MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-295M17
Chromosome	8 (Build37)
Map Location	107,812,479 - 107,812,690
singlet/doublet	singlet
Overlap gene	4931428F04Rik
Upstream gene	Cmtm2a, Cmtm2b, Cmtm3, Cmtm4, Dync1li2, Ccdc79, Appbp1, Car7, LOC628007, 4833426J09Rik, Cdh16, Rrad, 1110019N10Rik, EG637550, LOC382052, LOC100041473, Ces6, LOC628050, 4932416K20Rik, BC015286, Matr3-ps2, Ces2, LOC667754, LOC667760, Ces5, 2310038E17Rik, 2210023G05Rik, LOC436058, EG436059, Es31, EG13909, LOC667774, BC026374, LOC100042408, Cbfb, D230025D16Rik, C76566, Tradd, Fbxl8, Hsf4, Nol3
Downstream gene	Exoc3l, E2f4, Elmo3, Lrrc29, Hspc171, Fhod1, Slc9a5, Plekhg4, Kctd19, Lrrc36, 2700055K07Rik, Zdhhc1, LOC667837, Hsd11b2, Atp6v0d1, Agrp, EG667846, 2310066E14Rik, LOC546100, Ctcf, EG546101, D130029J02Rik, Acd, Pard6a, E130303B06Rik, 4933405L10Rik, Gfod2, Ranbp10, Tsnaxip1, Cenpt, LOC100041617, Thap11, Nutf2, Edc4, Nrn1l, Pskh1, Ctrl, Psmb10, Lcat, Slc12a4, Dpep3, Dpep2, Ddx28, Dus2l, Nfatc3, Rbm35b, Lypla3, Slc7a6, Slc7a6os, Prmt7, Smpd3
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cmtm2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73381 MGI:2447160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75502 MGI:2447311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68119 MGI:2447162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97487 MGI:2142888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dync1li2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234663 MGI:107738
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc79 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320022 MGI:2443187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Appbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234664 MGI:2384561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12354 MGI:103100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628007 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 4 Proteins pseudo : _no_value

name	4833426J09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382051 MGI:1918878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdh16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12556 MGI:106671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrad (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56437 MGI:1930943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110019N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68523 MGI:1915773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG637550 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637550 MGI:3648500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 16 Proteins pseudo : _no_value

name	LOC382052 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 28 Proteins pseudo : _no_value

name	LOC100041473 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Ces6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102022 MGI:2142491
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628050 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628050
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins pseudo : _no_value

name	4932416K20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442809 MGI:3045271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	BC015286 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234669 MGI:2448547
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Matr3-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17186 MGI:1298410
definition	note : matrin 3, pseudogene 2 pseudo : _no_value

name	Ces2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234671 MGI:2385905
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667754 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 49 ESTs, 38 Proteins pseudo : _no_value

name	LOC667760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 27 Proteins pseudo : _no_value

name	Ces5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234673 MGI:2443170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2310038E17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71903 MGI:1919153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210023G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72361 MGI:1919611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436058 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436058
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	EG436059 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436059 MGI:3648740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 Proteins

name	Es31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 mRNAs, 81 ESTs, 12 Proteins

name	EG13909 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13909 MGI:3644960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667774 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	BC026374 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234677 MGI:2384581
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042408 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cbfb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12400 MGI:99851
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D230025D16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234678 MGI:2443049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C76566 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:97440 MGI:2142841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tradd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71609 MGI:109200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxl8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50788 MGI:1354697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hsf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26386 MGI:1347058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nol3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78688 MGI:1925938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4931428F04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74356 MGI:1921606
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Exoc3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277978 MGI:3041195
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E2f4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104394 MGI:103012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elmo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234683 MGI:2679007
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234684 MGI:2443262
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hspc171 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66320 MGI:1913570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fhod1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234686 MGI:2679008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:277973 MGI:2685542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plekhg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102075 MGI:2142544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kctd19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279499 MGI:3045294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc36 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270091 MGI:2448585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2700055K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67971 MGI:1915221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70796 MGI:1918046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Hsd11b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15484 MGI:104720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6v0d1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11972 MGI:1201778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Agrp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11604 MGI:892013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667846 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667846 MGI:3647575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 952 ESTs, 3 Proteins

name	2310066E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75687 MGI:1922937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546100 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	Ctcf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13018 MGI:109447
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG546101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546101 MGI:3642938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 453 ESTs, 34 Proteins

name	D130029J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234695 MGI:2685431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:497652 MGI:87873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pard6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56513 MGI:1927223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	E130303B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102124 MGI:2142593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933405L10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71046 MGI:1918296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 5 ESTs, 2 Proteins

name	Gfod2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70575 MGI:1917825
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ranbp10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74334 MGI:1921584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsnaxip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72236 MGI:1919486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320394 MGI:2443939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041617 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Thap11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59016 MGI:1930964
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nutf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68051 MGI:1915301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Edc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234699 MGI:2446249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrn1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234700 MGI:2443642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pskh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244631 MGI:3528383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ctrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109660 MGI:88558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19171 MGI:1096380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lcat (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16816 MGI:96755
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc12a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20498 MGI:1309465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpep3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71854 MGI:1919104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319446 MGI:2442042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx28 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71986 MGI:1919236
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dus2l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66369 MGI:1913619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nfatc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18021 MGI:103296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm35b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77411 MGI:1924661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lypla3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192654 MGI:2178076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330836 MGI:2142598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a6os (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66432 MGI:1916951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Prmt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214572 MGI:2384879
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58994 MGI:1927578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157473 GeneID:73381 MGI:2447160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 2A transcript_id : NM_027022.4

name	Cmtm2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366677 GeneID:75502 MGI:2447311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 2B transcript_id : NM_028524.2

name	Cmtm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892608 GeneID:68119 MGI:2447162
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 3 transcript_id : NM_024217.3

name	Cmtm4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130093 GeneID:97487 MGI:2142888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 4 transcript_id : NM_153582.4

name	Dync1li2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62945389 GeneID:234663 MGI:107738
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein, cytoplasmic 1 light intermediate chain 2 transcript_id : NM_001013380.1

name	Ccdc79 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348021 GeneID:320022 MGI:2443187
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 79 transcript_id : NM_180958.2

name	Appbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369149 GeneID:234664 MGI:2384561
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : amyloid beta precursor protein binding protein 1 transcript_id : NM_144931.2

name	Car7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227229 GeneID:12354 MGI:103100
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 7 transcript_id : NM_053070.2

name	4833426J09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66841377 GeneID:382051 MGI:1918878
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833426J09 gene transcript_id : NM_001024606.1

name	Cdh16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376412 GeneID:12556 MGI:106671
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cadherin 16 transcript_id : NM_007663.2

name	Rrad (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145496 GeneID:56437 MGI:1930943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras-related associated with diabetes transcript_id : NM_019662.2

name	1110019N10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360665 GeneID:68523 MGI:1915773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110019N10 gene transcript_id : NM_026753.2

name	Ces6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352997 GeneID:102022 MGI:2142491
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxylesterase 6 transcript_id : NM_133960.3

name	BC015286 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371927 GeneID:234669 MGI:2448547
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC015286 transcript_id : NM_198171.2

name	Ces2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704205 GeneID:234671 MGI:2385905
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxylesterase 2 transcript_id : NM_145603.1

name	Ces5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802881 GeneID:234673 MGI:2443170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carboxylesterase 5 transcript_id : NM_172759.2

name	2310038E17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120474986 GeneID:71903 MGI:1919153
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310038E17 gene transcript_id : NM_001079865.2

name	2210023G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574079 GeneID:72361 MGI:1919611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2210023G05 gene transcript_id : NM_197999.1

name	EG436059 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51764432 GeneID:436059 MGI:3648740
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins product : predicted gene, EG436059, transcript variant 1 transcript_id : XM_488149.1

name	Es31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259059 GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 69 ESTs, 6 Proteins product : esterase 31, transcript variant 5 transcript_id : XM_001003935.2

name	Es31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383764 GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 81 ESTs, 10 Proteins product : esterase 31, transcript variant 1 transcript_id : XM_356125.5

name	Es31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383767 GeneID:382053 MGI:102773
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 72 ESTs, 5 Proteins product : esterase 31, transcript variant 4 transcript_id : XM_901994.2

name	EG13909 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21362300 GeneID:13909 MGI:3644960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG13909 transcript_id : NM_144511.1

name	BC026374 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122766 GeneID:234677 MGI:2384581
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC026374 transcript_id : NM_146213.1

name	LOC100042408 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259060 GeneID:100042408
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042408 transcript_id : XM_001478728.1

name	Cbfb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362453 GeneID:12400 MGI:99851
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : core binding factor beta transcript_id : NM_022309.3

name	D230025D16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704215 GeneID:234678 MGI:2443049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D230025D16 gene transcript_id : NM_145604.1

name	C76566 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111160293 GeneID:97440 MGI:2142841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C76566 transcript_id : NM_178879.3

name	Tradd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949761 GeneID:71609 MGI:109200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TNFRSF1A-associated via death domain transcript_id : NM_001033161.2

name	Fbxl8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7657076 GeneID:50788 MGI:1354697
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 8 transcript_id : NM_015821.1

name	Hsf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129985 GeneID:26386 MGI:1347058
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heat shock transcription factor 4 transcript_id : NM_011939.2

name	Nol3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379243 GeneID:78688 MGI:1925938
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleolar protein 3 (apoptosis repressor with CARD domain) transcript_id : NM_030152.3

name	4931428F04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037370 GeneID:74356 MGI:1921606
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4931428F04 gene transcript_id : NM_028888.1

name	Exoc3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366366 GeneID:277978 MGI:3041195
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : exocyst complex component 3-like transcript_id : NM_177788.3

name	E2f4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22507328 GeneID:104394 MGI:103012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E2F transcription factor 4 transcript_id : NM_148952.1

name	Elmo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922683 GeneID:234683 MGI:2679007
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : engulfment and cell motility 3, ced-12 homolog (C. elegans) transcript_id : NM_172760.2

name	Lrrc29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922633 GeneID:234684 MGI:2443262
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 29 transcript_id : NM_177449.3

name	Hspc171 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13384905 GeneID:66320 MGI:1913570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HSPC171 protein transcript_id : NM_025486.1

name	Fhod1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361635 GeneID:234686 MGI:2679008
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : formin homology 2 domain containing 1 transcript_id : NM_177699.3

name	Slc9a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486738 GeneID:277973 MGI:2685542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), member 5 transcript_id : NM_001081332.1

name	Plekhg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487488 GeneID:102075 MGI:2142544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family G (with RhoGef domain) member 4 transcript_id : NM_001081333.1

name	Kctd19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343012 GeneID:279499 MGI:3045294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 19 transcript_id : NM_177791.2

name	Lrrc36 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361661 GeneID:270091 MGI:2448585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 36 transcript_id : NM_001033371.2

name	2700055K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980918 GeneID:67971 MGI:1915221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2700055K07 gene transcript_id : NM_026481.2

name	Zdhhc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357306 GeneID:70796 MGI:1918046
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 1 transcript_id : NM_175160.3

name	Hsd11b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778912 GeneID:15484 MGI:104720
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid 11-beta dehydrogenase 2 transcript_id : NM_008289.2

name	Atp6v0d1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802838 GeneID:11972 MGI:1201778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal V0 subunit D1 transcript_id : NM_013477.3

name	Agrp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491876 GeneID:11604 MGI:892013
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : agouti related protein transcript_id : NM_007427.2

name	EG667846 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259072 GeneID:667846 MGI:3647575
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 952 ESTs, 3 Proteins product : predicted gene, EG667846 transcript_id : XM_992869.2

name	2310066E14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486970 GeneID:75687 MGI:1922937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2310066E14 gene transcript_id : NM_001081241.1

name	LOC546100 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94383788 GeneID:546100
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical LOC546100 transcript_id : XM_622446.3

name	Ctcf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6681072 GeneID:13018 MGI:109447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCCTC-binding factor transcript_id : NM_007794.1

name	Ctcf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342434 GeneID:13018 MGI:109447
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCCTC-binding factor transcript_id : NM_181322.2

name	EG546101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94383789 GeneID:546101 MGI:3642938
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 453 ESTs, 34 Proteins product : predicted gene, EG546101 transcript_id : XM_620708.3

name	D130029J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131122 GeneID:234695 MGI:2685431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D130029J02 gene transcript_id : NM_001033320.2

name	Acd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593058 GeneID:497652 MGI:87873
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adrenocortical dysplasia transcript_id : NM_001012638.1

name	Pard6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145500 GeneID:56513 MGI:1927223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : par-6 (partitioning defective 6,) homolog alpha (C. elegans) transcript_id : NM_001047436.1

name	Pard6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145494 GeneID:56513 MGI:1927223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : par-6 (partitioning defective 6,) homolog alpha (C. elegans) transcript_id : NM_019695.2

name	Pard6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145498 GeneID:56513 MGI:1927223
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : par-6 (partitioning defective 6,) homolog alpha (C. elegans) transcript_id : NM_001047435.1

name	E130303B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38142469 GeneID:102124 MGI:2142593
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E130303B06 gene transcript_id : NM_198299.1

name	4933405L10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259073 GeneID:71046 MGI:1918296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : RIKEN cDNA 4933405L10 gene transcript_id : XM_134328.4

name	Gfod2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802477 GeneID:70575 MGI:1917825
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose-fructose oxidoreductase domain containing 2 transcript_id : NM_027469.2

name	Ranbp10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117676379 GeneID:74334 MGI:1921584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAN binding protein 10 transcript_id : NM_145824.4

name	Tsnaxip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357349 GeneID:72236 MGI:1919486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translin-associated factor X (Tsnax) interacting protein 1 transcript_id : NM_024445.3

name	Cenpt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380926 GeneID:320394 MGI:2443939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein T transcript_id : NM_177150.2

name	LOC100041617 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259024 GeneID:100041617
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041617 transcript_id : XM_001476693.1

name	Thap11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946933 GeneID:59016 MGI:1930964
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : THAP domain containing 11 transcript_id : NM_021513.1

name	Nutf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892556 GeneID:68051 MGI:1915301
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear transport factor 2 transcript_id : NM_026532.3

name	Edc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31795580 GeneID:234699 MGI:2446249
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : enhancer of mRNA decapping 4 transcript_id : NM_181594.2

name	Nrn1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383424 GeneID:234700 MGI:2443642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuritin 1-like transcript_id : NM_175024.3

name	Pskh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982544 GeneID:244631 MGI:3528383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein serine kinase H1 transcript_id : NM_173432.2

name	Ctrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598840 GeneID:109660 MGI:88558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chymotrypsin-like transcript_id : NM_023182.2

name	Psmb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373194 GeneID:19171 MGI:1096380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteasome (prosome, macropain) subunit, beta type 10 transcript_id : NM_013640.2

name	Lcat (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678671 GeneID:16816 MGI:96755
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lecithin cholesterol acyltransferase transcript_id : NM_008490.1

name	Slc12a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892389 GeneID:20498 MGI:1309465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 12, member 4 transcript_id : NM_009195.2

name	Dpep3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369401 GeneID:71854 MGI:1919104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidase 3 transcript_id : NM_027960.2

name	Dpep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32880213 GeneID:319446 MGI:2442042
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidase 2 transcript_id : NM_176913.3

name	Ddx28 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369283 GeneID:71986 MGI:1919236
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 transcript_id : NM_028038.2

name	Dus2l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365381 GeneID:66369 MGI:1913619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dihydrouridine synthase 2-like (SMM1, S. cerevisiae) transcript_id : NM_025518.3

name	Nfatc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113199768 GeneID:18021 MGI:103296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 transcript_id : NM_010901.2

name	Rbm35b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341162 GeneID:77411 MGI:1924661
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 35b transcript_id : NM_176838.2

name	Lypla3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543133 GeneID:192654 MGI:2178076
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysophospholipase 3 transcript_id : NM_133792.2

name	Slc7a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130634 GeneID:330836 MGI:2142598
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 transcript_id : NM_178798.3

name	Slc7a6os (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222271 GeneID:66432 MGI:1916951
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7, member 6 opposite strand transcript_id : NM_001007567.1

name	Prmt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703807 GeneID:214572 MGI:2384879
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein arginine N-methyltransferase 7 transcript_id : NM_145404.1

name	Smpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130464 GeneID:58994 MGI:1927578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sphingomyelin phosphodiesterase 3, neutral transcript_id : NM_021491.3

name	Cmtm2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729761 GeneID:73381 MGI:2447160
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IPI] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003714 - transcription corepressor activity [Evidence IDA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA] codon_start : 1 note : chemokine-like factor superfamily 2-1b product : chemokine-like factor super family 2A protein_id : NP_081298.1

name	Cmtm2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729765 CCDS:CCDS22576.1 GeneID:75502 MGI:2447311
definition	codon_start : 1 note : chemokine-like factor superfamily protein 2-2 product : chemokine-like factor super family 2B protein_id : NP_082800.1

name	Cmtm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13195644 CCDS:CCDS22577.1 GeneID:68119 MGI:2447162
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 3 protein_id : NP_077179.1

name	Cmtm4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27312023 CCDS:CCDS22578.1 GeneID:97487 MGI:2142888
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 4 protein_id : NP_705810.2

name	Dync1li2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945390 CCDS:CCDS22579.1 GeneID:234663 MGI:107738
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005868 - cytoplasmic dynein complex [Evidence IEA]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007018 - microtubule-based movement [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dynein, cytoplasmic, light intermediate chain 2 product : dynein, cytoplasmic, light intermediate polypeptide 2 protein_id : NP_001013398.1

name	Ccdc79 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725843 CCDS:CCDS22580.1 GeneID:320022 MGI:2443187
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 79 protein_id : NP_851289.1

name	Appbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450341 GeneID:234664 MGI:2384561
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0007049 - cell cycle [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : amyloid beta precursor protein binding protein 1, 59kDa product : amyloid beta precursor protein binding protein 1 protein_id : NP_659180.1

name	Car7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28269695 CCDS:CCDS22581.1 GeneID:12354 MGI:103100
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : carbonic anhydrase VII product : carbonic anhydrase 7 protein_id : NP_444300.1

name	4833426J09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66841378 CCDS:CCDS22582.1 GeneID:382051 MGI:1918878
definition	GO_component : GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : pyruvate dehydrogenase phosphatase isoenzyme 2 protein_id : NP_001019777.1

name	Cdh16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680900 CCDS:CCDS22583.1 GeneID:12556 MGI:106671
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence IEA] codon_start : 1 note : KSP-cadherin product : cadherin 16 protein_id : NP_031689.1

name	Rrad (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145497 CCDS:CCDS22584.1 GeneID:56437 MGI:1930943
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : Ras-like GTP-binding protein rad product : Ras-related associated with diabetes protein_id : NP_062636.2

name	1110019N10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312046 GeneID:68523 MGI:1915773
definition	codon_start : 1 product : hypothetical protein LOC68523 protein_id : NP_081029.1

name	Ces6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527178 CCDS:CCDS22585.1 GeneID:102022 MGI:2142491
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004091 - carboxylesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 product : carboxylesterase 6 protein_id : NP_598721.1

name	BC015286 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718991 CCDS:CCDS22586.1 GeneID:234669 MGI:2448547
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234669 protein_id : NP_937814.1

name	Ces2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704206 CCDS:CCDS22587.1 GeneID:234671 MGI:2385905
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 note : carboxylesterase ML3; acylcarnitine hydrolase M1 product : carboxylesterase 2 protein_id : NP_663578.1

name	Ces5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370126 CCDS:CCDS22588.1 GeneID:234673 MGI:2443170
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004091 - carboxylesterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 product : carboxylesterase 5 protein_id : NP_766347.1

name	2310038E17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120474987 GeneID:71903 MGI:1919153
definition	codon_start : 1 product : hypothetical protein LOC71903 protein_id : NP_001073334.2

name	2210023G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574080 CCDS:CCDS22589.1 GeneID:72361 MGI:1919611
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC72361 protein_id : NP_932116.1

name	EG436059 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51764433 GeneID:436059 MGI:3648740
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_488149.1

name	Es31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63578904 GeneID:382053 MGI:102773
definition	codon_start : 1 product : esterase 31 isoform 1 protein_id : XP_356125.2

name	Es31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383766 GeneID:382053 MGI:102773
definition	codon_start : 1 product : esterase 31 isoform 5 protein_id : XP_001003935.1

name	Es31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82918240 GeneID:382053 MGI:102773
definition	codon_start : 1 product : esterase 31 isoform 4 protein_id : XP_907087.1

name	EG13909 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362301 CCDS:CCDS22590.1 GeneID:13909 MGI:3644960
definition	codon_start : 1 product : esterase 31-like protein_id : NP_653094.1

name	BC026374 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122767 CCDS:CCDS22591.1 GeneID:234677 MGI:2384581
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004759 - serine esterase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC234677 protein_id : NP_666325.1

name	LOC100042408 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259061 GeneID:100042408
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478778.1

name	Cbfb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981854 CCDS:CCDS22592.1 GeneID:12400 MGI:99851
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IEA] GO_process : GO:0048469 - cell maturation [Evidence IMP]; GO:0030098 - lymphocyte differentiation [Evidence IMP]; GO:0030099 - myeloid cell differentiation [Evidence IMP]; GO:0001503 - ossification [Evidence IMP]; GO:0001649 - osteoblast differentiation [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 exception : mismatches in translation product : core binding factor beta protein_id : NP_071704.2

name	D230025D16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704216 CCDS:CCDS22593.1 GeneID:234678 MGI:2443049
definition	GO_component : GO:0030425 - dendrite [Evidence ISS]; GO:0005802 - Golgi trans face [Evidence ISS]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0030672 - synaptic vesicle membrane [Evidence ISS] GO_function : GO:0003674 - molecular_function [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0043001 - Golgi to plasma membrane protein transport [Evidence ISS] codon_start : 1 exception : mismatches in translation note : lin 10 homolog; lin-10 homolog product : lin-10 protein_id : NP_663579.1

name	C76566 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725708 GeneID:97440 MGI:2142841
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008378 - galactosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006486 - protein amino acid glycosylation [Evidence IEA] codon_start : 1 note : beta-1,3-galactosyltransferase-related protein product : hypothetical protein LOC97440 protein_id : NP_849210.1

name	Tradd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677522 CCDS:CCDS22594.1 GeneID:71609 MGI:109200
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : TNF receptor 1 associated signal transducer product : TNFRSF1A-associated via death domain protein_id : NP_001028333.1

name	Fbxl8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7657077 CCDS:CCDS22595.1 GeneID:50788 MGI:1354697
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : F-box and leucine-rich repeat protein 8 protein_id : NP_056636.1

name	Hsf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754252 GeneID:26386 MGI:1347058
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048468 - cell development [Evidence IMP]; GO:0001747 - eye development (sensu Mammalia) [Evidence IMP]; GO:0045597 - positive regulation of cell differentiation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI] [Evidence IMP]; GO:0006457 - protein folding [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : heat shock factor 4; DNA binding protein; binds heat shock DNA elements product : heat shock transcription factor 4 protein_id : NP_036069.1

name	Nol3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313458 GeneID:78688 MGI:1925938
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016528 - sarcoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] [Evidence IEA] GO_process : GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 product : nucleolar protein 3 protein_id : NP_084428.1

name	4931428F04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037371 CCDS:CCDS22596.1 GeneID:74356 MGI:1921606
definition	codon_start : 1 product : hypothetical protein LOC74356 protein_id : NP_083164.1

name	Exoc3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244320 CCDS:CCDS22597.1 GeneID:277978 MGI:3041195
definition	GO_function : GO:0000155 - two-component sensor activity [Evidence IEA] GO_process : GO:0000160 - two-component signal transduction system (phosphorelay) [Evidence IEA] codon_start : 1 product : exocyst complex component 3-like protein_id : NP_808456.1

name	E2f4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507329 GeneID:104394 MGI:103012
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] [Evidence TAS] GO_process : GO:0008015 - circulation [Evidence IMP]; GO:0000083 - G1/S-specific transcription in mitotic cell cycle [Evidence IGI] [Evidence IDA]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0008361 - regulation of cell size [Evidence IMP]; GO:0006884 - regulation of cell volume [Evidence IMP]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : E2F transcription factor 4 protein_id : NP_683754.1

name	Elmo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87080827 CCDS:CCDS22598.1 GeneID:234683 MGI:2679007
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006909 - phagocytosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : engulfment and cell motility 3, ced-12 homolog protein_id : NP_766348.2

name	Lrrc29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922634 GeneID:234684 MGI:2443262
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine rich repeat containing 29 protein_id : NP_803232.2

name	Hspc171 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384906 CCDS:CCDS22599.1 GeneID:66320 MGI:1913570
definition	codon_start : 1 product : HSPC171 protein protein_id : NP_079762.1

name	Fhod1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244148 CCDS:CCDS22600.1 GeneID:234686 MGI:2679008
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA] GO_process : GO:0030036 - actin cytoskeleton organization and biogenesis [Evidence IEA]; GO:0016043 - cell organization and biogenesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : formin homology 2 domain containing 1 protein_id : NP_808367.1

name	Slc9a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486739 GeneID:277973 MGI:2685542
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0015385 - sodium:hydrogen antiporter activity [Evidence IEA]; GO:0015299 - solute:hydrogen antiporter activity [Evidence IEA] GO_process : GO:0006885 - regulation of pH [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 product : solute carrier family 9 (sodium/hydrogen exchanger), member 5 protein_id : NP_001074801.1

name	Plekhg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487489 GeneID:102075 MGI:2142544
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 product : pleckstrin homology domain containing, family G (with RhoGef domain) member 4 protein_id : NP_001074802.1

name	Kctd19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244318 GeneID:279499 MGI:3045294
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 19 protein_id : NP_808459.1

name	Lrrc36 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701864 CCDS:CCDS22601.1 GeneID:270091 MGI:2448585
definition	codon_start : 1 product : leucine rich repeat containing 36 protein_id : NP_001028543.1

name	2700055K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385968 CCDS:CCDS22602.1 GeneID:67971 MGI:1915221
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67971 protein_id : NP_080757.1

name	Zdhhc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424758 CCDS:CCDS22603.1 GeneID:70796 MGI:1918046
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA] codon_start : 1 product : zinc finger, DHHC domain containing 1 protein_id : NP_780369.1

name	Hsd11b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778913 GeneID:15484 MGI:104720
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : 11(beta)-HSD2 product : hydroxysteroid 11-beta dehydrogenase 2 protein_id : NP_032315.2

name	Atp6v0d1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981304 CCDS:CCDS22604.1 GeneID:11972 MGI:1201778
definition	GO_component : GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence IDA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump), 42 kDa; lysosomal 38kDa; ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D; ATPase, H+ transporting, V0 subunit D product : ATPase, H+ transporting, V0 subunit D isoform 1 protein_id : NP_038505.2

name	Agrp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671529 CCDS:CCDS22605.1 GeneID:11604 MGI:892013
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005184 - neuropeptide hormone activity [Evidence IDA] GO_process : GO:0009755 - hormone-mediated signaling [Evidence IEA]; GO:0007218 - neuropeptide signaling pathway [Evidence IDA]; GO:0007582 - physiological process [Evidence IDA] codon_start : 1 note : orexigenic neuropeptide product : agouti related protein protein_id : NP_031453.1

name	EG667846 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383782 GeneID:667846 MGI:3647575
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997963.1

name	2310066E14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486971 GeneID:75687 MGI:1922937
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC75687 protein_id : NP_001074710.1

name	LOC546100 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63578927 GeneID:546100
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622446.1

name	EG546101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94383790 GeneID:546101 MGI:3642938
definition	codon_start : 1 product : similar to 17,000 dalton myosin light chain protein_id : XP_620708.3

name	Ctcf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681073 CCDS:CCDS22606.1 GeneID:13018 MGI:109447
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006306 - DNA methylation [Evidence IDA]; GO:0009048 - dosage compensation, by inactivation of X chromosome [Evidence TAS]; GO:0006349 - imprinting [Evidence IMP] [Evidence IDA]; GO:0010216 - maintenance of DNA methylation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : CCCTC-binding factor protein_id : NP_031820.1

name	Ctcf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044459 CCDS:CCDS22606.1 GeneID:13018 MGI:109447
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006306 - DNA methylation [Evidence IDA]; GO:0009048 - dosage compensation, by inactivation of X chromosome [Evidence TAS]; GO:0006349 - imprinting [Evidence IMP] [Evidence IDA]; GO:0010216 - maintenance of DNA methylation [Evidence IMP]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : CCCTC-binding factor protein_id : NP_851839.1

name	D130029J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701822 CCDS:CCDS22607.1 GeneID:234695 MGI:2685431
definition	codon_start : 1 product : hypothetical protein LOC234695 protein_id : NP_001028492.1

name	Acd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593059 CCDS:CCDS22608.1 GeneID:497652 MGI:87873
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000781 - chromosome, telomeric region [Evidence IEA]; GO:0000783 - nuclear telomere cap complex [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0030326 - embryonic limb morphogenesis [Evidence IMP]; GO:0035282 - segmentation [Evidence IMP]; GO:0001501 - skeletal development [Evidence IMP]; GO:0000723 - telomere maintenance [Evidence IEA] [Evidence ISS]; GO:0001655 - urogenital system development [Evidence IMP] codon_start : 1 product : adrenocortical dysplasia protein_id : NP_001012656.1

name	Pard6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145501 GeneID:56513 MGI:1927223
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0030742 - GTP-dependent protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030010 - establishment of cell polarity [Evidence TAS]; GO:0045217 - intercellular junction maintenance [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; Tax interaction protein 40 product : par-6 (partitioning defective 6,) homolog alpha isoform 3 protein_id : NP_001040901.1

name	Pard6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145495 CCDS:CCDS22609.1 GeneID:56513 MGI:1927223
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0030742 - GTP-dependent protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030010 - establishment of cell polarity [Evidence TAS]; GO:0045217 - intercellular junction maintenance [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; Tax interaction protein 40 product : par-6 (partitioning defective 6,) homolog alpha isoform 1 protein_id : NP_062669.2

name	Pard6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145499 GeneID:56513 MGI:1927223
definition	GO_component : GO:0005938 - cell cortex [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0030742 - GTP-dependent protein binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0017048 - Rho GTPase binding [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0030010 - establishment of cell polarity [Evidence TAS]; GO:0045217 - intercellular junction maintenance [Evidence IDA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; Tax interaction protein 40 product : par-6 (partitioning defective 6,) homolog alpha isoform 2 protein_id : NP_001040900.1

name	E130303B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38142470 CCDS:CCDS22610.1 GeneID:102124 MGI:2142593
definition	codon_start : 1 product : hypothetical protein LOC102124 protein_id : NP_938041.1

name	4933405L10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259074 GeneID:71046 MGI:1918296
definition	codon_start : 1 product : hypothetical protein LOC71046 protein_id : XP_134328.2

name	Gfod2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312610 CCDS:CCDS22612.1 GeneID:70575 MGI:1917825
definition	codon_start : 1 product : glucose-fructose oxidoreductase domain containing 2 protein_id : NP_081745.1

name	Ranbp10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40804757 CCDS:CCDS22613.1 GeneID:74334 MGI:1921584
definition	codon_start : 1 product : Ran-binding protein 10 protein_id : NP_665823.2

name	Tsnaxip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789217 CCDS:CCDS22614.1 GeneID:72236 MGI:1919486
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 product : translin-associated factor X (Tsnax) interacting protein 1 protein_id : NP_077765.1

name	Cenpt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893125 CCDS:CCDS22615.1 GeneID:320394 MGI:2443939
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] codon_start : 1 product : centromere protein T protein_id : NP_796124.1

name	LOC100041617 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259025 GeneID:100041617
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476743.1

name	Thap11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946934 CCDS:CCDS22616.1 GeneID:59016 MGI:1930964
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : THAP domain containing 11 protein_id : NP_067488.1

name	Nutf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386032 CCDS:CCDS22617.1 GeneID:68051 MGI:1915301
definition	GO_function : GO:0008565 - protein transporter activity [Evidence IDA] GO_process : GO:0006606 - protein import into nucleus [Evidence IDA] codon_start : 1 product : nuclear transport factor 2 protein_id : NP_080808.1

name	Edc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712002 GeneID:234699 MGI:2446249
definition	codon_start : 1 product : cDNA sequence BC022641 protein_id : NP_853625.1

name	Nrn1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542833 CCDS:CCDS22618.1 GeneID:234700 MGI:2443642
definition	codon_start : 1 note : MRCC2446-like protein; candidate plasticity gene 15-2 product : neuritin 1-like protein_id : NP_778189.1

name	Pskh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734116 CCDS:CCDS22619.1 GeneID:244631 MGI:3528383
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 product : protein serine kinase H1 protein_id : NP_775608.1

name	Ctrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13374559 CCDS:CCDS22620.1 GeneID:109660 MGI:88558
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : chymotrypsin A; chymotrypsin A CTRA-1 product : chymotrypsin-like protein_id : NP_075671.1

name	Psmb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305417 CCDS:CCDS22621.1 GeneID:19171 MGI:1096380
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0005839 - proteasome core complex (sensu Eukaryota) [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004298 - threonine endopeptidase activity [Evidence IEA] GO_process : GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : proteasome (prosomome, macropain) subunit, beta type 10; prosome Mecl1; proteasome subunit MECL1 product : proteasome (prosome, macropain) subunit, beta type 10 protein_id : NP_038668.1

name	Lcat (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678672 CCDS:CCDS22622.1 GeneID:16816 MGI:96755
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004607 - phosphatidylcholine-sterol O-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : lecithin-cholesterol acyltransferase Lcat product : lecithin cholesterol acyltransferase protein_id : NP_032516.1

name	Slc12a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677993 CCDS:CCDS22623.1 GeneID:20498 MGI:1309465
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0015377 - cation:chloride symporter activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : K-Cl cotransporter KCC1 product : solute carrier family 12, member 4 protein_id : NP_033221.1

name	Dpep3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313683 CCDS:CCDS22624.1 GeneID:71854 MGI:1919104
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IDA] GO_function : GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0008239 - dipeptidyl-peptidase activity [Evidence IEA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004237 - membrane dipeptidase activity [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 product : putative membrane-bound dipeptidase 3 protein_id : NP_082236.1

name	Dpep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32880214 CCDS:CCDS22625.1 GeneID:319446 MGI:2442042
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016805 - dipeptidase activity [Evidence IEA]; GO:0008239 - dipeptidyl-peptidase activity [Evidence IEA]; GO:0008238 - exopeptidase activity [Evidence IDA]; GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004237 - membrane dipeptidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : putative membrane-bound dipeptidase 2 protein_id : NP_795887.2

name	Ddx28 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312584 CCDS:CCDS22626.1 GeneID:71986 MGI:1919236
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 28 protein_id : NP_082314.1

name	Dus2l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625595 CCDS:CCDS22627.1 GeneID:66369 MGI:1913619
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0008033 - tRNA processing [Evidence IEA] codon_start : 1 product : dihydrouridine synthase 2-like protein_id : NP_079794.1

name	Nfatc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113199769 CCDS:CCDS22628.1 GeneID:18021 MGI:103296
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0045333 - cellular respiration [Evidence IMP]; GO:0007507 - heart development [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IMP] [Evidence IDA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : nuclear factor of activated T-cells, cytoplasmic 3 product : cytoplasmic nuclear factor of activated T-cells 3 protein_id : NP_035031.2

name	Rbm35b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28849887 CCDS:CCDS22629.1 GeneID:77411 MGI:1924661
definition	GO_function : GO:0000166 - nucleotide binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein 35b protein_id : NP_789808.1

name	Lypla3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527008 CCDS:CCDS22630.1 GeneID:192654 MGI:2178076
definition	GO_component : GO:0005764 - lysosome [Evidence IEA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0047499 - calcium-independent phospholipase A2 activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004622 - lysophospholipase activity [Evidence IDA]; GO:0004607 - phosphatidylcholine-sterol O-acyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006672 - ceramide metabolism [Evidence IDA]; GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : lysosomal phospholipase A2 product : lysophospholipase 3 protein_id : NP_598553.1

name	Slc7a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520283 CCDS:CCDS22631.1 GeneID:330836 MGI:2142598
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carriersolute carrier family 7 (cationic amino acid transporter, y+ system), member 6 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 protein_id : NP_848913.1

name	Slc7a6os (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222272 CCDS:CCDS22632.1 GeneID:66432 MGI:1916951
definition	codon_start : 1 product : solute carrier family 7, member 6 opposite strand protein_id : NP_001007568.1

name	Prmt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703808 CCDS:CCDS22633.1 GeneID:214572 MGI:2384879
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0042393 - histone binding [Evidence ISS]; GO:0008469 - histone-arginine N-methyltransferase activity [Evidence ISS]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0035241 - protein-arginine omega-N monomethyltransferase activity [Evidence ISS]; GO:0035243 - protein-arginine omega-N symmetric methyltransferase activity [Evidence ISS]; GO:0008757 - S-adenosylmethionine-dependent methyltransferase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016277 - [myelin basic protein]-arginine N-methyltransferase activity [Evidence ISS] GO_process : GO:0016571 - histone methylation [Evidence ISS]; GO:0018216 - peptidyl-arginine methylation [Evidence ISS]; GO:0043393 - regulation of protein binding [Evidence ISS] codon_start : 1 product : protein arginine N-methyltransferase 7 protein_id : NP_663379.1

name	Smpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946902 CCDS:CCDS22634.1 GeneID:58994 MGI:1927578
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0000137 - Golgi cis cisterna [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004767 - sphingomyelin phosphodiesterase activity [Evidence IMP] [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0030072 - peptide hormone secretion [Evidence IMP]; GO:0006950 - response to stress [Evidence TAS]; GO:0007165 - signal transduction [Evidence TAS]; GO:0006684 - sphingomyelin metabolism [Evidence IDA] codon_start : 1 note : fragilitas ossium; neutral sphingomyelinase II product : sphingomyelin phosphodiesterase 3, neutral protein_id : NP_067466.1

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 12 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 11 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 10 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 9 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 8 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 7 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 6 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 5 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 4 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 3 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 2 pseudo : _no_value

name	LOC382052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:382052
definition	number : 1 pseudo : _no_value

name	LOC100041473 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041473
definition	number : 1 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 1 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 2 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 3 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 4 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 5 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 6 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 7 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 8 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 9 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 10 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 11 pseudo : _no_value

name	LOC628050 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628050
definition	number : 12 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 1 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 2 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 3 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 4 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 5 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 6 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 7 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 8 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 9 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 10 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 11 pseudo : _no_value

name	LOC436058 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436058
definition	number : 12 pseudo : _no_value

name	LOC667774 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667774
definition	number : 1 pseudo : _no_value

name	LOC667837 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667837
definition	number : 1 pseudo : _no_value

name	LOC667837 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667837
definition	number : 2 pseudo : _no_value

name	LOC628007 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259055 GeneID:628007
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 4 Proteins product : similar to guanine nucleotide binding protein (G protein), gamma 5 subunit pseudo : _no_value transcript_id : XR_033668.1

name	EG637550 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149259018 GeneID:637550 MGI:3648500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 16 Proteins product : predicted gene, EG637550 pseudo : _no_value transcript_id : XR_002064.2

name	4932416K20Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149259019 GeneID:442809 MGI:3045271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4932416K20 gene transcript_id : XR_035314.1

name	LOC667754 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94383778 GeneID:667754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 49 ESTs, 38 Proteins product : similar to Carboxylesterase 2 pseudo : _no_value transcript_id : XR_002069.1

name	LOC667760 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259058 GeneID:667760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 27 Proteins product : similar to Carboxylesterase 2 pseudo : _no_value transcript_id : XR_033757.1

clone name	MSMg01-347G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-367G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-413D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070L07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-377F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531L10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-062A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050J09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509P03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-384H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547L17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-131F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-471A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266E02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-105O14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084J04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-154G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-116D01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-390O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-235P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321E03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086O04
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-295M17.T7 (MSMg01no295_m17.b1)	MSMg01-295M17.TJ (MSMg01no295_m17.g1)
ACC	AG423587	AG423588
length	772	764
length of high quality (start - end)	221 (44 - 264)	287 (74 - 360)
definition	CHROMAT_FILE: MSMg01no295_m17.b1 PHD_FILE: MSMg01no295_m17.b1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:31:49 2005	CHROMAT_FILE: MSMg01no295_m17.g1 PHD_FILE: MSMg01no295_m17.g1.phd.1 CHEM: term DYE: big TIME: Tue May 17 21:31:49 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCGCGGAA TTCTGGTAATTACGTGGAGGTAGGTGGAATGAACGAAGGGAAAATGGAAG AACTGGCCCATATAGTGGTCACGCTAGACATCCAGAAAAGTATACAGTTT GAGGGTGAATGAGATCTGAGACTAGAAGTCGTTTTTTAAGCAGCTGATCA CTAGGTAAGGTGGAGGAAGACTCCGAGGAGGAGGAGGATGCCGGGGTGGG GGTGGGGGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNN NNNNNNNGNNNNNNNNNTTTTTTTTNTTTTTTTTTTTNNTTTTTTTNNNN NNNTTTTTTTTTTTTTCCCCCCCCCCCCCCCCNNNNNNNTNNTTNNNNNN NNTTCTTNCCCCCCCCTTTAAAAAAAAAAAAAAAAATTTTGGGGGGGGTG GTGTGTTCCTCCACTTTTCTTCCCCCCTTTTCCTTCTTTCACTCCTTTCT TTCTCTCCGCCCCTTGTTCCTATTTCTCCCTTCTTACGTTTTTTCCATTT TTACTTTCCCCATTTTAGCTTTTTTCCTCTCTTGTTTTTATTCCTCCCCC TTTTTTTCTTTTCCCCTTTCTCCCCTCCATTCTTTCTTTCGCTTATCCAT TCTTTACACCACCCACATTCTTCCTCCCTTTTTTTTTTCACACCCATATT TTTATTATTCCGTCTTTCCCTTTTCTCATCCTCTCTCTTTTTCTCCCCCC CCTCTTTTTTCCACTTTTTTTT	ATAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX XXXXXXXXXXXXXXXXXXXXXXXCACACCCCTAAGCCCCGTACCCCATAA AAGCCCCTGGCTTTCGAGCCTCGTGGCCGGCATCTGTTATCTCCTGTGTG GGATTCATGCCGGTCCGGAGCTCCGTAATTAAACGTCCTCATGTAATTAC AGCGAGTGGGTCCTCGTGTTTCTTTGGGTGCTCTCACACTCCTGAGACTA GAGTGGGGGTCCCCGAAAGGGGGTCTTACATTTTGGGGGCTCGTCCGGGA TTTGGGTGCACCCAGAAACCTGAGAATACCCCTTGGAGGTACGTTTGTTT TTGTGAGTCTTCTATGTTGCCTCGCCCCTAAGTGTCTAAGTGTGGCACCG CTGAATTTCTGCCTTTGTTTTTCAAATCTGAGATTGTGGGTTTGAGTCCC ACCTGCGTTTCCAGTTCTGGTATTCTGTATTCTGGCAGCTGCCACTGTGG GCCGTAAGGACCCTAGTGGCTGTGGGAGGACGACGGTCTATGGCCCCACA GGCTGCACCCCTGGAAGACGTTCCAAGGGAGACCCTGGAGAGAGTGCCCA GGGTATGGACCAGTCAGGAGGACCTGGCTGTTGCCTGTCATAGTACAGGA GAGAGAGTGTTCTCTCTGCCAGAGCAGGTATGGATGCGGACTCCCACCCT ATCTGGAAGGCATACGATGTGTAATCTCATCCCGCCCCTAATAGCGATTG GCTTGTCTGGTTGC
quality values	Open. Hide. 6 6 6 6 8 15 30 59 39 33 32 30 28 28 37 23 23 25 28 28 30 48 48 35 30 28 28 28 36 47 47 47 48 48 48 57 57 57 42 42 36 36 36 42 59 68 68 51 51 47 47 51 51 68 68 68 50 51 50 50 48 48 54 48 48 57 57 57 68 68 68 57 54 57 57 57 53 51 50 50 50 50 68 68 68 68 68 68 68 68 68 50 51 42 42 42 47 59 59 59 57 57 50 50 50 53 50 50 53 53 53 53 48 43 39 35 31 25 17 10 10 9 10 9 10 10 19 30 41 50 50 50 50 53 53 53 57 53 53 57 53 53 53 53 50 50 50 53 59 57 57 57 54 68 68 68 47 47 42 42 47 47 50 50 50 50 50 57 53 53 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 50 47 47 47 47 47 50 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 27 27 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 3 12 17 14 14 17 8 3 0 3 8 8 10 8 9 10 10 10 11 3 0 0 3 9 9 9 9 9 3 0 0 0 0 0 0 0 3 12 13 21 21 21 21 9 12 9 9 7 6 8 8 12 22 19 19 21 22 18 12 8 8 6 8 9 3 0 0 0 0 0 0 0 3 0 0 3 3 0 0 0 0 0 0 0 0 3 8 9 13 3 0 3 13 13 19 23 18 16 16 15 18 11 11 11 12 14 13 11 11 10 23 14 13 12 13 13 8 8 8 10 10 16 8 9 10 13 16 18 16 15 9 9 9 9 6 7 7 6 6 7 8 8 8 11 8 8 8 13 8 10 12 12 14 14 11 11 10 8 12 11 10 9 9 13 8 10 9 10 12 12 10 10 9 10 9 9 9 10 17 9 11 10 10 12 12 9 9 10 10 9 10 12 14 12 10 9 11 10 12 12 10 13 13 11 16 13 15 21 19 12 13 10 12 20 16 18 8 8 6 6 6 8 11 10 13 13 12 12 11 11 11 16 15 15 11 11 11 18 13 13 14 14 14 14 12 13 9 8 8 8 10 9 9 9 9 10 10 10 10 11 9 9 9 8 8 6 6 8 10 12 9 9 8 8 8 8 8 6 6 8 7 8 11 10 20 13 16 16 10 9 9 10 17 16 24 20 14 14 22 12 13 9 12 9 11 8 8 8 9 8 8 8 8 10 8 12 10 8 8 8 10 10 8 8 8 9 10 10 8 12 13 8 8 8 11 10 10 10 8 6 6 6 7 7 8 10 8 8 8 8 8 8 6 6 8 8 8 9 9 14 12 13 13 11 13 13 13 10 11 11 12 11 11 11 11 10 10 8 8 8 8 8 10 8 11 10 8 10 10 8 10 8 11 8 8 8 8 13 10 12 9 9 10 8 9 9 8 8 8 8 8 8 10 10 10 9 8 9 10 11 8 8 8 14 7 9 10 10 11 15 27 24 11 11 13 16 13 12 16 16 16 16 10 10 7 7 8 8 11 18 19 21 22 22 22	Open. Hide. 6 8 8 6 6 8 19 21 35 32 32 39 43 43 53 53 53 57 57 53 53 53 53 53 57 59 59 59 59 57 57 57 57 54 48 42 37 42 42 48 42 59 59 59 59 54 50 50 50 50 50 50 54 54 54 57 57 57 42 42 36 36 41 48 57 68 68 50 50 50 50 68 50 50 50 50 51 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 54 54 57 59 52 57 52 50 50 59 59 68 68 68 68 68 59 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 41 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 59 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 44 44 48 48 42 43 42 54 54 57 68 68 68 57 57 59 59 59 59 59 59 59 57 57 57 57 57 57 59 59 59 59 59 59 59 59 41 36 23 20 20 11 12 12 11 11 11 15 15 25 17 15 13 11 8 8 8 8 8 8 12 12 16 15 12 21 30 59 48 57 57 57 57 57 59 59 57 57 57 57 57 57 57 57 57 57 53 50 50 50 44 44 31 31 20 20 20 24 28 37 37 37 32 29 29 24 21 16 12 12 12 13 15 16 9 11 11 23 25 39 59 59 41 32 32 32 39 39 39 35 37 37 47 47 57 57 57 57 59 59 59 59 59 50 50 54 54 68 68 68 68 68 68 68 68 59 59 57 68 57 57 54 54 59 59 59 68 68 68 68 59 59 59 59 59 59 59 59 57 48 48 46 57 57 57 48 48 48 48 57 37 37 37 39 39 40 36 47 41 59 41 34 32 38 39 39 41 46 40 40 43 37 39 47 39 39 47 57 48 48 39 39 39 40 40 43 43 59 35 43 39 43 43 37 37 30 30 30 28 28 23 28 31 37 33 33 40 30 32 30 37 37 43 37 43 32 37 30 37 34 29 25 18 17 15 15 20 24 26 32 23 25 31 31 28 30 30 37 37 32 29 31 39 37 28 28 28 31 31 30 31 31 32 28 28 20 20 20 20 22 18 18 18 18 19 19 19 22 30 20 22 25 30 24 19 19 22 16 15 22 13 9 8 8 8 8 8 15 9 9 9 12 12 11 11 11 16 11 10 9 9 9 14 14 22 22 22 30 27 14 14 9 9 10 9 11 12 12 12 16 8 8 8 8 12 8 10 9 8 8 8 6 10 8 8 8 8 19 19 25 23 19 12 13 9 8 13 10 8 8 8 8 8 8 8 9 9 9 9 10 10 15 13 10 11 13 12 9 17 11 14 14 12 14 13 15 10 10 8 8 8 8 9 9 12 12 9 12 10 8 8 8 11 8 9 9 9 9 10 11 11 19 14 16 16 16 16 16

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no295_m17.b1 MSMg01no295_m17.b1 CHROMAT_FILE:
MSMg01no295_m17.b1 PHD_FILE: MSMg01no295_m17.b1.phd.1 CHEM: term DYE:
big TIME: Tue May 17 21:31:49 2005
         (221 letters)



>mm_chr8_107812275_107812893
          Length = 619

 Score =  375 bits (194), Expect = e-108
 Identities = 209/214 (97%), Gaps = 2/214 (0%)
 Strand = Plus / Minus

                                                                       
Query: 5   gaattctggtaattacgtggaggtaggtggaatgaacgaagggaaaatggaagaactggc 64
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 gaattctggtaattacgtggaggtaggtggaatgaacgaagggaaaatggaagaactggc 357

                                                                       
Query: 65  ccatatagtggtcacgctagacatccagaaaagtatacagtttgagggtgaatgagatct 124
           |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 356 ccatatagtggtca-g-tagacatccagaaaagtatacagtttgagggtgaatgagatct 299

                                                                       
Query: 125 gagactagaagtcgttttttaagcagctgatcactaggtaaggtggaggaagactccgag 184
           ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 298 gagactagaagtcattttttaagcagccgatcactaggtaaggtggaggaagactccgag 239

                                             
Query: 185 gaggaggaggatgccggggtgggggtggggggag 218
            |||||||||||||||||||||||||||||||||
Sbjct: 238 aaggaggaggatgccggggtgggggtggggggag 205


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 8
Number of extensions: 2
Number of successful extensions: 2
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 221
Length of database: 619
Length adjustment: 9
Effective length of query: 212
Effective length of database: 610
Effective search space:   129320
Effective search space used:   129320
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information