MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-210B08
Chromosome	8 (Build37)
Map Location	86,809,139 - 86,809,408
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Ucp1, Elmod2, 4933434I20Rik, Clgn, Scoc, LOC546077, LOC675854, Olfr370, Ndufb7, Gpsn2, Dnajb1, Gipc1, Ptger1, Pkn1, Ddx39, Cd97, EG384857, Lphn1, Asf1b, Prkaca, Samd1, 1700067K01Rik, 2210011C24Rik, 4432412L15Rik, Il27ra, Rln3, C330011M18Rik, Rfx1, BC057552, LOC100039920, Podnl1, Cc2d1a, 4930432K21Rik, Nanos3, Zswim4, D8Ertd738e, 2410018C20Rik, Ccdc130
Downstream gene	Cacna1a, Ier2, LOC100039975, Btbd14b, Trmt1, LOC100039997, Lyl1, Nfix, Dand5, Gadd45gip1, Rad23a, Calr, LOC546080, Farsa, Syce2, Gcdh, Klf1, Dnase2a, Mast1, Rtbdn, Rnaseh2a, LOC666841, Prdx2, Junb, Hook2, Best2, Asna1, 2310036O22Rik, Tnpo2, Fbxw9, EG436049, Dhps, 1500041N16Rik, BC056474, Man2b1, EG244556, EG624855, Olfr371, Vps35
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ucp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22227 MGI:98894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elmod2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244548 MGI:2445165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933434I20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67555 MGI:1914805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12745 MGI:107472
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scoc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56367 MGI:1927654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC546077 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 177 ESTs, 6 Proteins pseudo : _no_value

name	LOC675854 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675854
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Olfr370 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258267 MGI:3030204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndufb7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66916 MGI:1914166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpsn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:106529 MGI:1915408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnajb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81489 MGI:1931874
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gipc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67903 MGI:1926252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptger1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19216 MGI:97793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pkn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320795 MGI:108022
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68278 MGI:1915528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd97 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26364 MGI:1347095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG384857 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384857 MGI:3646765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Lphn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330814 MGI:1929461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asf1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66929 MGI:1914179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prkaca (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18747 MGI:97592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Samd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666704 MGI:2142433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700067K01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73453 MGI:1920703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210011C24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70134 MGI:1917384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	4432412L15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74337 MGI:1921587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il27ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50931 MGI:1355318
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rln3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212108 MGI:2158015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330011M18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442802 MGI:3045248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Rfx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19724 MGI:105982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC057552 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212123 MGI:2684420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039920 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	Podnl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244550 MGI:2685352
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cc2d1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212139 MGI:2384831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930432K21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74666 MGI:1921916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nanos3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244551 MGI:2675387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zswim4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212168 MGI:2443726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D8Ertd738e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:101966 MGI:1289231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410018C20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67873 MGI:1915123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67736 MGI:1914986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12286 MGI:109482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ier2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15936 MGI:104815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039975 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Btbd14b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66830 MGI:1914080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trmt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212528 MGI:1289155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039997 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs

name	Lyl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17095 MGI:96891
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfix (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18032 MGI:97311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Dand5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23863 MGI:1344365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gadd45gip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102060 MGI:1914947
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rad23a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19358 MGI:105126
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Calr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12317 MGI:88252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins pseudo : _no_value

name	Farsa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66590 MGI:1913840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Syce2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71846 MGI:1919096
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gcdh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270076 MGI:104541
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Klf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16596 MGI:1342771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13423 MGI:1329019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mast1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56527 MGI:1861901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtbdn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234542 MGI:2443686
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnaseh2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69724 MGI:1916974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs

name	Prdx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21672 MGI:109486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Junb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16477 MGI:96647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hook2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170833 MGI:2181664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Best2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212989 MGI:2387588
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asna1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56495 MGI:1928379
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310036O22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68544 MGI:1922833
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tnpo2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212999 MGI:2384849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68628 MGI:1915878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436049 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436049 MGI:3645690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Dhps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330817 MGI:2683592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500041N16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67836 MGI:1915086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC056474 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:414077 MGI:3041257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Man2b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17159 MGI:107286
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG244556 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244556 MGI:3648473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624855 MGI:3643620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258858 MGI:3030205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:65114 MGI:1890467
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ucp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981931 GeneID:22227 MGI:98894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uncoupling protein 1 (mitochondrial, proton carrier) transcript_id : NM_009463.2

name	Elmod2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367620 GeneID:244548 MGI:2445165
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ELMO domain containing 2 transcript_id : NM_178736.4

name	4933434I20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119964703 GeneID:67555 MGI:1914805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933434I20 gene transcript_id : NM_026233.2

name	Clgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262137 GeneID:12745 MGI:107472
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calmegin transcript_id : NM_009904.2

name	Scoc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687673 GeneID:56367 MGI:1927654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : short coiled-coil protein transcript_id : NM_001039137.2

name	Scoc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114687764 GeneID:56367 MGI:1927654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : short coiled-coil protein transcript_id : NM_019708.3

name	Olfr370 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129744 GeneID:258267 MGI:3030204
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 370 transcript_id : NM_146270.1

name	Ndufb7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354042 GeneID:66916 MGI:1914166
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 transcript_id : NM_025843.2

name	Gpsn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802387 GeneID:106529 MGI:1915408
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycoprotein, synaptic 2 transcript_id : NM_134118.2

name	Dnajb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055241 GeneID:81489 MGI:1931874
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DnaJ (Hsp40) homolog, subfamily B, member 1 transcript_id : NM_018808.1

name	Gipc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475640 GeneID:67903 MGI:1926252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GIPC PDZ domain containing family, member 1 transcript_id : NM_018771.3

name	Ptger1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892046 GeneID:19216 MGI:97793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : prostaglandin E receptor 1 (subtype EP1) transcript_id : NM_013641.2

name	Pkn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32813438 GeneID:320795 MGI:108022
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase N1 transcript_id : NM_177262.3

name	Ddx39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38372906 GeneID:68278 MGI:1915528
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 transcript_id : NM_197982.2

name	Cd97 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753359 GeneID:26364 MGI:1347095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD97 antigen transcript_id : NM_011925.1

name	Lphn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56118950 GeneID:330814 MGI:1929461
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : latrophilin 1 transcript_id : NM_181039.1

name	Asf1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130257 GeneID:66929 MGI:1914179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ASF1 anti-silencing function 1 homolog B (S. cerevisiae) transcript_id : NM_024184.2

name	Prkaca (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475738 GeneID:18747 MGI:97592
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, cAMP dependent, catalytic, alpha transcript_id : NM_008854.3

name	Samd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487220 GeneID:666704 MGI:2142433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sterile alpha motif domain containing 1 transcript_id : NM_001081415.1

name	1700067K01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147068 GeneID:73453 MGI:1920703
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700067K01 gene transcript_id : NM_183097.1

name	2210011C24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383703 GeneID:70134 MGI:1917384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : RIKEN cDNA 2210011C24 gene transcript_id : XM_985599.1

name	4432412L15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124430706 GeneID:74337 MGI:1921587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4432412L15 gene transcript_id : NM_028877.1

name	Il27ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980646 GeneID:50931 MGI:1355318
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 27 receptor, alpha transcript_id : NM_016671.2

name	Rln3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27502354 GeneID:212108 MGI:2158015
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : relaxin 3 transcript_id : NM_173184.1

name	Rfx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361730 GeneID:19724 MGI:105982
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : regulatory factor X, 1 (influences HLA class II expression) transcript_id : NM_009055.3

name	BC057552 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360075 GeneID:212123 MGI:2684420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC057552 transcript_id : NM_172502.3

name	LOC100039920 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258961 GeneID:100039920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to Ubtf protein transcript_id : XM_001473784.1

name	Podnl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61656183 GeneID:244550 MGI:2685352
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : podocan-like 1 transcript_id : NM_001013384.1

name	Cc2d1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122408 GeneID:212139 MGI:2384831
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil and C2 domain containing 1A transcript_id : NM_145970.1

name	4930432K21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037384 GeneID:74666 MGI:1921916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432K21 gene transcript_id : NM_029045.1

name	Nanos3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130762 GeneID:244551 MGI:2675387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nanos homolog 3 (Drosophila) transcript_id : NM_194059.2

name	Zswim4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130013 GeneID:212168 MGI:2443726
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, SWIM domain containing 4 transcript_id : NM_172503.3

name	D8Ertd738e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090601 GeneID:101966 MGI:1289231
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 8, ERATO Doi 738, expressed transcript_id : NM_001007571.1

name	2410018C20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357511 GeneID:67873 MGI:1915123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2410018C20 gene transcript_id : NM_026423.3

name	Ccdc130 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355090 GeneID:67736 MGI:1914986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 130 transcript_id : NM_026350.2

name	Cacna1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116174794 GeneID:12286 MGI:109482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, P/Q type, alpha 1A subunit transcript_id : NM_007578.3

name	Ier2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802849 GeneID:15936 MGI:104815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immediate early response 2 transcript_id : NM_010499.3

name	Btbd14b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543308 GeneID:66830 MGI:1914080
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BTB (POZ) domain containing 14B transcript_id : NM_025788.2

name	Trmt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574125 GeneID:212528 MGI:1289155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) transcript_id : NM_198020.1

name	LOC100039997 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258964 GeneID:100039997
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs product : hypothetical protein LOC100039997 transcript_id : XM_001473917.1

name	Lyl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865988 GeneID:17095 MGI:96891
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lymphoblastomic leukemia transcript_id : NM_008535.2

name	Nfix (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517470 GeneID:18032 MGI:97311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/X transcript_id : NM_010906.2

name	Nfix (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517486 GeneID:18032 MGI:97311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/X transcript_id : NM_001081982.1

name	Nfix (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517473 GeneID:18032 MGI:97311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor I/X transcript_id : NM_001081981.1

name	Dand5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742721 GeneID:23863 MGI:1344365
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DAN domain family, member 5 transcript_id : NM_201227.2

name	Gadd45gip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387542 GeneID:102060 MGI:1914947
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth arrest and DNA-damage-inducible, gamma interacting protein 1 transcript_id : NM_183358.3

name	Rad23a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368388 GeneID:19358 MGI:105126
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAD23a homolog (S. cerevisiae) transcript_id : NM_009010.3

name	Calr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116875821 GeneID:12317 MGI:88252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calreticulin transcript_id : NM_007591.3

name	Farsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130298 GeneID:66590 MGI:1913840
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phenylalanyl-tRNA synthetase, alpha subunit transcript_id : NM_025648.2

name	Syce2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366155 GeneID:71846 MGI:1919096
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptonemal complex central element protein 2 transcript_id : NM_027954.2

name	Gcdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680426 GeneID:270076 MGI:104541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaryl-Coenzyme A dehydrogenase transcript_id : NM_001044744.1

name	Gcdh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113680424 GeneID:270076 MGI:104541
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glutaryl-Coenzyme A dehydrogenase transcript_id : NM_008097.2

name	Klf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754453 GeneID:16596 MGI:1342771
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 1 (erythroid) transcript_id : NM_010635.1

name	Dnase2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299638 GeneID:13423 MGI:1329019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease II alpha transcript_id : NM_010062.3

name	Mast1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628633 GeneID:56527 MGI:1861901
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule associated serine/threonine kinase 1 transcript_id : NM_019945.2

name	Rtbdn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46048290 GeneID:234542 MGI:2443686
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retbindin transcript_id : NM_144929.2

name	Rnaseh2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384190 GeneID:69724 MGI:1916974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribonuclease H2, large subunit transcript_id : NM_027187.3

name	LOC666841 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149258967 GeneID:666841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs product : hypothetical LOC666841 transcript_id : XM_986414.2

name	Prdx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383789 GeneID:21672 MGI:109486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxiredoxin 2 transcript_id : NM_011563.3

name	Junb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680511 GeneID:16477 MGI:96647
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Jun-B oncogene transcript_id : NM_008416.1

name	Hook2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875435 GeneID:170833 MGI:2181664
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hook homolog 2 (Drosophila) transcript_id : NM_133255.1

name	Best2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350632 GeneID:212989 MGI:2387588
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bestrophin 2 transcript_id : NM_145388.2

name	Asna1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12025541 GeneID:56495 MGI:1928379
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arsA (bacterial) arsenite transporter, ATP-binding, homolog 1 transcript_id : NM_019652.1

name	2310036O22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85362707 GeneID:68544 MGI:1922833
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310036O22 gene transcript_id : NM_026760.2

name	Tnpo2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801768 GeneID:212999 MGI:2384849
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transportin 2 (importin 3, karyopherin beta 2b) transcript_id : NM_145390.3

name	Fbxw9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248555 GeneID:68628 MGI:1915878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 9 transcript_id : NM_026791.2

name	EG436049 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82918066 GeneID:436049 MGI:3645690
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG436049 transcript_id : XM_488140.2

name	Dhps (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87252719 GeneID:330817 MGI:2683592
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyhypusine synthase transcript_id : NM_001039514.1

name	1500041N16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067129 GeneID:67836 MGI:1915086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500041N16 gene transcript_id : NM_026399.2

name	BC056474 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59709456 GeneID:414077 MGI:3041257
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC056474 transcript_id : NM_001001493.2

name	Man2b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113195689 GeneID:17159 MGI:107286
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mannosidase 2, alpha B1 transcript_id : NM_010764.2

name	EG244556 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83627692 GeneID:244556 MGI:3648473
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG244556 transcript_id : NM_001037745.1

name	EG624855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388245 GeneID:624855 MGI:3643620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG624855 transcript_id : NM_001037922.2

name	Olfr371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170061 GeneID:258858 MGI:3030205
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 371 transcript_id : NM_146859.1

name	Vps35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367507 GeneID:65114 MGI:1890467
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 35 transcript_id : NM_022997.3

name	Ucp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678497 CCDS:CCDS22449.1 GeneID:22227 MGI:98894
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0017077 - oxidative phosphorylation uncoupler activity [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : uncoupling protein, mitochondrial; uncoupling protein 1, mitochondrial product : uncoupling protein 1 (mitochondrial, proton carrier) protein_id : NP_033489.1

name	Elmod2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542057 CCDS:CCDS22450.1 GeneID:244548 MGI:2445165
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006909 - phagocytosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ELMO domain containing 2 protein_id : NP_848851.2

name	4933434I20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119964704 CCDS:CCDS22451.1 GeneID:67555 MGI:1914805
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016758 - transferase activity, transferring hexosyl groups [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67555 protein_id : NP_080509.2

name	Clgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86262138 CCDS:CCDS22452.1 GeneID:12745 MGI:107472
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007126 - meiosis [Evidence IEA]; GO:0006457 - protein folding [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IEA] codon_start : 1 product : calmegin protein_id : NP_034034.2

name	Scoc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362711 CCDS:CCDS22453.1 GeneID:56367 MGI:1927654
definition	codon_start : 1 note : isoform a is encoded by transcript variant 1; short coiled coil protein SCOCO product : short coiled-coil protein isoform a protein_id : NP_001034226.1

name	Scoc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790207 GeneID:56367 MGI:1927654
definition	codon_start : 1 note : isoform b is encoded by transcript variant 2; short coiled coil protein SCOCO product : short coiled-coil protein isoform b protein_id : NP_062682.1

name	Olfr370 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129745 CCDS:CCDS22454.1 GeneID:258267 MGI:3030204
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2NUPS-11609807-11610751; olfactory receptor MOR267-16 product : olfactory receptor 370 protein_id : NP_666382.1

name	Ndufb7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385322 CCDS:CCDS22455.1 GeneID:66916 MGI:1914166
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IEA] [Evidence IDA] GO_function : GO:0008137 - NADH dehydrogenase (ubiquinone) activity [Evidence IEA]; GO:0003954 - NADH dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 protein_id : NP_080119.1

name	Gpsn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19923070 GeneID:106529 MGI:1915408
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : glycoprotein, synaptic 2 protein_id : NP_598879.1

name	Dnajb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055242 CCDS:CCDS22456.1 GeneID:81489 MGI:1931874
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0031072 - heat shock protein binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA] GO_process : GO:0051085 - chaperone cofactor-dependent protein folding [Evidence IGI]; GO:0006457 - protein folding [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 product : DnaJ (Hsp40) homolog, subfamily B, member 1 protein_id : NP_061278.1

name	Gipc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055336 CCDS:CCDS22457.1 GeneID:67903 MGI:1926252
definition	codon_start : 1 note : synectin; Tax interacting protein, clone 2; semaF cytoplasmic domain associated protein; RGS-GAIP interacting protein GIPC; neurophilin1-IP product : regulator of G-protein signaling 19 interacting protein 1 protein_id : NP_061241.1

name	Ptger1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7363447 CCDS:CCDS22458.1 GeneID:19216 MGI:97793
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004957 - prostaglandin E receptor activity [Evidence IEA]; GO:0004955 - prostaglandin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : prostaglandin E receptor 1 (subtype EP1) protein_id : NP_038669.1

name	Pkn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32813439 CCDS:CCDS22459.1 GeneID:320795 MGI:108022
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IMP]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006972 - hyperosmotic response [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : serine/threonine kinase 3; protein kinase C-like 1 product : protein kinase N1 protein_id : NP_796236.2

name	Ddx39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38372907 CCDS:CCDS22460.1 GeneID:68278 MGI:1915528
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA] codon_start : 1 note : UAP56-related helicase, 49 kDa; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 protein_id : NP_932099.2

name	Cd97 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753360 CCDS:CCDS22461.1 GeneID:26364 MGI:1347095
definition	GO_component : GO:0016021 - integral to membrane [Evidence TAS] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence TAS] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : EGF-TM7 receptor product : CD97 antigen protein_id : NP_036055.1

name	Lphn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56118951 GeneID:330814 MGI:1929461
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016524 - latrotoxin receptor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : lectomedin-2 product : latrophilin 1 protein_id : NP_851382.1

name	Asf1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313226 CCDS:CCDS22462.1 GeneID:66929 MGI:1914179
definition	GO_component : GO:0000785 - chromatin [Evidence IDA] GO_function : GO:0042393 - histone binding [Evidence IDA] GO_process : GO:0006334 - nucleosome assembly [Evidence IDA] codon_start : 1 product : anti-silencing function 1B protein_id : NP_077146.1

name	Prkaca (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7110693 CCDS:CCDS22463.1 GeneID:18747 MGI:97592
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0031594 - neuromuscular junction [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004691 - cAMP-dependent protein kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0001707 - mesoderm formation [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 note : C alpha; cAMP-dependent protein kinase catalytic subunit C alpha 2 product : protein kinase, cAMP dependent, catalytic, alpha protein_id : NP_032880.1

name	Samd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487221 GeneID:666704 MGI:2142433
definition	codon_start : 1 product : sterile alpha motif domain containing 1 protein_id : NP_001074884.1

name	1700067K01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147069 CCDS:CCDS22464.1 GeneID:73453 MGI:1920703
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73453 protein_id : NP_898920.1

name	2210011C24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383704 GeneID:70134 MGI:1917384
definition	codon_start : 1 product : hypothetical protein LOC70134 protein_id : XP_990693.1

name	4432412L15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124430707 GeneID:74337 MGI:1921587
definition	codon_start : 1 product : paralemmin 3 protein_id : NP_083153.1

name	Il27ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710110 CCDS:CCDS22465.1 GeneID:50931 MGI:1355318
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0042607 - exogenous peptide antigen binding [Evidence IDA]; GO:0045509 - interleukin-27 receptor activity [Evidence IDA]; GO:0042287 - MHC protein binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence TAS] codon_start : 1 exception : mismatches in translation note : cytokine receptor family, class 1 (WSXWS), member 1; T cell cytokine receptor product : interleukin 27 receptor, alpha protein_id : NP_057880.1

name	Rln3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27502355 CCDS:CCDS22466.1 GeneID:212108 MGI:2158015
definition	GO_component : GO:0005576 - extracellular region [Evidence TAS] GO_function : GO:0005179 - hormone activity [Evidence IEA] GO_process : GO:0007582 - physiological process [Evidence IEA]; GO:0030819 - positive regulation of cAMP biosynthesis [Evidence ISS] codon_start : 1 note : insulin-like 7 product : relaxin 3 protein_id : NP_775276.1

name	Rfx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543582 CCDS:CCDS22468.1 GeneID:19724 MGI:105982
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : vregulatory factor X, 1 (influences HLA class II expression) product : regulatory factor X, 1 (influences HLA class II expression) protein_id : NP_033081.2

name	BC057552 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249333 GeneID:212123 MGI:2684420
definition	codon_start : 1 product : hypothetical protein LOC212123 protein_id : NP_766090.2

name	LOC100039920 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258962 GeneID:100039920
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473834.1

name	Podnl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656184 GeneID:244550 MGI:2685352
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : podocan-like 1 protein_id : NP_001013402.1

name	Cc2d1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110835702 GeneID:212139 MGI:2384831
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : five' repressor element under dual repression binding protein 1; 5-HT1A receptor; putative NFkB activating protein product : coiled-coil and C2 domain containing 1A protein_id : NP_666082.2

name	4930432K21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037385 GeneID:74666 MGI:1921916
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC74666 protein_id : NP_083321.1

name	Nanos3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34610217 CCDS:CCDS22470.1 GeneID:244551 MGI:2675387
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0048477 - oogenesis [Evidence IEA]; GO:0048157 - oogenesis (sensu Mammalia) [Evidence IMP]; GO:0006417 - regulation of protein biosynthesis [Evidence IEA]; GO:0006445 - regulation of translation [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 product : nanos homolog 3 protein_id : NP_918948.1

name	Zswim4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42476037 CCDS:CCDS22471.1 GeneID:212168 MGI:2443726
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, SWIM domain containing 4 protein_id : NP_766091.2

name	D8Ertd738e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090602 GeneID:101966 MGI:1289231
definition	codon_start : 1 product : hypothetical protein LOC101966 protein_id : NP_001007572.1

name	2410018C20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541890 CCDS:CCDS22473.1 GeneID:67873 MGI:1915123
definition	GO_process : GO:0044249 - cellular biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC67873 protein_id : NP_080699.2

name	Ccdc130 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312808 GeneID:67736 MGI:1914986
definition	codon_start : 1 product : coiled-coil domain containing 130 protein_id : NP_080626.1

name	Cacna1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116174795 GeneID:12286 MGI:109482
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence TAS] GO_function : GO:0005262 - calcium channel activity [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005245 - voltage-gated calcium channel activity [Evidence IMP]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : calcium channel, P/Q type, alpha 1A; P/Q-type calcium channel alpha1A subunit product : calcium channel, voltage-dependent, P/Q type, alpha 1A subunit protein_id : NP_031604.3

name	Ier2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542990 CCDS:CCDS22474.1 GeneID:15936 MGI:104815
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : immediate early response 2 protein_id : NP_034629.2

name	Btbd14b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543309 CCDS:CCDS22475.1 GeneID:66830 MGI:1914080
definition	codon_start : 1 exception : mismatches in translation product : transcriptional repressor NAC1 protein_id : NP_080064.2

name	Trmt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574126 GeneID:212528 MGI:1289155
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004809 - tRNA (guanine-N2-)-methyltransferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TRM1 tRNA methyltransferase 1 homolog protein_id : NP_932137.1

name	LOC100039997 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149258965 GeneID:100039997
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473967.1

name	Lyl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865989 CCDS:CCDS22476.1 GeneID:17095 MGI:96891
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : lymphoblastomic leukemia protein_id : NP_032561.2

name	Nfix (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517474 GeneID:18032 MGI:97311
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : nuclear factor I/X isoform 3 protein_id : NP_001075450.1

name	Nfix (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754838 GeneID:18032 MGI:97311
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : nuclear factor I/X isoform 2 protein_id : NP_035036.1

name	Nfix (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517487 GeneID:18032 MGI:97311
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : nuclear factor I/X isoform 1 protein_id : NP_001075451.1

name	Dand5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054862 CCDS:CCDS22477.1 GeneID:23863 MGI:1344365
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0007368 - determination of left/right symmetry [Evidence IMP] [Evidence IGI]; GO:0030512 - negative regulation of transforming growth factor beta receptor signaling pathway [Evidence IGI]; GO:0017015 - regulation of transforming growth factor beta receptor signaling pathway [Evidence IDA] codon_start : 1 note : cerberus-like 2; dante product : DAN domain family, member 5 protein_id : NP_957679.1

name	Gadd45gip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254411 CCDS:CCDS22478.1 GeneID:102060 MGI:1914947
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : papillomavirus L2 interacting nuclear protein 1 protein_id : NP_899202.2

name	Rad23a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34447211 GeneID:19358 MGI:105126
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006289 - nucleotide-excision repair [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IGI] codon_start : 1 product : RAD23a homolog protein_id : NP_033036.2

name	Calr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680836 CCDS:CCDS22479.1 GeneID:12317 MGI:88252
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA] [Evidence IEA]; GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005529 - sugar binding [Evidence IEA]; GO:0051082 - unfolded protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030866 - cortical actin cytoskeleton organization and biogenesis [Evidence IDA]; GO:0006457 - protein folding [Evidence IEA]; GO:0040020 - regulation of meiosis [Evidence IDA] codon_start : 1 product : calreticulin protein_id : NP_031617.1

name	Farsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794462 CCDS:CCDS22480.1 GeneID:66590 MGI:1913840
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] codon_start : 1 product : phenylalanine-tRNA synthetase-like, alpha subunit protein_id : NP_079924.1

name	Syce2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313691 CCDS:CCDS22481.1 GeneID:71846 MGI:1919096
definition	GO_component : GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007130 - synaptonemal complex formation [Evidence IC] codon_start : 1 exception : mismatches in translation note : central element synaptonemal complex 1 product : synaptonemal complex central element protein 2 protein_id : NP_082230.1

name	Gcdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680427 GeneID:270076 MGI:104541
definition	EC_number : 1.3.99.7 GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004361 - glutaryl-CoA dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutaryl-Coenzyme A dehydrogenase protein_id : NP_001038209.1

name	Gcdh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113680425 CCDS:CCDS22482.1 GeneID:270076 MGI:104541
definition	EC_number : 1.3.99.7 GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0004361 - glutaryl-CoA dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : glutaryl-Coenzyme A dehydrogenase protein_id : NP_032123.2

name	Klf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754454 CCDS:CCDS22483.1 GeneID:16596 MGI:1342771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006338 - chromatin remodeling [Evidence IDA]; GO:0048821 - erythrocyte development [Evidence IMP]; GO:0043249 - erythrocyte maturation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Kruppel-like factor 1 (erythroid) protein_id : NP_034765.1

name	Dnase2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753654 CCDS:CCDS22484.1 GeneID:13423 MGI:1329019
definition	GO_component : GO:0005764 - lysosome [Evidence TAS] GO_function : GO:0004531 - deoxyribonuclease II activity [Evidence IDA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0006308 - DNA catabolism [Evidence IMP]; GO:0006259 - DNA metabolism [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP] codon_start : 1 product : deoxyribonuclease II alpha protein_id : NP_034192.1

name	Mast1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628634 GeneID:56527 MGI:1861901
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence ISS] [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 note : syntrophin-associated serine-threonine protein kinase; syntrophin associated serine/threonine kinase product : microtubule associated serine/threonine kinase 1 protein_id : NP_064329.2

name	Rtbdn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450337 CCDS:CCDS22485.1 GeneID:234542 MGI:2443686
definition	codon_start : 1 product : retbindin protein_id : NP_659178.1

name	Rnaseh2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037175 CCDS:CCDS22486.1 GeneID:69724 MGI:1916974
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0004523 - ribonuclease H activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0016070 - RNA metabolism [Evidence IEA] codon_start : 1 product : ribonuclease H2, large subunit protein_id : NP_081463.1

name	LOC666841 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94383713 GeneID:666841
definition	codon_start : 1 product : hypothetical protein protein_id : XP_991508.1

name	Prdx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560539 GeneID:21672 MGI:109486
definition	GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence TAS]; GO:0051920 - peroxiredoxin activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence TAS]; GO:0008379 - thioredoxin peroxidase activity [Evidence TAS] [Evidence ISS] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006800 - oxygen and reactive oxygen species metabolism [Evidence TAS]; GO:0006979 - response to oxidative stress [Evidence TAS] codon_start : 1 exception : unclassified translation discrepancy note : thioredoxin peroxidase 1; Prx II-1; thioredoxin reductase; Trx dependent peroxide reductase 1; thiol specific antioxidant protein; thioredoxin dependent peroxide reductase 1; protector protein; Calpromotin product : peroxiredoxin 2 protein_id : NP_035693.2

name	Junb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680512 CCDS:CCDS22488.1 GeneID:16477 MGI:96647
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046983 - protein dimerization activity [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0050875 - cellular physiological process [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : Jun-B oncogene protein_id : NP_032442.1

name	Hook2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875436 CCDS:CCDS22489.1 GeneID:170833 MGI:2181664
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0008017 - microtubule binding [Evidence IEA] GO_process : GO:0000226 - microtubule cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hook homolog 2 protein_id : NP_573518.1

name	Best2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703776 GeneID:212989 MGI:2387588
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : vitelliform macular dystrophy 2-like protein 1 protein_id : NP_663363.1

name	Asna1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12025542 GeneID:56495 MGI:1928379
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015446 - arsenite-transporting ATPase activity [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006820 - anion transport [Evidence IEA]; GO:0046685 - response to arsenic [Evidence IEA] codon_start : 1 function : catalytic subunit of arsenite extrusion pump function : resistance to As(III)/Sb(III) note : arsenite-translocating ATPase product : arsA (bacterial) arsenite transporter, ATP-binding, homolog 1 protein_id : NP_062626.1

name	2310036O22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85362708 CCDS:CCDS22490.1 GeneID:68544 MGI:1922833
definition	codon_start : 1 product : hypothetical protein LOC68544 protein_id : NP_081036.2

name	Tnpo2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84875502 CCDS:CCDS22491.1 GeneID:212999 MGI:2384849
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0005643 - nuclear pore [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0000059 - protein import into nucleus, docking [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : karyopherin (importin) beta 2b protein_id : NP_663365.2

name	Fbxw9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248556 GeneID:68628 MGI:1915878
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : F-box and WD-40 domain protein 9 protein_id : NP_081067.2

name	EG436049 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82918067 GeneID:436049 MGI:3645690
definition	codon_start : 1 product : similar to hCG1650801 protein_id : XP_488140.2

name	Dhps (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87252720 CCDS:CCDS22492.1 GeneID:330817 MGI:2683592
definition	EC_number : 2.5.1.46 GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008612 - hypusine biosynthesis from peptidyl-lysine [Evidence IEA]; GO:0050983 - spermidine catabolism to deoxyhypusine, using deoxyhypusine synthase [Evidence ISS] codon_start : 1 product : deoxyhypusine synthase protein_id : NP_001034603.1

name	1500041N16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71067130 CCDS:CCDS22493.1 GeneID:67836 MGI:1915086
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : MAPK cascade scaffold protein product : mitogen-activated protein kinase organizer 1 protein_id : NP_080675.2

name	BC056474 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47894404 GeneID:414077 MGI:3041257
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : hypothetical protein LOC414077 protein_id : NP_001001493.1

name	Man2b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113195690 CCDS:CCDS22494.1 GeneID:17159 MGI:107286
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004559 - alpha-mannosidase activity [Evidence IMP] [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0015923 - mannosidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0007611 - learning and/or memory [Evidence IMP]; GO:0006013 - mannose metabolism [Evidence IMP] [Evidence IDA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : lysosomal alpha-mannosidase product : mannosidase 2, alpha B1 protein_id : NP_034894.2

name	EG244556 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627693 GeneID:244556 MGI:3648473
definition	codon_start : 1 product : zinc finger protein 791 protein_id : NP_001032834.1

name	EG624855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702318 GeneID:624855 MGI:3643620
definition	codon_start : 1 product : hypothetical protein LOC624855 protein_id : NP_001033011.1

name	Olfr371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170062 CCDS:CCDS22496.1 GeneID:258858 MGI:3030205
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2NUPS-13298842-13299780; olfactory receptor MOR141-3 product : olfactory receptor 371 protein_id : NP_667070.1

name	Vps35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928670 GeneID:65114 MGI:1890467
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0045045 - secretory pathway [Evidence ISS]; GO:0006810 - transport [Evidence IEA]; GO:0006624 - vacuolar protein processing or maturation [Evidence ISS] codon_start : 1 note : maternal embryonic message 3 product : vacuolar protein sorting 35 protein_id : NP_075373.1

name	LOC675854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675854
definition	number : 2 pseudo : _no_value

name	LOC675854 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675854
definition	number : 1 pseudo : _no_value

name	EG384857 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:384857
definition	number : 1 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 1 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 2 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 3 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 4 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 5 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 6 pseudo : _no_value

name	LOC100039975 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039975
definition	number : 7 pseudo : _no_value

name	LOC546077 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258963 GeneID:546077
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 177 ESTs, 6 Proteins product : similar to PES1 protein pseudo : _no_value transcript_id : XR_031582.1

name	C330011M18Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149258960 GeneID:442802 MGI:3045248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA C330011M18 gene transcript_id : XR_035219.1

name	LOC546080 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149258966 GeneID:546080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 8 Proteins product : similar to ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 pseudo : _no_value transcript_id : XR_031475.1

clone name	MSMg01-443B02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269M08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111J19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-460O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303C13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-431J06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317I24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-491N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-292J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517I16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275N11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-210B08.T7 (MSMg01no210_b08.b1)	MSMg01-210B08.TJ (MSMg01no210_b08.g1)
ACC	AG392346	AG392347
length	825	1,581
length of high quality (start - end)	274 (46 - 319)	---
definition	CHROMAT_FILE: MSMg01no210_b08.b1 PHD_FILE: MSMg01no210_b08.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:34:28 2005	CHROMAT_FILE: MSMg01no210_b08.g1 PHD_FILE: MSMg01no210_b08.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 20:34:28 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	CTATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGG AATTCCAGGACGGCAGCCACACTGGGTTGATTTCACCAACACAGCTGACA CTTACAAAAACATTGTGTAAACAAAATAAAGTAACTGTCTAACAGACCTA AGAGGAGAGGGGGTGTGCTGGGAGTGTGGCTGACCACTGCTTCACCTTGT ACAAGGCTCTGGGTTCCACACCGGAAGCAGCAAAACAAGCAAACAAAAAG ATTGGGTCATGTGCTTGTCTGTGGTGCAGGAAATCCTAAGGGCCTGCTGA TCTCCTGAAGGTTTATGGGTGCTTCCCCTAAACTTGATATTTTTGGTTCT TTATGACACGTGATTTTTTTTCCCCCCCCCCCCCCCCATCTTTTTCTCTC CTTTTCCTTTTTTATTTTCCCCCCCCCTCTTTTAAAAAAAACTTTTCCCC GCTTTTTCTCCCCCCTTTTCCCTTTTTTTCCTTTCCCTTCTTTTTTTTTT CCTGTTTCCCTTTTTCGCCCTTTCCCCCATATTTCCTAACCCTTCTTACC TCCCTTCTCACCTTCATTCCCCGTGTCTTTTCCTTTCTTTCTCCCTCACT CCTTCCGATCCTCTTTTTCTCCACACTTTTCCCTTCCCCTTCTCACCTCG TTCCACCCTTTGGTATTGCATTCTTTCGCCCTTACATCCCCCTCCCTTCT TTCCTTCCTACTTCTCCTCTTTTACTCCCTTTCTCATTTCGCGACACTCC TTCTCCTCCATTACACCAATACTCCCATATTACATTTCCTTGTTTCGCAC CATCTTAGCCCTTTATACCCCTCTT	TCTCATCTACTCTTTCTCTGCGGCACTGGCGCCTNACACACCCACAGACA GCGCTCACCACACANAAGCAGCCCCCCCANCACACACTCTATCAAATATA ATTACGACATGATTATAGTATTTAGATACACCCCCGACACNAGGCACGAC ACGCATGCGAGCATTGCAAAATCACATCATATAAAGTGTCATGACCCCAG CACAACGCCCACGAAAGATATGTGTACTCGCGTGTTACACACGNCGCGTC GGCCCTGTCTGCCACTCNANAACGCTCAAAAGCACATGAGTGTGATAGGT ACCCGCTAGCCCTTTGGGCAGCGCCTCCTCTCCTTCGTCTGCTACACTAG CNTCAGTACGTTCTTACCTCTCCTCTTCCTCATCCTCGTTTCTCTCAACC ACTACCCCTGCTCTCATATTTGTACATCGCAGCAGCACGCCTCCACACTA TAGATAGATTGCGTATTTAATATCACTGTCCGGACACTGCAACGGTGGAC CACCCCACCCTCCCACGCTCTATACGGCGTGTAAGAACATATTATGTGAG AGGAAAGTGGAGCCTCAGACAGACCACACCTATTAATGACNCACAATATT ATAATGCAGCGATGGAGACTCGATTTGATGATATATACACTCACTTGATG CAGCTCGAGAATCTCTCATATCGAGTCCACTCTGCTGAGGCACATAGCAT GTCTCCACTATACCTATCTCCCTCAACAGCGACGGCGGATTGAGTATTAT GTTTTGTATTTCTTGTTGTGCACCCACTCTTCCTCTCGCCTGCTCTCGCG TGTTGTGGCGCAGCCGTTATCCAGCTTACTGCGCTTTGTCGCTGCGGTGA TTGTTGTTTATGGACAAGGAANACAATTAGTACGCACAAACAAATATTAT ATATATAAAATGTGTGTGGGATTAGTTCGCCGTCCTTAATCATTCTCCTC GTATATTACGTGGCGTGGTGTTGTTATATGCCGCGGGTGTGTCGGTGCGC GGCGTGACGTGTGGTGGGTATCTCCAGCCGGCTCGACGTCGTATCTCAGA CACGCCGCTCTCTATCTTCACTCCCCTCACTATCACCGNCCCCACGGTCT TCAGTTACTTCGTTCGTTCTCCTACTCCACAGATTATCACGTGCCGCGTC AGTTCGCTGTCCGTCGCGTTTCTTCAGACGCGTCGTGCGTCACAAGAGCA GCCGGTGACGTGTCACACGTTTGTTCGTGTATACTATTGTAAGATCGAGA CACGTCGTGCGNGCATACGATAATACAGCATGCGCGCTGTTNGTCGTGCC TCTATTCGTGAGTGCACGCCGCGTAGATCAATGTATCATCGCAGCGTTGT CTATTTATGCGCGCGCTGTGCCTGTTGCCCGTATGCCGCTGTCTTAGTGC TTCTCGGNAGCGCATCGCGTCTATGCGTGCAGATGAGTCGTTTTATTATG ACNCNTACNTCATACTGCGCTCACTACGACGTCGCGTACGAATATATTAT ATATCGTGGCTACATCTNCTCTCTGCGTCGTCTGCGATACGTCTGATCCT CCCGTGCTTTCTATACTTATTCTCACATTGG
quality values	Open. Hide. 8 8 8 9 9 12 19 29 37 41 29 28 28 22 22 32 37 32 32 26 30 30 22 23 41 30 29 31 31 31 35 44 53 50 57 57 57 57 57 57 30 29 22 29 29 42 34 57 57 47 47 47 47 47 42 41 41 41 42 57 57 48 54 54 68 68 68 68 68 68 68 68 68 68 68 68 68 51 51 50 50 50 50 57 57 57 57 57 57 57 68 68 68 68 68 68 51 50 50 50 57 57 51 51 50 50 50 32 36 35 35 35 50 50 57 68 68 68 68 68 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 59 57 57 57 57 57 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 52 57 57 57 57 57 68 68 68 68 68 57 57 57 57 57 68 68 68 68 68 57 57 62 62 62 57 57 59 57 57 57 68 68 57 57 59 59 57 59 59 59 59 59 59 52 57 52 57 57 57 57 57 57 57 57 57 57 57 57 57 43 41 39 39 57 57 54 52 57 57 59 59 59 59 59 59 59 68 68 57 57 57 57 52 57 59 52 52 57 57 54 54 54 59 59 59 59 57 52 57 52 52 44 44 43 43 46 57 50 54 54 57 57 50 44 44 36 27 20 30 28 41 41 43 47 47 57 48 57 48 57 57 57 59 57 57 47 42 32 32 30 30 41 40 37 34 19 13 13 19 24 22 20 21 18 23 20 16 16 12 12 15 24 31 34 43 43 37 43 34 25 28 19 22 16 16 17 21 16 19 16 18 10 12 12 14 8 8 8 8 8 9 11 11 17 23 24 22 9 11 10 10 9 9 9 17 11 12 28 28 18 19 14 14 8 10 8 8 8 8 10 10 10 10 8 8 8 8 8 8 8 8 8 8 10 8 8 8 10 8 8 8 8 9 9 10 14 19 21 17 24 26 26 23 29 22 22 22 22 13 11 13 8 8 8 8 8 8 8 8 8 8 10 10 10 10 13 9 16 10 10 10 10 12 12 15 16 21 16 10 9 9 8 8 8 8 8 8 10 10 17 16 16 21 19 23 18 18 11 11 11 13 13 21 21 28 18 18 12 11 8 8 10 13 21 25 23 15 8 8 8 8 8 8 8 10 7 7 8 8 10 10 15 8 8 6 6 8 8 10 13 15 8 8 8 10 13 15 15 11 11 11 12 12 12 12 9 8 8 8 8 8 14 14 16 10 10 10 8 10 11 10 8 8 9 12 10 10 8 8 10 6 6 6 8 10 11 12 9 8 8 8 8 8 7 7 12 15 16 12 9 10 10 8 10 8 9 9 13 18 19 10 10 10 9 9 9 12 12 15 18 15 17 13 15 8 8 6 6 10 8 10 8 12 9 15 11 10 10 10 10 8 8 8 8 11 14 13 14 20 22 22 10 10 10 13 13 12 15 13 12 10 10 8 8 8 10 8 8 8 8 8 10 13 11 10 9 9 8 8 8 8 8 9 8 10 8 8 6 6 10 8 10 8 8 8 8 8 8 10 15 10 10 10 8 8 8 8 10 8 10 7 7 8 8 9 12 8 11 6 7 7 7 11 8 11 11 8 8 6 6 10 10 10 10 10 11 10 10 12 12 10 8 8 10 8 8 9 9 9 9 16 16 10 8 8 8 8 8 8 8 8 8 8 10 8 8 18 19 14 20 24 20 17 12 10 10 8 8 8 6 6 8 8 8 8 6 6 8 8 8 10 6 9 7 8 10 10 10 15 10 8 8 8 8 12 10 10 12 13 10 8 9 8 11 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 12 9 8 8 8 8 8 8 8 8 13 8 8 8	Open. Hide. 6 8 6 6 6 6 8 8 8 8 6 6 8 8 11 11 10 8 8 6 6 8 8 8 8 8 9 7 7 7 7 8 17 3 0 3 6 8 6 6 6 11 8 8 8 8 8 8 9 9 9 9 10 9 9 9 11 8 6 6 6 8 8 3 0 3 10 10 6 8 6 6 6 6 8 6 6 8 3 0 3 8 9 9 9 9 13 16 8 8 8 8 6 6 7 8 13 12 11 9 9 9 8 8 8 8 8 8 8 9 11 9 12 11 9 9 9 9 10 10 8 8 8 8 8 8 8 8 8 9 9 9 9 9 9 9 9 9 9 3 0 3 6 6 8 9 6 6 6 6 6 8 16 15 10 10 10 8 6 6 6 6 7 7 10 12 13 11 7 7 6 6 6 6 8 8 10 10 10 10 10 8 8 8 8 8 8 10 10 10 11 8 8 6 6 10 10 10 10 8 8 6 6 8 6 8 8 10 10 8 6 6 8 8 8 8 8 7 7 7 8 8 8 8 11 12 8 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 3 0 3 10 10 10 10 9 8 8 8 8 8 8 7 7 10 6 11 11 11 11 9 13 3 0 3 0 3 7 8 8 6 6 6 6 7 7 8 6 6 8 8 8 8 10 11 11 8 8 6 6 8 6 6 6 8 8 13 8 8 6 6 6 8 8 8 10 10 10 9 9 9 9 9 9 10 10 9 12 8 8 8 8 8 10 11 12 10 9 8 8 8 8 8 8 8 8 10 9 8 8 8 8 10 8 10 10 3 0 3 6 8 6 6 6 6 8 8 8 8 7 6 6 6 6 6 6 6 6 8 8 8 9 8 8 8 8 8 10 8 8 8 8 8 8 8 11 10 11 11 11 11 11 10 13 10 10 8 8 8 7 6 8 10 10 10 10 10 16 11 8 8 10 8 8 8 8 10 10 10 8 8 6 6 8 10 8 8 8 8 8 10 8 8 6 6 6 8 8 8 10 10 11 10 10 10 10 8 8 8 7 10 9 10 9 9 9 9 9 9 9 10 13 12 9 7 7 8 8 8 8 6 6 8 6 11 12 8 8 10 6 6 6 6 8 10 8 6 6 6 8 6 6 8 6 8 8 8 8 8 8 8 8 6 7 7 6 10 10 10 8 8 8 10 10 8 8 6 6 6 10 8 10 10 8 8 6 6 10 8 8 8 8 8 8 8 8 8 10 8 10 6 7 8 8 8 8 8 8 6 7 6 8 8 11 8 8 7 7 10 8 15 11 11 6 6 6 6 6 6 10 8 11 10 8 8 8 8 6 6 6 6 8 8 12 10 3 0 3 8 8 8 8 8 10 18 13 14 10 10 8 6 6 6 6 6 10 13 10 6 8 6 6 8 8 8 6 6 6 8 8 8 8 8 8 8 8 8 8 8 9 8 8 6 6 6 6 6 8 8 10 8 8 8 8 8 8 8 7 9 6 8 6 6 8 8 8 8 7 6 6 8 8 8 9 9 9 9 9 8 8 8 8 8 8 9 9 9 9 8 8 8 8 8 8 9 9 9 9 9 9 7 8 6 6 6 6 8 8 10 8 7 6 6 6 6 8 8 10 8 8 8 10 10 10 10 10 10 10 10 11 10 10 7 8 7 8 8 10 6 6 8 8 8 8 6 6 8 8 9 6 6 8 8 6 6 6 6 11 14 8 8 8 8 8 8 10 8 8 8 8 10 12 8 8 8 8 8 8 9 13 9 7 7 8 8 10 8 8 11 8 10 8 8 8 8 8 8 8 8 12 11 12 10 13 10 10 9 9 8 8 8 8 8 8 8 8 10 8 8 10 10 10 9 8 8 8 8 8 8 9 9 6 6 6 6 6 6 6 6 6 8 8 8 8 8 8 10 11 11 11 8 8 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 3 0 3 7 7 7 9 6 6 6 6 6 6 6 6 8 10 6 6 6 6 6 15 8 8 9 9 10 10 8 8 8 11 10 8 7 7 7 7 8 8 8 8 10 6 8 7 6 8 6 8 8 8 7 6 8 8 8 8 10 9 10 10 11 11 10 10 13 8 8 8 8 8 8 11 12 12 12 12 10 8 8 10 8 8 8 8 8 8 8 12 10 9 9 9 8 8 8 8 6 6 6 6 6 11 11 8 8 8 8 8 6 9 7 13 8 9 10 15 11 11 11 9 9 9 9 9 9 11 14 11 12 8 8 8 10 8 8 7 7 8 7 7 9 6 8 8 10 10 10 9 12 9 9 8 8 8 8 8 8 8 8 8 8 10 10 8 8 8 8 8 8 8 10 9 9 8 8 6 6 8 8 6 6 6 8 10 8 9 9 9 9 8 8 8 8 8 8 8 8 6 6 10 8 6 6 6 6 8 8 9 9 8 8 8 8 8 3 0 3 8 8 11 11 8 6 6 6 8 6 9 8 8 9 8 8 8 10 10 11 11 11 8 8 6 7 8 10 8 9 6 6 6 6 8 6 8 10 10 9 9 9 10 9 9 10 10 15 13 8 8 8 10 13 17 11 10 9 9 10 9 9 10 8 6 6 6 6 8 8 10 8 8 8 8 8 10 10 13 10 10 10 10 10 10 9 10 10 13 13 12 10 8 8 8 6 8 8 6 8 8 8 8 8 8 9 9 9 8 8 8 8 6 7 6 6 6 6 6 8 8 10 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 9 8 8 8 8 8 6 6 8 8 8 8 8 10 9 9 10 10 10 10 12 13 11 11 3 0 3 8 8 8 6 6 7 6 8 8 9 9 9 6 6 7 6 8 8 10 10 8 8 6 6 6 8 8 3 0 3 8 8 8 8 8 8 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 8 8 8 8 8 8 9 8 8 6 6 6 6 8 8 8 8 8 10 10 10 8 7 7 7 6 6 6 6 6 6 10 10 8 6 6 6 6 6 6 8 8 8 8 8 10 12 8 8 12 15 10 12 12 10 10 10 10 8 8 8 6 6 8 6 8 8 8 8 8 8 8 8 8 6 6 6 6 7 8 6 6 6 6 8 6 8 8 10 8 8 8 3 0 3 6 8 13 7 7 8 8 8 6 6 6 6 6 8 10 6 6 6 6 8 8 10 11 9 8 8 8 8 10 10 12 8 8 8 8 8 14 10 6 6 6 6 3 0 3 0 3 7 3 0 3 6 8 10 11 10 8 8 8 6 6 6 6 11 15 19 13 8 6 6 6 6 8 6 12 15 11 9 9 15 8 8 6 6 6 8 11 8 8 8 8 8 8 8 6 6 6 6 6 8 8 8 8 8 8 8 8 3 0 3 10 9 7 8 10 11 13 8 10 8 6 6 6 6 12 11 7 7 6 6 6 6 6 8 12 11 11 11 8 8 7 7 6 6 8 8 11 11 11 11 10 10 10 11 10 10 10 10 9 8 8 8 8 10 8 10 10 8 6 6 6 6

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no210_b08.b1 MSMg01no210_b08.b1 CHROMAT_FILE:
MSMg01no210_b08.b1 PHD_FILE: MSMg01no210_b08.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 20:34:28 2005
         (274 letters)



>mm_chr8_86808935_86809608
          Length = 674

 Score =  514 bits (266), Expect = e-150
 Identities = 269/270 (99%)
 Strand = Plus / Plus

                                                                       
Query: 5   gaattccaggacggcagccacactgggttgatttcaccaacacagctgacacttacaaaa 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 205 gaattccaggacggcagccacactgggttgatttcaccaacacagctgacacttacaaaa 264

                                                                       
Query: 65  acattgtgtaaacaaaataaagtaactgtctaacagacctaagaggagagggggtgtgct 124
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 265 acattgtgtaaacaaaataaagtaactgtctaacagacctaagaggagagggggtgtgct 324

                                                                       
Query: 125 gggagtgtggctgaccactgcttcaccttgtacaaggctctgggttccacaccggaagca 184
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 325 gggagtgtggctgaccactgcttcaccttgtacaaggctctgggttccacaccggaagca 384

                                                                       
Query: 185 gcaaaacaagcaaacaaaaagattgggtcatgtgcttgtctgtggtgcaggaaatcctaa 244
           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 385 gcaaaacaagcaaacaaaaagattgggtcatatgcttgtctgtggtgcaggaaatcctaa 444

                                         
Query: 245 gggcctgctgatctcctgaaggtttatggg 274
           ||||||||||||||||||||||||||||||
Sbjct: 445 gggcctgctgatctcctgaaggtttatggg 474


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 14
Number of extensions: 1
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 274
Length of database: 674
Length adjustment: 9
Effective length of query: 265
Effective length of database: 665
Effective search space:   176225
Effective search space used:   176225
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information