50 43 46 46 50 18 13 8 18 12 11 49 51 59 59 43 39 43 34 46 51 59 59 49 51 24 19 12 13 40 14 59 30 24 23 12 23 13 28 34 49 56 49 46 56 59 59 62 56 59 49 51 56 50 59 56 51 34 40 46 59 13 18 13 13 22 19 49 18 18 13 18 12 11 21 29 19 51 49 43 46 43 51 59 36 43 18 24 17 25 23 17 43 39 43 45 41 43 56 45 56 45 34 19 23 17 19 30 18 46 44 51 51 30 30 24 20 25 18 30 28 23 51 59 59 34 24 21 34 24 24 23 26 22 13 51 32 37 38 31 38 42 32 42 19 21 24 39 26 56 62 44 8 44 56 56 62 62 62 51 56 51 62 54 47 56 39 47 24 56 39 51 42 37 22 62 42 51 56 51 56 47 62 47 62 56 62 47 56 56 56 51 32 42 39 38 38 42 42 39 41 38 38 32 42 31 39 15 27 20 13 14 10 47 16 20 16 17 13 10 23 37 20 43 38 27 47 20 12 14 13 27 21 27 43 38 18 14 14 13 19 12 28 52 28 15 31 35 41 31 35 43 15 29 40 42 10 27 50 19 43 42 38 42 33 31 43 31 34 38 14 32 32 16 25 19 12 30 18 10 10 11 35 28 32 22 9 26 35 22 14 12 33 29 25 34 16 19 26 25 13 12 21 35 24 15 41 25 13 25 25 35 32 31 31 15 32 32 41 14 29 42 35 12 10 52 36 25 28 15 20 10 7 9 7 8 24 7 33 42 46 19 18 19 15 18 25 21 10 30 15 24 9 12 9 10 26 37 28 33 27 13 26 13 22 8 41 26 15 22 47 20 16 22 21 19 19 12 13 9 19 29 13 13 38 25 34 22 17 13 11 9 10 10 28 27 23 48 28 32 33 37 32 11 27 13 20 53 17 18 27 16 25 27 40 39 40 19 25 16 10 37 9 19 49 39 28 18 13 29 36 16 14 26 23 9 10 6	Open. Hide. 62 44 39 47 62 62 62 59 59 62 56 56 28 26 22 38 33 33 44 56 47 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 59 62 62 59 59 62 62 62 62 62 59 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 54 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 49 58 58 58 58 58 54 58 58 58 58 42 58 58 58 54 45 36 49 58 54 52 58 58 58 58 58 58 58 58 45 54 58 58 58 46 58 54 58 52 58 47 54 58 58 58 58 54 58 49 54 54 54 58 58 58 58 58 58 54 58 54 58 54 58 58 58 54 58 54 58 58 58 58 49 58 58 58 58 51 58 58 50 54 58 47 45 39 51 51 51 46 46 58 58 49 53 58 58 53 47 58 58 58 33 58 46 49 41 49 58 48 50 58 52 46 50 50 49 50 58 53 58 40 50 50 50 51 49 58 58 44 51 53 53 58 49 49 46 51 50 58 51 58 58 44 40 58 50 50 49 51 58 36 38 58 49 39 51 51 58 37 51 37 50 58 58 58 39 54 58 47 58 28 42 33 40 49 53 38 52 52 49 39 33 39 49 32 44 49 50 40 39 54 53 34 52 39 39 44 47 49 52 30 54 54 50 52 40 23 44 51 46 30 50 44 50 49 23 49 51 32 46 42 37 38 37 39 54 23 33 33 22 49 46 32 42 54 40 49 47 51 26 45 53 37 51 18 35 32 42 53 54 47 24 51 31 27 47 40 25 31 34 29 41 47 32 34 31 51 31 30 31 40 45 25 32 34 39 43 40 31 32 28 33 53 53 26 26 31 42 32 31 41 41 33 29 30 28 33 31 30 31 31 32 29 36 30 34 26 51 43 31 31 30 31 23 29 24 28 32 31 23 37 31 30 27 28 32 29 31 26 31 31 33 18 33 24 30 31 32 31 48 48 34 31 31 31 22 43 48 32 33 27 21 13 41 31 18 10 24 23 42 34 25 19 30 31 31 32 34 36 31 20 22 31 31 31 37 19 31 35 36 26 34 22 22 29 31 46 46 27 11 22 28 31 20 33 22 44 31 22 19 27 32 22 25 26 28 29 15 25 16 20 34 33 44 31 25 31 21 31 32 28 21 31 34 34 18 22 29 25 21 10 12 24 24 16 31 18 6 11 4 4 7 19 17 15 33 21 4 8 12 23 26 9 8 6 7 33 22 8 20 30 17 31 31 8 15 18 25 18 18 6 6 13 5 12 22 28 11 34 18 21 19 8 21 24 24 28 28 15 9 27 26 13 10 13 6 19 7 32 6 15 14 30 21 17 38 17 24 19 34 16 23 26 19 11 19 10 7 14 28 38 34 4 21 15 9 15 14 6 18 15 18 16 12 10 18 15 10 23 20 20 21 9 16 10 16 13 5 9 20 21 25 28 16 5 19 6 4 3 6 8 5 6 7 5 3 3 3 12 17 5 7 7 9 2 1 5 22 20 8 7 6 4 6 2 1 3 4 5 19 2 2 3 7 7 6 6 11 7 25 15 8 13 26 15 9 6 7 15 7 13 14 12 1 2 3 4 1 5 2 2 4 4 7 1 4 10 7 1 3 3 8 1 9 11 9 2 6 5 7 18 4 4 5 5 13 3 6 6 8 21 9 5 8 4 21 10 3 4 1 2 3 3 2 4

Alignment Information

BAC End 1

BAC End 2

seq1: chr8_41715289_41716123
seq2: B6Ng01-324P01.b_42_887

seq1  TTCCTAA-TGCCTA-GTCTAAAATATGAAG-TACTAAAATAAAGAATACT  47
      ||||||| |||||| ||||||||||||||| |||||||||||||||||||
seq2  TTCCTAATTGCCTAGGTCTAAAATATGAAGTTACTAAAATAAAGAATACT  50

seq1  ATTCATTCTTGCAATTATTATTTATTTAGTGCATGCTTGCTTGGTAGCAA  97
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCATTCTTGCAATTATTATTTATTTAGTGCATGCTTGCTTGGTAGCAA  100

seq1  GCACTGTTGAGGTGCCATGAATGCAGGAGTGATTACATCCACCTTCTTCT  147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGTTGAGGTGCCATGAATGCAGGAGTGATTACATCCACCTTCTTCT  150

seq1  GAGACTCCCAGTTAAGACAGGAAGCTTAGCATTCAACAACTACCATTCAA  197
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACTCCCAGTTAAGACAGGAAGCTTAGCATTCAACAACTACCATTCAA  200

seq1  ATGAATGCAGTAATCACAGCGAGGAACATAAAAGAACAACAAAATGGCTC  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAATGCAGTAATCACAGCGAGGAACATAAAAGAACAACAAAATGGCTC  250

seq1  CATTAAAAACTACAACAGGCAGGTCTAATTCAGACAAAGGACATGGGTGA  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAAAAACTACAACAGGCAGGTCTAATTCAGACAAAGGACATGGGTGA  300

seq1  CAGCCTCTCTGAGATCACATGTAATTGGGAACTGGGACTGTGAGAAAGAA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCCTCTCTGAGATCACATGTAATTGGGAACTGGGACTGTGAGAAAGAA  350

seq1  ACCTAGCCTGGCAAAGAAAATAAATTAGAGTGTGCAGTTCCCCCACTCTT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTAGCCTGGCAAAGAAAATAAATTAGAGTGTGCAGTTCCCCCACTCTT  400

seq1  CCTGAGATGGGATGACTGCACAAATCCTGGGACACAAGAGAACCTGGCAC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGAGATGGGATGACTGCACAAATCCTGGGACACAAGAGAACCTGGCAC  450

seq1  ACTTGATAAGCCTATCAAGGCCATGGCCCTGGTCAGGAAATGGTCACTGA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGATAAGCCTATCAAGGCCATGGCCCTGGTCAGGAAATGGTCACTGA  500

seq1  ATAAAGCCGGGTAAGTGGGACAAGCCAGCCGAACAAAGCCCCAGAATCCC  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAAGCCGGGTAAGTGGGACAAGCCAGCCGAACAAAGCCCCAGAATCCC  550

seq1  CTGGGGATTCTTGTTTTGTATCTACTAGGTTCAGAGAAAATTTGCTCAAA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGATTCTTGTTTTGTATCTACTAGGTTCAGAGAAAATTTGCTCAAA  600

seq1  AAAAAAAAAAAAACACTGGCAGAGTTAAGTAGGATGGTTGAC-TTCAACT  646
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  AAAAAAAAAAAAACACTGGCAGAGTTAAGTAGGATGGTTGACTTTCAACT  650

seq1  AA-TTGGA-TTTAAAAACAAAACAAAAACAAAACAATC-TAGGACATTAA  693
      || ||||| |||||| |||||||||||||||||||||| |||||||||||
seq2  AATTTGGATTTTAAATACAAAACAAAAACAAAACAATCTTAGGACATTAA  700

seq1  GAAGGCACAGTTCAGGGTGTGTCCATGAGGAGGTTTAACCAAAG-AGG-A  741
      |||||||||||||||||||||||||||||||||||||||||||| ||| |
seq2  GAAGGCACAGTTCAGGGTGTGTCCATGAGGAGGTTTAACCAAAGTAGGAA  750

seq1  AAAACTCACACTGAATGTGGGACCCCAAGGGTGAGG-TTCCAGACTGATA  790
      |||||||||||||||||||||||| | ||||||||| |||||||||||| 
seq2  AAAACTCACACTGAATGTGGGACCTCCAGGGTGAGGTTTCCAGACTGATT  800

seq1  GAAAAGGGAAAAGAAGGTTAGTCACTAA-GCAATAACATTTCCCTT  835
      |||||||||||||||||||||||||||| || ||||||||| ||||
seq2  GAAAAGGGAAAAGAAGGTTAGTCACTAAGGCTATAACATTTTCCTT  846

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information