MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-085B12
Chromosome	8 (Build37)
Map Location	121,743,014 - 121,743,136
singlet/doublet	singlet
Overlap gene	Cdh13
Upstream gene	none
Downstream gene	Hsbp1, Mlycd, Osgin1, Efcbp2, Gm587, Mbtps1, Hsdl1, Lrrc50, Taf1c, EG628061, 4930403J07Rik, Kcng4, Wfdc1, Atp2c2, 4632415K11Rik, Cotl1, BC025816, Usp10, Crispld2, Zdhhc7, 6430548M08Rik, 1700120B06Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cdh13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12554 MGI:99551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68196 MGI:1915446
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlycd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56690 MGI:1928485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Osgin1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71839 MGI:1919089
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Efcbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:117148 MGI:2152211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm587 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234788 MGI:2685433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mbtps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56453 MGI:1927235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsdl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72552 MGI:1919802
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68270 MGI:1915520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21341 MGI:109576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628061 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628061 MGI:3648822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1213 ESTs, 6 Proteins

name	4930403J07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75773 MGI:1923023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	Kcng4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66733 MGI:1913983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wfdc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67866 MGI:1915116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2c2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69047 MGI:1916297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 38 ESTs, 7 Proteins

name	4632415K11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74347 MGI:1921597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cotl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72042 MGI:1919292
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC025816 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234796 MGI:2385305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22224 MGI:894652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crispld2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78892 MGI:1926142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102193 MGI:2142662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430548M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234797 MGI:2443793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700120B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436062 MGI:3588213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdh13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351346 GeneID:12554 MGI:99551
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 13 transcript_id : NM_019707.3

name	Hsbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311872 GeneID:68196 MGI:1915446
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock factor binding protein 1 transcript_id : NM_024219.1

name	Mlycd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56797738 GeneID:56690 MGI:1928485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : malonyl-CoA decarboxylase transcript_id : NM_019966.2

name	Osgin1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794397 GeneID:71839 MGI:1919089
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxidative stress induced growth inhibitor 1 transcript_id : NM_027950.1

name	Efcbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131117 GeneID:117148 MGI:2152211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF hand calcium binding protein 2 transcript_id : NM_054095.2

name	Gm587 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57977292 GeneID:234788 MGI:2685433
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 587, (NCBI) transcript_id : NM_001009950.1

name	Mbtps1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476184 GeneID:56453 MGI:1927235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-bound transcription factor peptidase, site 1 transcript_id : NM_019709.3

name	Hsdl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802950 GeneID:72552 MGI:1919802
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid dehydrogenase like 1 transcript_id : NM_175185.3

name	Lrrc50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803422 GeneID:68270 MGI:1915520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 50 transcript_id : NM_026648.2

name	Taf1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778984 GeneID:21341 MGI:109576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C transcript_id : NM_021441.2

name	EG628061 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383838 GeneID:628061 MGI:3648822
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 1213 ESTs, 6 Proteins product : predicted gene, EG628061 transcript_id : XM_895061.2

name	4930403J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383839 GeneID:75773 MGI:1923023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : RIKEN cDNA 4930403J07 gene, transcript variant 2 transcript_id : XM_915766.2

name	4930403J07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383841 GeneID:75773 MGI:1923023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : RIKEN cDNA 4930403J07 gene, transcript variant 1 transcript_id : XM_486166.3

name	Kcng4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28076886 GeneID:66733 MGI:1913983
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, subfamily G, member 4 transcript_id : NM_025734.2

name	Wfdc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83816975 GeneID:67866 MGI:1915116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WAP four-disulfide core domain 1 transcript_id : NM_023395.2

name	Atp2c2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259105 GeneID:69047 MGI:1916297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 38 ESTs, 7 Proteins product : ATPase, Ca++ transporting, type 2C, member 2, transcript variant 1 transcript_id : XM_486167.5

name	4632415K11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130538 GeneID:74347 MGI:1921597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632415K11 gene transcript_id : NM_028883.2

name	Cotl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383258 GeneID:72042 MGI:1919292
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coactosin-like 1 (Dictyostelium) transcript_id : NM_028071.2

name	BC025816 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122778 GeneID:234796 MGI:2385305
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC025816 transcript_id : NM_146219.1

name	Usp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678492 GeneID:22224 MGI:894652
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 10 transcript_id : NM_009462.1

name	Crispld2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60592999 GeneID:78892 MGI:1926142
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich secretory protein LCCL domain containing 2 transcript_id : NM_030209.2

name	Zdhhc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054240 GeneID:102193 MGI:2142662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 7 transcript_id : NM_133967.3

name	6430548M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377690 GeneID:234797 MGI:2443793
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430548M08 gene transcript_id : NM_172286.3

name	1700120B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702174 GeneID:436062 MGI:3588213
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700120B06 gene transcript_id : NM_001033980.1

name	Cdh13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625609 GeneID:12554 MGI:99551
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0042803 - protein homodimerization activity [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 product : cadherin 13 protein_id : NP_062681.2

name	Hsbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311873 GeneID:68196 MGI:1915446
definition	codon_start : 1 product : heat shock factor binding protein 1 protein_id : NP_077181.1

name	Mlycd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56797739 CCDS:CCDS22703.1 GeneID:56690 MGI:1928485
definition	GO_function : GO:0050080 - malonyl-CoA decarboxylase activity [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA] codon_start : 1 product : malonyl-CoA decarboxylase protein_id : NP_064350.2

name	Osgin1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794398 CCDS:CCDS22704.1 GeneID:71839 MGI:1919089
definition	codon_start : 1 note : pregnancy-induced growth inhibitor product : oxidative stress induced growth inhibitor 1 protein_id : NP_082226.1

name	Efcbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16905129 CCDS:CCDS22705.1 GeneID:117148 MGI:2152211
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0017000 - antibiotic biosynthesis [Evidence IEA] codon_start : 1 note : neuronal calcium binding 2 product : neuronal calcium-binding protein 2 protein_id : NP_473436.1

name	Gm587 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57977293 CCDS:CCDS22706.1 GeneID:234788 MGI:2685433
definition	codon_start : 1 product : hypothetical protein LOC234788 protein_id : NP_001009950.1

name	Mbtps1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476185 CCDS:CCDS22707.1 GeneID:56453 MGI:1927235
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005795 - Golgi stack [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004175 - endopeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IDA]; GO:0004289 - subtilase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IMP]; GO:0006508 - proteolysis [Evidence IEA]; GO:0042990 - regulation of transcription factor import into nucleus [Evidence IDA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : site-1 protease; subtilisin/kexin isozyme-1; subtilisin/kexin isozyme SKI-1 product : membrane-bound transcription factor protease, site 1 protein_id : NP_062683.2

name	Hsdl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424792 CCDS:CCDS22708.1 GeneID:72552 MGI:1919802
definition	codon_start : 1 product : hydroxysteroid dehydrogenase like 1 protein_id : NP_780394.1

name	Lrrc50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386136 CCDS:CCDS22709.1 GeneID:68270 MGI:1915520
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 50 protein_id : NP_080924.1

name	Taf1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778985 GeneID:21341 MGI:109576
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0000120 - RNA polymerase I transcription factor complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0030528 - transcription regulator activity [Evidence TAS] GO_process : GO:0006350 - transcription [Evidence IEA]; GO:0006360 - transcription from RNA polymerase I promoter [Evidence TAS] codon_start : 1 note : transcription factor TAFI95; TBP-associated factor RNA polymerase I 95 kDa product : TATA box binding protein (Tbp)-associated factor, RNA polymerase I, C protein_id : NP_067416.2

name	EG628061 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82918395 GeneID:628061 MGI:3648822
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900154.1

name	4930403J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383842 GeneID:75773 MGI:1923023
definition	codon_start : 1 product : hypothetical protein LOC75773 isoform 1 protein_id : XP_486166.3

name	4930403J07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383840 GeneID:75773 MGI:1923023
definition	codon_start : 1 product : hypothetical protein LOC75773 isoform 2 protein_id : XP_920859.2

name	Kcng4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28076887 CCDS:CCDS22710.1 GeneID:66733 MGI:1913983
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : voltage-gated potassium channel subunit Kv6.3 protein_id : NP_080010.2

name	Wfdc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963659 CCDS:CCDS22711.1 GeneID:67866 MGI:1915116
definition	GO_function : GO:0004866 - endopeptidase inhibitor activity [Evidence IEA]; GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 product : WAP four-disulfide core domain 1 protein_id : NP_075884.1

name	Atp2c2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259106 GeneID:69047 MGI:1916297
definition	codon_start : 1 product : ATPase, Ca++ transporting, type 2C, member 2 isoform 1 protein_id : XP_486167.5

name	4632415K11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28077021 GeneID:74347 MGI:1921597
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypothetical protein LOC74347 protein_id : NP_083159.1

name	Cotl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19482160 CCDS:CCDS22712.1 GeneID:72042 MGI:1919292
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0019899 - enzyme binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0050832 - defense response to fungus [Evidence IDA] codon_start : 1 note : coactosin-like protein product : coactosin-like 1 protein_id : NP_082347.1

name	BC025816 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122779 CCDS:CCDS22713.1 GeneID:234796 MGI:2385305
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234796 protein_id : NP_666331.1

name	Usp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678493 GeneID:22224 MGI:894652
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : ubiquintin c-terminal hydrolase related polypeptide product : ubiquitin specific protease 10 protein_id : NP_033488.1

name	Crispld2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229267 CCDS:CCDS22714.1 GeneID:78892 MGI:1926142
definition	codon_start : 1 product : LCCL domain containing cysteine-rich secretory protein 2 protein_id : NP_084485.1

name	Zdhhc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527186 CCDS:CCDS22715.1 GeneID:102193 MGI:2142662
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA] codon_start : 1 note : GABA-A receptor-associated membrane protein 2 product : zinc finger, DHHC domain containing 7 protein_id : NP_598728.1

name	6430548M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982038 CCDS:CCDS22716.1 GeneID:234797 MGI:2443793
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC234797 protein_id : NP_758490.2

name	1700120B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702175 CCDS:CCDS22717.1 GeneID:436062 MGI:3588213
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC436062 protein_id : NP_001029152.1

clone name	MSMg01-409H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-406I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-402N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-190D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-174H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294N14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-504A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-298I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-064O18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527O04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-533O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-178D12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-131E04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-349D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016I14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223O23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-085B12.T7 (MSMg01no085_b12.b1)	MSMg01-085B12.TJ (MSMg01no085_b12.g1)
ACC	AG304775	AG304776
length	1,159	1,324
length of high quality (start - end)	70 (62 - 131)	123 (125 - 247)
definition	CHROMAT_FILE: MSMg01no085_b12.b1 PHD_FILE: MSMg01no085_b12.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:35:23 2005	CHROMAT_FILE: MSMg01no085_b12.g1 PHD_FILE: MSMg01no085_b12.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 17:35:24 2005
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	TTAATGACCAATCACAGTGGCTTTCTAGATCTCCTACCTCTTGGTCCTAC CCCCCAGCTACTAGTTTTCATGAAGGAAGGAATATTTAGTGTTGACTTGA GAGCCTGTCTTCCCTGAAGTGTTAGCTGGAAAGGTGGGCAGTAGAGTGGA AGGGACTTGGTTCTGCCTAACATCCAGACACCAAGCTTAGAGCCACCAGT TCCTGGGTATGCAGTGTTAATAGTCCCCTAAAGAGCACCTCTCCCCTTCT TGAAGTTTTTGTGTTTCTAGCTTTGTGCTCATAAACTTCCTTGTCACATC TCATCTCCCATGGAGGCGTGACTTTCATTTTTTTTTTTGGAAGCCAGTTT CTACCACTATTTTTCATAGCCCTCTGCTTCGTATTTTGTCTTCATGTATC CCTGGTCTTGGTTCCCTTATTCATCTGTTCCTTTTCTTTTACTTTTTCTT CTATTTTTTTTCCCTCTTTTTCACTACTTTTTCTTTCTCCTTTTTTCTCC TTTTTCTTTTTTTCTTTTTTTTCTTTATTTTTTTTTCTTTTTCCTTCTTT TTTTTCTTCTCTTTATTTCTATTTTTTTTTTCTATCTTTTTTTTTTTTTC TCTTTTCTTTTTTTTTTTAATATCTCTCCTTCTTTTCTTTTTTTTATTTT TTTTTTTTCTTTCTCTTCTCATTTTTTTTTTTTTTCTTTTTTTTTCTTTT ACTTCTTTTTTTTTTTCTTCATTTTTTTTTTTCATTTTTTCTTCTTTTTT TTTTCTTTTTTCTTTTCTTTATTTTATTCTTTTTCTTCTTTTCTTTTCTT TTTTTGTTCTTTATTTTTTTTTCTTTTTATTCTTTTTTTCTTTTTTTTTA TTCTATTTTTTTTTTCTTTTCTTTTTCTTTCTTTTTCCTTTTTACTATTA TTTTCTTTCTTTTATTCTTCTATTTTCTTTCTTTATTATTCTTTTCTTTT ATCTTTTTTTCTTTTTTTTCTCTTTATTTTTTTTTCTTACTTTTATTTTT CCCTCTTTCTTTTTCTTCTTTCTTTCTCTTTCCCCTTTTCTTTTATTTTT TTTTTTTCTTTTTATCTTTTATTCTTCCTCTCTTTTTATTTTTTCTTTTT TTTTCTTCCTTCTTTTATACGTTTACTTATTCTCTCTATCTTCTTTCTTT ATTATTTTT	TATATGGTAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXCCCTTTTGACTGGCCCCCTTTCCTGCTCTGATTCTTTAGA CGCTCTCTAACAAAGACCCCCTGGTACCTAACACCATCAGCATCATCTTT GAGTTGGCCGGGGTGGCTGAGATCTACCCCAGACTTCTGTGTCAGATTCA CAGATCCTTCTGAGAAGCCTGTCCTTCAGGTCTTCCCTTGGCAGCAGCTG TGGTGGCCTGACCCCAGAAGAAGGAAGGCCCTGATAGGTAGGTGTCCTCA ATGGTTTCCAGCATGGAGAGTAGTTAGCTCTCATTCCTTTAGTGGCTGCT ACTAGGGCTGTGCCTCCCCCTGCTCAAGGTGTACTTTCCTCTTTTTTTCT TTCATCCTTCTCCGGTATTTTTCTTCCTGTCTACTTCTCTACCCAATCAG TCGTCTTGCTTGTTCTAGATCCTCCTACTTATTTAGTTTCAGATTCATAA TTTTATAATTAATCTTCCCGTATCTCTTCTCCTGCATCCTTTATATTAGT GTATCTCTTTCCTTCTCTTCCATTCTGCTTGCCATGATAATATGTCTATA TTTTTTTTTATCTTTTCCTCTTTTGTTTTTTTCATTCTTTATTTTTCTTT TTTTTTTATCTTTCTCTTTTCTTTTTCTGTTTTTGTTGTTTCTCATTTTT TTTGCTTTTTATTAATTCTTTCTTTTCCCTTTCTTTTTTATATTTTGTTC TTCTTTTTTCTTTTTTTTTTTATCTTCTTTTTTTTTTTCTCTTTTCTTCT TATTTTTTCTTCTTTTTTCTTCTTTTTCTTCTCTATTTTTTTTTTTTTTT TTCTTTATTTTTTCCTTTCTTCTTTTTTTTTTTCTTTTTTATCTTTCTCA TTTTTCTTTTTTTTTTATTTTTTTTTCTTTTTTTTTTTTTTTTTTTTTTA TTTTCTTTTATTCTTCTTCCTCTTTTCTTTTTTTTCTTCTATTCTTTTCT CTCTTTCCTATTTTTTATCATTTTTTCTCTTTCCTTTTTTCCCTCTTCTT TCTTTTCTCTTTATCCTTAGCCTGTTTCTTTACTTTTCTTATCGTTATCC TTTTTTCTNTTTTTTTTTATTTTTTTTCCNCCCCCTGTGTTTTTATAATT TTTTATTTCTTATTTTTCTTTTTCATATTCTTTCTTTTTCTTTCTCTCTT ATTTACTCTTTTTTCCTGCAGTCTAATTTCACTTTCTTTTGTTTCTTTCA TTCTTTTTTCCTCGTCTATTCTACCTTATTTATTTCTCTTGTCTTCTTCT CATTATTTCTCGTCCTTTCTTTTG
quality values	Open. Hide. 8 12 12 10 8 8 8 8 8 8 6 6 6 15 19 14 17 20 20 20 29 37 53 50 50 47 36 33 33 33 33 33 30 26 30 22 6 6 8 8 9 6 10 10 10 15 10 12 12 10 9 9 10 10 13 16 13 17 14 23 14 14 14 23 30 57 34 36 30 30 24 32 26 35 35 37 35 35 35 39 39 43 43 48 40 34 25 20 19 25 25 39 39 43 47 43 47 32 41 20 20 20 25 25 25 36 36 57 47 47 57 47 47 47 41 41 18 18 13 15 15 24 21 26 26 25 28 32 23 23 23 23 22 23 19 22 12 14 14 18 18 19 11 11 11 12 12 15 12 17 21 23 14 14 14 23 28 26 14 14 14 19 17 25 12 8 8 8 8 8 8 11 11 11 11 13 15 21 14 13 13 13 11 8 8 8 11 13 8 11 11 15 18 20 20 20 20 13 10 8 8 8 15 15 19 17 17 17 30 25 18 12 12 12 22 10 10 10 10 10 10 10 10 10 10 10 8 8 8 8 8 9 15 15 12 11 11 15 16 19 16 22 12 12 12 21 22 32 32 33 40 28 21 14 14 13 26 23 23 13 10 10 10 13 10 15 10 8 8 8 14 19 19 16 11 11 12 12 11 8 8 8 8 8 9 18 29 15 11 8 8 8 6 6 8 8 9 10 9 9 10 10 18 11 11 11 12 12 19 18 14 14 19 15 10 8 8 8 12 8 11 11 13 18 13 11 8 8 8 8 13 18 32 27 11 7 8 8 8 8 10 14 13 13 15 15 18 28 23 12 9 8 8 8 8 8 8 10 13 10 10 10 10 11 11 11 12 12 11 9 9 10 12 10 8 9 9 8 8 8 8 8 8 8 8 8 16 28 28 28 21 21 9 9 9 9 9 10 11 10 10 10 10 10 10 11 15 16 16 11 11 9 12 14 15 10 10 10 8 10 8 8 8 6 6 6 10 8 10 10 10 10 8 10 7 6 8 8 8 6 6 8 8 10 16 18 14 9 8 10 10 8 8 8 8 10 10 19 13 10 10 8 8 8 8 8 8 8 10 8 8 6 6 8 8 8 8 8 8 8 8 9 9 9 12 12 12 10 10 10 10 12 19 15 11 8 6 6 8 8 8 8 7 10 6 6 8 8 10 21 12 8 6 6 8 8 16 10 12 12 16 13 14 10 13 8 8 8 10 10 9 10 10 11 10 7 7 8 8 8 10 9 6 6 6 8 8 8 8 8 8 8 8 8 8 10 16 16 10 10 10 11 10 8 8 8 10 10 10 9 9 8 8 8 8 8 8 8 9 8 6 6 6 8 8 10 10 12 13 12 13 10 10 9 24 19 10 10 10 8 8 10 10 8 10 6 6 8 8 9 19 19 16 15 11 9 8 7 7 6 6 8 8 8 8 8 6 7 6 6 8 10 10 10 10 7 7 8 8 10 10 10 10 8 8 10 8 10 10 17 11 13 13 12 12 14 12 10 10 10 8 8 8 8 8 8 14 17 17 8 8 8 10 10 10 11 11 13 13 9 9 14 9 9 8 9 9 9 12 12 16 11 10 10 10 11 11 12 12 8 6 6 7 10 10 13 10 10 10 16 16 19 19 14 14 14 21 18 13 9 9 10 10 15 12 10 11 8 8 8 10 13 10 10 12 18 13 15 15 16 8 8 7 6 8 8 10 10 13 16 11 8 8 7 7 8 12 21 13 15 10 10 9 8 8 8 8 8 10 8 8 8 10 14 9 8 8 7 7 12 13 19 10 9 8 8 9 9 8 10 8 8 7 7 8 10 9 7 8 8 8 8 8 9 9 8 8 8 8 10 13 10 10 11 10 10 19 15 13 9 10 8 8 8 10 10 10 8 8 8 8 6 6 10 7 9 12 12 9 9 10 10 10 13 11 10 10 10 9 10 11 8 8 8 8 8 10 12 14 14 12 13 10 8 8 6 6 10 8 15 15 20 23 11 13 16 15 17 14 15 10 8 8 9 12 10 10 6 7 8 8 8 8 8 8 8 8 8 8 8 8 8 10 11 12 12 10 9 9 10 8 8 8 8 8 8 6 6 6 6 6 6 8 8 8 8 9 8 10 7 7 8 12 8 6 6 6 6 8 8 10 10 11 11 10 13 13 8 8 8 8 6 8 11 16 12 11 8 8 7 7 10 12 16 16 11 15 11 10 12 7 6 8 8 6 6 8 8 13 14 17 12 13 8 8 6 7 8 7 6 7 10 10 8 10 11 8 8 12 10 10 8 8 8 8 8 8 6 6 8 10 8 8 6 6 6 6 10 11 18 12 11 11 8 8 6 7 6 8 10 13 11 9 9 9 9 8 10 6 6 8 8 9 11 11 11 21 21 28 24 16 13 11 11 8 12 13 14 14 12 10 10 8 8 8 8 8 19 15 9 9 9 9 9 11 8 11 9 7 10 6 6 8 10 8 8 8 8 8 13 10 10 8 6 7 6 8 8 19 21 23 12 15 10 8 8 10 8 8 11 11 8 8 10 10 10 10 9 9 9 9 9 8 8 8 8 8 6 9 9 8 8 6 7 6 6 8 8 6 6 11 8 10 8 8 8 8 8 10 11 10 8 8 8 8 12 10 10 8	Open. Hide. 6 6 6 6 7 6 6 6 6 6 6 6 6 8 8 15 9 9 8 8 11 9 3 0 3 17 17 21 16 11 12 10 22 22 12 12 10 18 12 11 11 19 21 33 33 25 25 25 34 34 48 48 41 41 47 59 27 23 9 9 9 10 13 12 12 9 14 10 10 10 10 8 8 8 8 15 24 39 40 40 41 48 48 47 36 38 38 42 42 42 37 39 35 39 39 35 32 36 18 25 11 11 9 11 10 10 10 13 17 15 15 12 12 11 11 11 11 11 11 18 17 23 19 15 19 23 32 34 37 39 39 30 28 31 28 28 28 34 34 46 46 48 48 43 42 39 42 42 48 44 47 43 36 42 43 48 43 32 32 23 20 23 28 31 37 31 31 21 32 17 20 20 40 40 47 48 48 47 44 43 44 44 48 48 54 57 57 57 47 42 42 32 32 32 42 42 44 42 35 35 28 33 33 43 43 57 57 57 57 57 57 44 36 27 27 32 28 28 32 36 32 32 22 36 30 27 12 11 11 27 26 38 43 44 52 52 52 43 44 38 32 18 19 18 20 19 32 21 24 10 10 11 11 11 11 15 15 17 36 38 37 37 32 32 20 18 15 15 14 14 15 21 24 30 19 19 20 27 27 23 36 26 30 12 12 12 15 12 12 12 15 12 11 11 11 11 19 25 24 17 17 17 27 27 37 39 37 37 30 30 30 31 30 27 24 14 12 12 9 10 10 9 9 23 30 26 19 9 9 9 19 19 32 32 28 20 28 28 24 22 9 14 9 9 9 11 15 20 24 10 10 9 9 8 11 12 11 11 12 23 18 13 10 10 11 17 15 17 17 28 28 25 29 13 15 12 11 11 11 11 8 8 8 10 8 13 20 32 23 16 9 9 9 9 10 13 9 9 9 9 14 20 19 16 10 10 10 13 16 11 11 11 19 12 11 26 26 37 37 37 39 35 28 28 20 20 15 18 11 9 12 12 12 13 15 13 19 11 15 15 24 18 18 11 11 18 11 11 11 12 11 8 8 8 8 8 10 12 15 22 26 30 28 22 16 15 12 12 12 11 11 11 18 14 15 10 10 10 11 10 7 6 8 8 9 11 10 10 10 10 10 10 10 13 10 8 8 6 6 8 8 10 10 8 8 8 10 11 11 11 10 10 10 10 11 11 11 11 11 10 10 9 8 8 8 8 8 9 9 9 11 10 12 7 9 10 8 11 9 9 10 10 10 10 11 10 10 8 8 7 6 8 8 9 9 9 10 9 10 10 10 10 10 8 8 8 12 12 10 13 10 10 12 12 16 22 15 20 20 16 14 13 8 8 8 8 11 18 11 11 11 10 8 10 6 6 8 8 6 6 8 10 10 21 28 30 12 12 8 8 8 8 9 10 8 7 7 10 10 11 11 15 10 14 12 10 10 8 9 9 9 9 9 9 9 8 8 8 10 9 7 8 10 8 9 8 8 9 9 12 19 23 23 14 12 12 8 9 9 10 11 12 11 10 13 12 15 8 8 8 8 8 10 10 8 8 6 7 8 8 10 11 8 13 13 16 12 12 10 17 10 10 10 10 10 10 15 10 10 8 8 8 8 10 10 17 12 8 8 8 6 6 6 6 6 8 8 8 8 10 8 8 8 10 10 8 8 13 7 6 6 6 8 8 10 10 6 13 6 6 8 8 10 12 12 11 8 8 6 6 8 6 6 8 8 11 10 10 10 10 11 17 16 17 17 14 16 16 11 10 6 6 8 8 9 10 10 11 10 12 10 10 10 10 10 10 17 10 10 10 13 13 19 19 21 21 10 8 8 8 8 6 8 10 9 9 8 8 6 7 10 11 8 10 10 8 10 9 9 11 10 10 10 10 10 12 18 15 20 13 10 8 6 6 6 8 12 12 12 11 11 15 9 9 8 8 8 8 8 11 13 11 15 11 8 6 6 6 10 12 10 8 8 10 11 10 12 6 6 8 8 8 8 12 13 15 15 10 12 10 13 15 15 15 11 13 13 15 13 6 6 8 8 8 8 8 8 8 6 6 8 10 10 9 9 10 10 10 10 12 19 19 13 15 10 6 6 6 10 10 10 10 10 11 10 10 12 7 6 8 9 11 11 13 16 10 13 13 10 10 10 11 11 19 14 16 11 10 7 7 7 11 10 8 6 7 8 8 8 8 8 8 8 8 8 8 10 8 8 8 6 6 8 8 15 10 9 9 12 12 16 14 12 12 12 10 8 8 8 8 8 8 8 8 8 8 10 8 8 10 10 10 11 8 8 8 8 8 8 9 9 9 10 12 9 8 8 6 8 8 8 8 8 8 8 8 8 8 8 9 10 8 10 15 16 8 10 10 10 8 7 8 8 8 8 8 8 8 10 12 8 8 8 8 8 8 8 8 8 10 10 11 8 8 8 6 6 8 8 6 6 8 6 8 8 8 8 8 8 10 9 8 8 8 9 9 9 9 17 9 8 8 8 8 6 8 9 9 9 9 10 13 17 20 19 10 10 3 0 3 9 13 11 11 14 8 8 8 6 8 8 15 25 24 12 12 8 8 3 0 3 11 11 8 8 9 9 9 11 9 18 16 13 8 6 6 6 6 6 11 15 19 10 9 9 8 10 11 11 11 8 8 9 11 20 9 9 9 9 9 9 12 8 8 6 6 6 8 11 11 14 17 15 16 12 14 15 12 7 7 6 11 8 8 8 8 8 8 8 8 7 7 8 10 9 6 6 7 7 9 7 15 8 9 9 12 10 8 8 8 8 8 9 8 8 6 6 10 6 6 8 10 9 12 10 9 9 8 12 11 11 9 12 14 13 11 8 6 6 8 8 7 7 12 11 19 10 10 7 7 6 6 6 6 6 10 6 8 8 8 6 6 8 8 8 8 8 8 8 8 8 6 6 8 8 8 7 7 6 6 8 6 7 8 10 13 10 8 8 6 6 6 6 6 6 6 7 6 9 9 9 9 6 8 6 6 8 6 6 8 8 13 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no085_b12.g1 MSMg01no085_b12.g1 CHROMAT_FILE:
MSMg01no085_b12.g1 PHD_FILE: MSMg01no085_b12.g1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 17:35:24 2005
         (123 letters)



>mm_chr8_121742814_121743336
          Length = 523

 Score =  230 bits (119), Expect = 2e-65
 Identities = 122/123 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   tacctaacaccatcagcatcatctttgagttggccggggtggctgagatctaccccagac 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 323 tacctaacaccatcagcatcatctttgagttggccggggtggctgagatctaccccagac 264

                                                                       
Query: 61  ttctgtgtcagattcacagatccttctgagaagcctgtccttcaggtcttcccttggcag 120
           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 263 ttctgtgtcagattcacagatccttctgagaagcttgtccttcaggtcttcccttggcag 204

              
Query: 121 cag 123
           |||
Sbjct: 203 cag 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 6
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 123
Length of database: 523
Length adjustment: 8
Effective length of query: 115
Effective length of database: 515
Effective search space:    59225
Effective search space used:    59225
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information