MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	MSMg01-465K12
Chromosome	8 (Build37)
Map Location	123,605,342 - 123,605,587
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Zdhhc7, 6430548M08Rik, 1700120B06Rik, Gse1, 4833427B12Rik, LOC668301, 1190005I06Rik, Cox4nb, Cox4i1, Irf8, LOC100042333
Downstream gene	Foxf1a, Mthfsd, Foxc2, Foxl1, 1700018B08Rik, Fbxo31, Map1lc3b, Zcchc14, Jph3, Klhdc4, Slc7a5, BC048644, Car5a, Banp
Link	Open Mouse BAC browser

Click to get alignment info.

name	Zdhhc7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102193 MGI:2142662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430548M08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234797 MGI:2443793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700120B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436062 MGI:3588213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gse1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382034 MGI:1098275
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4833427B12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272551 MGI:1921019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	1190005I06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68918 MGI:1916168
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox4nb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18117 MGI:1343095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox4i1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12857 MGI:88473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15900 MGI:96395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Foxf1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15227 MGI:1347470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mthfsd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234814 MGI:2679252
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14234 MGI:1347481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14241 MGI:1347469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700018B08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76405 MGI:1923655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxo31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76454 MGI:1354708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Map1lc3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67443 MGI:1914693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:142682 MGI:2159407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jph3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57340 MGI:1891497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhdc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:234825 MGI:2384569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc7a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20539 MGI:1298205
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC048644 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407789 MGI:3039566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car5a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12352 MGI:101946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Banp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53325 MGI:1889023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054240 GeneID:102193 MGI:2142662
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 7 transcript_id : NM_133967.3

name	6430548M08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377690 GeneID:234797 MGI:2443793
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430548M08 gene transcript_id : NM_172286.3

name	1700120B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702174 GeneID:436062 MGI:3588213
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700120B06 gene transcript_id : NM_001033980.1

name	Gse1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46559413 GeneID:382034 MGI:1098275
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : genetic suppressor element 1 transcript_id : NM_198671.1

name	4833427B12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249059 GeneID:272551 MGI:1921019
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4833427B12 gene transcript_id : NM_178856.1

name	1190005I06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37574065 GeneID:68918 MGI:1916168
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1190005I06 gene transcript_id : NM_197988.1

name	Cox4nb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802224 GeneID:18117 MGI:1343095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : COX4 neighbor transcript_id : NM_010926.3

name	Cox4i1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111038139 GeneID:12857 MGI:88473
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase subunit IV isoform 1 transcript_id : NM_009941.2

name	Irf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130835 GeneID:15900 MGI:96395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon regulatory factor 8 transcript_id : NM_008320.3

name	LOC100042333 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259056 GeneID:100042333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Ubtf protein transcript_id : XM_001477969.1

name	Foxf1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753901 GeneID:15227 MGI:1347470
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box F1a transcript_id : NM_010426.1

name	Mthfsd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372291 GeneID:234814 MGI:2679252
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methenyltetrahydrofolate synthetase domain containing transcript_id : NM_172761.2

name	Foxc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8850212 GeneID:14234 MGI:1347481
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box C2 transcript_id : NM_013519.1

name	Foxl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120952617 GeneID:14241 MGI:1347469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box L1 transcript_id : NM_008024.2

name	1700018B08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313189 GeneID:76405 MGI:1923655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700018B08 gene transcript_id : NM_029597.1

name	Fbxo31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981580 GeneID:76454 MGI:1354708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box protein 31 transcript_id : NM_133765.2

name	Map1lc3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801716 GeneID:67443 MGI:1914693
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 1 light chain 3 beta transcript_id : NM_026160.2

name	Zcchc14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18252797 GeneID:142682 MGI:2159407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 14 transcript_id : NM_080855.1

name	Jph3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130503 GeneID:57340 MGI:1891497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : junctophilin 3 transcript_id : NM_020605.2

name	Klhdc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704209 GeneID:234825 MGI:2384569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch domain containing 4 transcript_id : NM_145605.1

name	Slc7a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982763 GeneID:20539 MGI:1298205
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 transcript_id : NM_011404.2

name	BC048644 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803107 GeneID:407789 MGI:3039566
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC048644 transcript_id : NM_001033485.2

name	Car5a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181174 GeneID:12352 MGI:101946
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5a, mitochondrial transcript_id : NM_007608.2

name	Banp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248563 GeneID:53325 MGI:1889023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Btg3 associated nuclear protein transcript_id : NM_016812.2

name	Zdhhc7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527186 CCDS:CCDS22715.1 GeneID:102193 MGI:2142662
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016409 - palmitoyltransferase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0018345 - protein palmitoylation [Evidence IDA] codon_start : 1 note : GABA-A receptor-associated membrane protein 2 product : zinc finger, DHHC domain containing 7 protein_id : NP_598728.1

name	6430548M08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982038 CCDS:CCDS22716.1 GeneID:234797 MGI:2443793
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC234797 protein_id : NP_758490.2

name	1700120B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702175 CCDS:CCDS22717.1 GeneID:436062 MGI:3588213
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC436062 protein_id : NP_001029152.1

name	Gse1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559414 GeneID:382034 MGI:1098275
definition	codon_start : 1 product : genetic suppressor element 1 protein_id : NP_941073.1

name	4833427B12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249060 GeneID:272551 MGI:1921019
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006260 - DNA replication [Evidence IEA] codon_start : 1 product : DNA replication complex GINS protein PSF2 protein_id : NP_849187.1

name	1190005I06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37574066 GeneID:68918 MGI:1916168
definition	codon_start : 1 product : RIKEN cDNA 1190005I06 protein_id : NP_932105.1

name	Cox4nb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754870 CCDS:CCDS22719.1 GeneID:18117 MGI:1343095
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence IEA] codon_start : 1 product : neighbor of Cox4 protein_id : NP_035056.1

name	Cox4i1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753498 GeneID:12857 MGI:88473
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : cytochrome c oxidase, subunit IVa product : cytochrome c oxidase subunit IV isoform 1 protein_id : NP_034071.1

name	Irf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680339 CCDS:CCDS22721.1 GeneID:15900 MGI:96395
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0006955 - immune response [Evidence IMP]; GO:0030099 - myeloid cell differentiation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : interferon consensus sequence binding protein 1 protein_id : NP_032346.1

name	LOC100042333 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259057 GeneID:100042333
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478019.1

name	Foxf1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753902 CCDS:CCDS22722.1 GeneID:15227 MGI:1347470
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0048566 - embryonic gut development [Evidence IGI]; GO:0045198 - establishment of epithelial cell polarity [Evidence IGI]; GO:0030198 - extracellular matrix organization and biogenesis [Evidence IGI]; GO:0030324 - lung development [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 note : HNF-3/forkhead homolog 8 product : forkhead box F1a protein_id : NP_034556.1

name	Mthfsd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370130 CCDS:CCDS22723.1 GeneID:234814 MGI:2679252
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : methenyltetrahydrofolate synthetase domain containing protein_id : NP_766349.1

name	Foxc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8850213 GeneID:14234 MGI:1347481
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] [Evidence IC]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0048468 - cell development [Evidence IMP]; GO:0007275 - development [Evidence IEA]; GO:0007507 - heart development [Evidence IGI]; GO:0001656 - metanephros development [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IGI]; GO:0045893 - positive regulation of transcription, DNA-dependent [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : forkhead homolog 14 product : forkhead box C2 protein_id : NP_038547.1

name	Foxl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120952618 GeneID:14241 MGI:1347469
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] GO_process : GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0030166 - proteoglycan biosynthesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence TAS]; GO:0030111 - regulation of Wnt receptor signaling pathway [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0007495 - visceral mesoderm-endoderm interaction [Evidence IMP] codon_start : 1 note : forkhead homolog 6 product : forkhead box L1 protein_id : NP_032050.2

name	1700018B08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313190 GeneID:76405 MGI:1923655
definition	codon_start : 1 product : hypothetical protein LOC76405 protein_id : NP_083873.1

name	Fbxo31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981581 GeneID:76454 MGI:1354708
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : F-box only protein 14 product : F-box only protein 31 protein_id : NP_598526.2

name	Map1lc3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385664 CCDS:CCDS22726.1 GeneID:67443 MGI:1914693
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006914 - autophagy [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : microtubule-associated protein 1 light chain 3 beta protein_id : NP_080436.1

name	Zcchc14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18252798 CCDS:CCDS22727.1 GeneID:142682 MGI:2159407
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : BDG-29 protein protein_id : NP_543131.1

name	Jph3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181142 CCDS:CCDS22728.1 GeneID:57340 MGI:1891497
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IDA] GO_process : GO:0040011 - locomotion [Evidence IMP] codon_start : 1 note : junctophilin type 3 product : junctophilin 3 protein_id : NP_065630.1

name	Klhdc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704210 CCDS:CCDS22729.1 GeneID:234825 MGI:2384569
definition	codon_start : 1 exception : mismatches in translation product : kelch domain containing 4 protein_id : NP_663580.1

name	Slc7a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982764 CCDS:CCDS22730.1 GeneID:20539 MGI:1298205
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015359 - amino acid permease activity [Evidence IEA]; GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005279 - amino acid-polyamine transporter activity [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0015179 - L-amino acid transporter activity [Evidence IDA] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0015807 - L-amino acid transport [Evidence IDA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 5 protein_id : NP_035534.2

name	Car5a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181175 CCDS:CCDS22731.1 GeneID:12352 MGI:101946
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006094 - gluconeogenesis [Evidence TAS]; GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 note : carbonic anhydrase 5, mitochondrial; carbonic anhydrase 5b, mitochondrial product : carbonic anhydrase 5a, mitochondrial protein_id : NP_031634.2

name	BC048644 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702019 GeneID:407789 MGI:3039566
definition	codon_start : 1 product : hypothetical protein LOC407789 protein_id : NP_001028657.1

name	Banp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248564 GeneID:53325 MGI:1889023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : Btg3 associated nuclear protein protein_id : NP_058092.2

name	LOC668301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668301
definition	number : 2 pseudo : _no_value

name	LOC668301 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668301
definition	number : 1 pseudo : _no_value

clone name	MSMg01-131E04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-274L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325I13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329L21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-516F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-381E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408F23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505P14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449A17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-216K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342N17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465E01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067J18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326M14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008N10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263K07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	MSMg01-465K12.T7 (MSMg01no465_k12.b1)	MSMg01-465K12.TJ (MSMg01no465_k12.g1)
ACC	AG549785	AG549786
length	741	1,398
length of high quality (start - end)	246 (64 - 309)	---
definition	CHROMAT_FILE: MSMg01no465_k12.b1 PHD_FILE: MSMg01no465_k12.b1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:40:51 2005	CHROMAT_FILE: MSMg01no465_k12.g1 PHD_FILE: MSMg01no465_k12.g1.phd.1 CHEM: term DYE: big TIME: Wed May 18 19:40:51 2005
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	TTGCGGCCGCAAAACGACTCACATTTCAAAGAGGATCCGCGGAATTCCCA CTTTTCAAAGAAGAGAGAGATGGAAGTGGGTACCCAAGAGGGTAGGAACC CTGAAAGTCTATACCTTGGATGACCCTCTACAGTTATAAAGCAATGAGGG TTTGGGGGAGTTGCCTATGTGTCTCAAAACAGCTCGCAGACACTTTGAGA TCTCTCTGAATCCCACATTTTTAAAGAGGAGAAACGGAGGTTCTGTCACA GGGCTCTATCAGTGGCTTCCCTTGCTGGACGAGTCTCCTGGCCCCATAAA CTATCTCCATCCTANTCTTTTATAAAGTGTCAACTGAAACTGGGGCGGGA GGGGGTGGGAGGAAGCCAAGCTCTTGGTCATTTTGTGTAACTAGGATGAG ACTGACTTCAGGAGCAGGGTCATCATGCCTCCCTCCTAAGAGGCCGCGGG GACCGCTTCCCACCCCCCACCCCCCCATATTTCAGTGTAGGATCACTCAC AAGTCTGGATGGTCCCAGCCTAGACCATTTTGCATGGAGTCTAGTTTCTC CCTTTAGACGCGGCTCCAACTAAAGTTCCCACTTCCTACGGTTGTGGCAG CACTGAGCTGGTACGGATGTCTCATAAAAGTCCCCCGGGGGAGCTTTTTT TTTGATCTAGTTCCTGCGCCCATAGGGCGGAACCTGTTCTTTCCTGTAAC TCTCCTGAACTTCTTTCTCATTTCTATTTTTTTTCTTCCCG	AAGACGGCAATAACACNNCGGGTCCTAGNTGCTTACTGTTACTTCATCAT ANTAACGGAGAAGGAGAAGNGTTCNTCTGATGACGAATAATTCGATACCA TACATAAACATAGACAAACAACACCAACACACCGAAGGAATACTCATAGT GTAGCGTATGCCGACCGAGGCACGCGCAACTGAGGCGTGACCACGAGGTA TATTGCGACGCGGCGCCCCCAGGGAGCCTGCAAGCCGGAGCGAATTCCCA AGATCACACATTATCTACATTCATTATCACCGANCCCCACCTCGCGATAT ACTATACACTCGCGGCAAGACAGAGAGGCGCGGCTATTAAGCACAACCGC CACAATTCCACTAACCNATCAATCACAAGATACAGATCACCACGCGGTCA GACTATTAAAATAAAATAACGAGACGGGATGATCGACGAGGGCATAGAAC AGACGAAACACATAAGAGGAAGAAGAGACGGGGAGCGAAAATAAATAAAA ATATATAGAATTAAGTGAAAAGATAATAGCAATGAATGAAAGGCAAGACG ACAGTACACCCATTATAATACATAGATTACCATAACTGAGCCAGAGAATT ATAACTCAGTCCTCGCTCACACAAACTCACACTATATATAATATTTCCAC ACTATTTATCGCAAAGAGGATGCATAATGTATGAGATTGTGACGTGAGAC ATAGTATACATAACAGCGCAGCGCATATTTATTCTAGATAGAAACGAAGA TAGCGCAACGAGTGAACGGGGGAGCGAGGAGGAAACGCAGGCAACGAATA AGATGAAAACGTGCGGACAAAGGGAAATATAACAAGACACAAGTAGAAAG AGAGAATGAGAATACAGAATAGNGGACACACGCGCCGAAAGACAGGTATG TATCGGTAACCGATATCGAAGATAAATAACGTCCAATCACAATAATTAGC ACCCAAGGAGAATAATCTGACTGGGTGCGCACGCTTACAGCCTATCACAC GGACGCTCGCAGACACACTAAAAAAGTGCATGAGGGATACGCAATGCAGA ACCGCGATATAAAAACAGAAGAGACTAGAGAAGAACATGAGACACGCACA CACGACGACAGGCGACGAAACACAATGCAAACGAGAAATAACCGAGTGAT AGAGATAAAGCGAGACAGCCGTCAAGACNCATACACAAACAGATGGATGC TGATCCTCACCCACACACTACCGACAAATTTATTGACGCATAATAGATCC GGAATGAAACGAGCACGGAGAGAGACGGAAAGCATAGTAACGAATACTAT ACATATAGAAGACAACAACCGNCGGCGGCACGTATATAACACAAAACTCT NCTNGACGTGGCCTCACACTGACGATAACGAGTACAACATTACAATCG
quality values	Open. Hide. 16 19 19 19 19 10 10 8 13 8 8 8 9 13 19 23 22 15 9 15 9 8 6 6 7 7 9 7 9 9 11 12 15 10 10 10 10 15 18 28 35 29 23 22 32 32 37 27 25 11 11 11 12 8 8 6 6 6 6 6 6 6 10 12 19 37 46 33 30 24 24 22 35 36 36 36 36 36 42 43 53 47 47 47 47 48 48 48 57 57 57 57 57 68 68 68 68 54 68 57 50 57 57 44 28 23 15 15 20 27 34 17 14 14 14 27 27 47 47 57 57 57 57 54 47 57 57 57 50 50 57 57 57 57 57 57 57 57 57 57 68 68 68 68 68 68 57 57 57 57 50 57 57 50 48 57 57 57 57 57 52 52 52 57 57 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 68 57 57 57 57 57 54 57 57 57 59 57 57 57 50 51 50 68 68 68 68 59 59 59 57 54 57 57 57 57 68 68 68 68 68 68 68 68 68 68 68 68 59 59 57 57 54 59 57 57 57 57 57 57 59 59 34 34 15 12 12 11 15 18 19 42 44 57 57 57 57 57 57 68 68 68 68 59 59 48 48 48 59 59 59 59 68 68 59 59 59 57 57 54 54 54 53 53 53 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 50 50 50 50 50 47 37 34 23 15 11 11 9 9 9 9 3 0 3 9 12 27 28 47 47 50 50 50 50 50 50 57 57 48 43 43 43 47 47 43 44 57 57 57 57 48 59 59 59 41 24 15 14 28 18 25 28 33 36 39 35 35 37 47 47 48 57 48 48 48 48 48 48 48 48 59 59 44 42 30 44 42 57 44 59 47 47 43 57 57 57 57 57 44 44 44 48 57 57 57 57 50 48 48 50 50 57 57 59 59 59 54 54 54 57 57 57 57 57 50 43 43 37 37 43 59 57 57 57 59 59 59 59 57 57 57 59 57 57 44 42 27 27 20 32 31 57 46 48 47 44 43 41 38 38 24 28 30 30 30 44 44 44 41 30 30 25 32 12 12 12 12 12 12 15 15 20 32 32 43 43 43 43 43 34 34 23 20 16 19 17 11 11 11 15 22 26 28 28 32 20 20 20 28 28 37 30 32 23 23 19 26 19 21 17 11 12 20 20 13 12 11 11 17 11 11 12 21 15 28 28 27 22 17 11 11 11 22 19 24 14 12 9 9 9 11 21 22 30 28 26 20 18 20 23 32 23 15 8 8 8 15 19 30 18 14 18 12 21 12 12 11 11 11 23 19 19 10 10 10 15 17 20 25 28 22 13 9 8 8 8 10 15 19 26 24 21 21 15 12 12 11 11 12 9 9 10 17 12 14 21 12 10 10 10 10 16 24 28 18 18 12 12 8 8 8 8 8 8 8 8 10 10 24 23 20 23 28 24 20 13 16 16 15 12 12 12 15 11 11 12 22 26 13 11 6 6 6 6 6 6 8 8 10 10 11 10 11 6 6 8 10 13 8 8 8 10 8 8 8 8 8 8 11 10 10 11 11 11 9 19 13 15 15 11 16 11 11 10 10 10 10 9 10 16 10 10 9 9 9 10 12 13 16 19 8 8 8 8 8 8 8 10 10 10 10 10 8 8 8 10 8 9 12 12 13 15 8 8 8 8 8 6 6	Open. Hide. 7 7 6 6 6 6 8 6 7 6 6 6 6 6 7 3 0 0 3 6 6 6 6 6 6 8 8 3 0 3 9 8 6 6 8 6 6 8 8 6 8 8 8 8 8 8 8 10 11 11 3 0 3 6 6 6 8 11 12 12 11 10 10 9 9 10 8 6 3 0 3 8 6 3 0 3 11 10 14 8 6 6 6 6 6 6 11 8 8 8 8 8 10 8 8 11 11 8 11 11 11 9 13 13 14 11 8 9 8 8 8 8 8 8 8 6 8 6 6 6 6 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 8 10 10 10 10 12 9 8 8 8 8 8 8 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 6 8 8 10 11 12 12 11 8 8 8 8 8 10 10 8 8 10 6 6 6 6 8 8 8 8 6 8 6 6 6 6 6 6 8 8 9 8 8 8 8 10 8 8 11 10 12 10 10 9 6 6 6 6 6 6 8 8 6 6 10 8 6 6 6 6 10 8 8 10 8 8 8 8 9 9 9 9 9 8 8 8 8 8 10 7 6 6 6 8 8 8 8 8 8 10 10 8 10 6 6 6 6 6 8 10 9 8 8 8 6 3 0 3 6 8 8 8 8 9 9 9 8 8 8 8 8 8 8 8 8 10 10 8 6 6 7 7 8 8 8 8 8 8 8 8 8 10 8 8 6 6 6 6 8 13 10 8 8 8 8 8 8 8 9 9 9 10 10 11 15 11 8 8 8 8 8 8 6 6 6 6 10 8 9 9 10 10 8 8 8 6 6 6 3 0 3 8 8 8 8 10 8 8 8 8 8 9 10 10 8 8 8 8 8 8 8 6 6 6 6 8 8 8 8 9 6 6 6 6 6 6 11 6 6 6 6 8 8 8 8 8 10 8 11 11 10 10 10 10 8 10 6 6 8 10 10 10 8 10 8 8 8 8 8 6 6 8 8 9 9 9 9 9 9 10 8 7 6 8 11 8 10 10 9 12 8 8 6 6 6 6 6 8 8 6 8 6 6 10 8 8 6 6 10 8 6 6 6 8 8 12 8 8 8 8 7 9 9 9 7 7 6 7 7 8 7 18 13 8 8 8 8 8 8 9 8 8 6 6 6 6 10 6 6 6 6 12 12 12 12 10 11 11 9 9 9 8 8 8 8 8 8 8 8 8 10 10 19 17 17 16 10 8 8 8 8 8 8 8 8 8 8 8 8 8 11 11 11 11 8 8 6 6 8 8 9 11 10 9 6 6 6 7 8 8 8 8 8 8 8 10 10 10 8 8 8 8 8 8 7 7 8 8 8 8 6 6 6 6 8 8 6 6 8 10 8 6 6 6 8 8 8 8 8 8 8 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 7 8 7 9 12 10 15 13 11 11 11 12 10 10 8 8 8 8 10 12 10 10 8 8 8 8 8 8 8 8 8 8 8 8 8 9 6 6 6 6 6 6 7 8 8 8 8 8 11 8 8 8 8 8 8 8 8 8 8 6 6 8 8 8 10 13 10 8 8 7 9 6 6 6 6 8 8 9 8 8 6 6 6 6 10 8 10 10 8 6 6 6 6 8 11 11 11 8 8 8 8 8 8 8 8 8 8 8 9 8 8 8 9 8 8 8 8 6 6 6 8 8 8 8 8 9 8 8 8 8 8 8 8 8 8 8 8 12 10 8 10 8 8 8 6 7 6 9 8 8 8 8 8 10 8 8 8 9 10 10 10 10 8 8 8 10 8 8 10 10 10 10 10 9 9 9 9 11 16 13 10 8 8 8 13 13 10 10 8 8 8 8 8 8 9 8 8 8 8 9 8 9 8 8 8 8 8 6 6 6 6 8 6 7 8 8 8 8 8 8 6 6 10 11 12 6 6 6 7 8 8 8 7 6 8 3 0 3 10 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 8 9 9 8 8 7 7 6 6 6 6 6 6 10 7 6 8 8 10 8 8 8 8 8 8 7 7 8 8 9 9 10 12 7 6 8 8 6 6 6 8 6 6 6 6 8 8 8 8 8 8 10 11 13 10 8 8 8 8 8 10 9 9 9 9 9 10 10 8 8 8 8 8 8 9 10 10 8 8 6 6 8 6 6 6 6 8 8 8 8 9 9 9 8 10 6 7 8 10 8 9 6 8 6 6 8 8 8 8 8 8 8 10 6 6 8 8 8 8 6 6 6 6 8 8 6 6 8 8 10 10 9 10 10 10 9 9 8 8 8 8 8 8 6 6 6 6 6 6 6 6 6 6 8 8 8 9 10 13 11 10 9 10 9 8 8 8 8 8 8 6 8 6 6 8 8 12 8 8 8 8 8 8 8 8 8 8 8 12 10 9 8 8 8 10 10 10 10 10 10 8 10 10 8 8 6 6 6 6 6 6 8 6 6 6 6 6 8 8 8 8 8 8 8 8 8 8 8 8 8 8 11 8 8 6 6 6 11 6 6 8 6 6 6 8 8 8 8 8 8 6 6 6 7 8 10 8 8 8 11 11 10 8 8 8 10 10 10 8 8 14 8 6 6 6 6 6 10 9 9 9 8 8 6 6 3 0 3 6 6 6 6 8 6 8 8 6 10 8 8 8 8 8 8 8 10 8 8 6 6 8 8 9 9 9 10 15 8 8 8 6 10 6 6 6 6 8 6 6 8 6 8 10 8 8 8 8 8 13 8 8 8 6 6 8 8 10 11 11 11 11 11 11 11 12 11 12 12 14 10 10 10 10 10 11 9 7 6 8 8 8 6 6 6 6 6 6 8 9 12 8 8 12 13 10 10 10 12 8 10 10 10 10 10 11 11 10 11 15 11 10 10 10 6 6 6 6 8 6 8 8 12 6 9 9 7 7 6 6 6 8 8 6 6 7 6 6 6 3 0 3 8 10 8 8 8 8 10 10 8 8 8 8 8 8 8 8 8 9 9 10 12 10 7 6 8 6 3 0 3 3 0 3 6 8 6 8 10 8 9 8 8 8 8 8 8 8 8 8 8 8 9 12 12 12 13 10 8 6 6 6 6 7 7 8 8 6 8 8 8 11 8 9 9 10 10

Alignment Information

BAC End 1

BAC End 2

Query= MSMg01no465_k12.b1 MSMg01no465_k12.b1 CHROMAT_FILE:
MSMg01no465_k12.b1 PHD_FILE: MSMg01no465_k12.b1.phd.1 CHEM: term DYE:
big TIME: Wed May 18 19:40:51 2005
         (246 letters)



>mm_chr8_123605142_123605787
          Length = 646

 Score =  429 bits (222), Expect = e-125
 Identities = 240/246 (97%)
 Strand = Plus / Minus

                                                                       
Query: 1   agagagatggaagtgggtacccaagagggtaggaaccctgaaagtctataccttggatga 60
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 446 agagagatggaagtgggtacccaagagggtaggaaccctgaaagcctatagcttggatga 387

                                                                       
Query: 61  ccctctacagttataaagcaatgagggtttgggggagttgcctatgtgtctcaaaacagc 120
           ||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||
Sbjct: 386 ccctctacagttataaagcaatgagggttggggggagttgcctatgtgtctcgaaacagc 327

                                                                       
Query: 121 tcgcagacactttgagatctctctgaatcccacatttttaaagaggagaaacggaggttc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 326 tcgcagacactttgagatctctctgaatcccacatttttaaagaggagaaacggaggttc 267

                                                                       
Query: 181 tgtcacagggctctatcagtggcttcccttgctggacgagtctcctggccccataaacta 240
            |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 266 agtcatagggctctatcagtggcttcccttgctggacgagtctcctggccccataaacta 207

                 
Query: 241 tctcca 246
           ||||||
Sbjct: 206 tctcca 201


Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.34    0.600     1.10 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 2, Extension: 1
Number of Sequences: 1
Number of Hits to DB: 10
Number of extensions: 2
Number of successful extensions: 1
Number of sequences better than 10.0: 1
Number of HSP's gapped: 1
Number of HSP's successfully gapped: 1
Length of query: 246
Length of database: 646
Length adjustment: 9
Effective length of query: 237
Effective length of database: 637
Effective search space:   150969
Effective search space used:   150969
X1: 7 (13.9 bits)
X2: 517 (999.5 bits)
X3: 517 (999.5 bits)
S1: 7 (14.4 bits)
S2: 7 (14.3 bits)

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information