MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-068M19
Chromosome	9 (Build37)
Map Location	110,256,684 - 110,256,727
singlet/doublet	singlet
Overlap gene	Scap
Upstream gene	EG382156, Fbxw16, Fbxw19, LOC635668, Fbxw15, EG382106, E330001B16Rik, C85627, EG382109, 1700124P09Rik, Spink8, 3000002C10Rik, Nme6, Camp, Cdc25a, LOC100043782, Mtap4, LOC100049540, Dhx30, Smarcc1, Rn4.5s-ps2, Cspg5, Tmem103
Downstream gene	Ptpn23, Ngp, Klhl18, Kif9, Setd2, Nradd, Nbeal2, Ccdc12, Pthr1, Myl3, 9430025E04Rik, LOC665549, Tessp2, 1700036D21Rik, Tessp3, BC107230, 1700112C13Rik, Tsp50, Tmie, Als2cl, Gm590, Tdgf1, Lrrc2, Rtp3, ENSMUSG00000057802, Ltf, Ccrl2, LOC100039275, Lrrfip2, Mlh1, Epm2aip1, Lba1
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG382156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382156 MGI:3643290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 13 Proteins

name	Fbxw16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320083 MGI:2443324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fbxw19 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235612 MGI:3505706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC635668 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	Fbxw15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382105 MGI:3505701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382106 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382106 MGI:3646659
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330001B16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546160 MGI:3588266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 9 Proteins

name	C85627 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546161 MGI:3034520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG382109 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382109 MGI:3646662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700124P09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 15 Proteins

name	Spink8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78709 MGI:1925959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3000002C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:378954 MGI:3036226
definition	note : RIKEN cDNA 3000002C10 gene pseudo : _no_value

name	Nme6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54369 MGI:1861676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12796 MGI:108443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cdc25a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12530 MGI:103198
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Mtap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17758 MGI:97178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100049540 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100049540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 ESTs, 13 Proteins pseudo : _no_value

name	Dhx30 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72831 MGI:1920081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smarcc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20588 MGI:1203524
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rn4.5s-ps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19801 MGI:97948
definition	note : 4.5s RNA, pseudogene 2 pseudo : _no_value

name	Cspg5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:29873 MGI:1352747
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem103 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72341 MGI:1919349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 43 ESTs, 3 Proteins

name	Scap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235623 MGI:2135958
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ptpn23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104831 MGI:2144837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18054 MGI:105983
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270201 MGI:2143315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16578 MGI:1098237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Setd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235626 MGI:1918177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nradd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67169 MGI:1914419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nbeal2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235627 MGI:2448554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 83 ESTs, 3 Proteins

name	Ccdc12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72654 MGI:1919904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pthr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19228 MGI:97801
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Myl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17897 MGI:97268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	9430025E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:442818 MGI:3045282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC665549 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665549
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Tessp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235628 MGI:2665280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700036D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73336 MGI:1920586
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tessp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272643 MGI:2684822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC107230 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:260408 MGI:3605764
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700112C13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74306 MGI:1921556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsp50 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235631 MGI:2447303
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmie (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20776 MGI:2159400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Als2cl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235633 MGI:2447532
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm590 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235634 MGI:2685436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Tdgf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21667 MGI:98658
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrrc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74249 MGI:1921499
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rtp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235636 MGI:2446841
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ENSMUSG00000057802 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:791282 MGI:3641798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Ltf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17002 MGI:96837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccrl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54199 MGI:1920904
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Lrrfip2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71268 MGI:1918518
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mlh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17350 MGI:101938
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Epm2aip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77781 MGI:1925031
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lba1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320429 MGI:1341834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 3 Proteins

name	EG382156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386617 GeneID:382156 MGI:3643290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 12 Proteins product : predicted gene, EG382156, transcript variant 2 transcript_id : XM_001005209.1

name	EG382156 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260370 GeneID:382156 MGI:3643290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 2 Proteins product : predicted gene, EG382156 transcript_id : XM_001481011.1

name	Fbxw16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032047 GeneID:320083 MGI:2443324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 16 transcript_id : NM_177070.3

name	Fbxw19 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382879 GeneID:235612 MGI:3505706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 19 transcript_id : NM_177703.3

name	LOC635668 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260325 GeneID:635668
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Fbxw16 protein transcript_id : XM_001472183.1

name	Fbxw15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115299772 GeneID:382105 MGI:3505701
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and WD-40 domain protein 15 transcript_id : NM_199036.2

name	EG382106 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381410 GeneID:382106 MGI:3646659
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG382106 transcript_id : NM_001013776.2

name	C85627 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702118 GeneID:546161 MGI:3034520
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C85627 transcript_id : NM_001033794.1

name	EG382109 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130897 GeneID:382109 MGI:3646662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG382109 transcript_id : NM_198674.2

name	1700124P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260377 GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 1 Protein product : RIKEN cDNA 1700124P09 gene, transcript variant 3 transcript_id : XM_001481022.1

name	1700124P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260375 GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 2 Proteins product : RIKEN cDNA 1700124P09 gene, transcript variant 2 transcript_id : XM_001481021.1

name	1700124P09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260373 GeneID:76998 MGI:1924248
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 ESTs, 13 Proteins product : RIKEN cDNA 1700124P09 gene, transcript variant 1 transcript_id : XM_001481019.1

name	Spink8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114145595 GeneID:78709 MGI:1925959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine peptidase inhibitor, Kazal type 8 transcript_id : NM_183136.2

name	Nme6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055289 GeneID:54369 MGI:1861676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed in non-metastatic cells 6, protein transcript_id : NM_018757.1

name	Camp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753471 GeneID:12796 MGI:108443
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cathelicidin antimicrobial peptide transcript_id : NM_009921.1

name	Cdc25a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92373435 GeneID:12530 MGI:103198
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cell division cycle 25 homolog A (S. pombe) transcript_id : NM_007658.3

name	Mtap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7106362 GeneID:17758 MGI:97178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microtubule-associated protein 4 transcript_id : NM_008633.1

name	Dhx30 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19111155 GeneID:72831 MGI:1920081
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAH (Asp-Glu-Ala-His) box polypeptide 30 transcript_id : NM_133347.1

name	Smarcc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421096 GeneID:20588 MGI:1203524
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 transcript_id : NM_009211.2

name	Cspg5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328223 GeneID:29873 MGI:1352747
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chondroitin sulfate proteoglycan 5 transcript_id : NM_013884.2

name	Tmem103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386623 GeneID:72341 MGI:1919349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 43 ESTs, 2 Proteins product : transmembrane protein 103, transcript variant 2 transcript_id : XM_895137.2

name	Tmem103 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386624 GeneID:72341 MGI:1919349
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 25 ESTs, 2 Proteins product : transmembrane protein 103, transcript variant 1 transcript_id : XM_135177.7

name	Scap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47564087 GeneID:235623 MGI:2135958
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SREBF chaperone transcript_id : NM_001001144.1

name	Ptpn23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517677 GeneID:104831 MGI:2144837
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase, non-receptor type 23 transcript_id : NM_001081043.1

name	Ngp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679053 GeneID:18054 MGI:105983
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neutrophilic granule protein transcript_id : NM_008694.1

name	Klhl18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517681 GeneID:270201 MGI:2143315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 18 (Drosophila) transcript_id : NM_177771.5

name	Kif9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374447 GeneID:16578 MGI:1098237
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 9 transcript_id : NM_010628.2

name	Setd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486750 GeneID:235626 MGI:1918177
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SET domain containing 2 transcript_id : NM_001081340.1

name	Nradd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47271512 GeneID:67169 MGI:1914419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neurotrophin receptor associated death domain transcript_id : NM_026012.2

name	Nbeal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260327 GeneID:235627 MGI:2448554
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 83 ESTs, 3 Proteins product : neurobeachin-like 2 transcript_id : XM_977572.2

name	Ccdc12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802309 GeneID:72654 MGI:1919904
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 12 transcript_id : NM_028312.2

name	Pthr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755221 GeneID:19228 MGI:97801
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : parathyroid hormone receptor 1 transcript_id : NM_011199.1

name	Myl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383792 GeneID:17897 MGI:97268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin, light polypeptide 3 transcript_id : NM_010859.2

name	9430025E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260380 GeneID:442818 MGI:3045282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9430025E04 gene transcript_id : XM_001481053.1

name	Tessp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346526 GeneID:235628 MGI:2665280
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis serine protease 2 transcript_id : NM_153099.1

name	1700036D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625927 GeneID:73336 MGI:1920586
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700036D21 gene transcript_id : NM_148940.2

name	Tessp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054965 GeneID:272643 MGI:2684822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis serine protease 3 transcript_id : NM_199471.1

name	BC107230 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346625 GeneID:260408 MGI:3605764
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC107230 transcript_id : NM_153172.1

name	1700112C13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130713 GeneID:74306 MGI:1921556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700112C13 gene transcript_id : NM_183103.2

name	Tsp50 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802008 GeneID:235631 MGI:2447303
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testes-specific protease 50 transcript_id : NM_146227.3

name	Tmie (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130173 GeneID:20776 MGI:2159400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane inner ear transcript_id : NM_146260.2

name	Als2cl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53749673 GeneID:235633 MGI:2447532
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ALS2 C-terminal like transcript_id : NM_146228.3

name	Gm590 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386579 GeneID:235634 MGI:2685436
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : gene model 590, (NCBI) transcript_id : XM_150244.3

name	Tdgf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053944 GeneID:21667 MGI:98658
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : teratocarcinoma-derived growth factor transcript_id : NM_011562.2

name	Lrrc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037352 GeneID:74249 MGI:1921499
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat containing 2 transcript_id : NM_028838.1

name	Rtp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346528 GeneID:235636 MGI:2446841
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : receptor transporter protein 3 transcript_id : NM_153100.1

name	ENSMUSG00000057802 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260329 GeneID:791282 MGI:3641798
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, ENSMUSG00000057802 transcript_id : XM_001472570.1

name	Ltf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803548 GeneID:17002 MGI:96837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lactotransferrin transcript_id : NM_008522.3

name	Ccrl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370308 GeneID:54199 MGI:1920904
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor-like 2 transcript_id : NM_017466.4

name	Lrrfip2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803187 GeneID:71268 MGI:1918518
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine rich repeat (in FLII) interacting protein 2 transcript_id : NM_027742.2

name	Mlh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19387851 GeneID:17350 MGI:101938
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mutL homolog 1 (E. coli) transcript_id : NM_026810.1

name	Epm2aip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802070 GeneID:77781 MGI:1925031
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EPM2A (laforin) interacting protein 1 transcript_id : NM_175266.3

name	Lba1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260382 GeneID:320429 MGI:1341834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 3 Proteins product : lupus brain antigen 1 transcript_id : XM_001481067.1

name	EG382156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260371 GeneID:382156 MGI:3643290
definition	codon_start : 1 product : hypothetical protein LOC382156 protein_id : XP_001481061.1

name	EG382156 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386618 GeneID:382156 MGI:3643290
definition	codon_start : 1 product : hypothetical protein LOC382156 isoform 2 protein_id : XP_001005209.1

name	Fbxw16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032048 GeneID:320083 MGI:2443324
definition	codon_start : 1 product : F-box and WD-40 domain protein 16 protein_id : NP_796044.2

name	Fbxw19 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244158 CCDS:CCDS23552.1 GeneID:235612 MGI:3505706
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 19 protein_id : NP_808371.1

name	LOC635668 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260326 GeneID:635668
definition	codon_start : 1 product : similar to Fbxw16 protein protein_id : XP_001472233.1

name	Fbxw15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115299773 CCDS:CCDS23553.1 GeneID:382105 MGI:3505701
definition	GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and WD-40 domain protein 15 protein_id : NP_950201.2

name	EG382106 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62945398 GeneID:382106 MGI:3646659
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC382106 protein_id : NP_001013798.1

name	C85627 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702119 GeneID:546161 MGI:3034520
definition	codon_start : 1 product : hypothetical protein LOC546161 protein_id : NP_001028966.1

name	EG382109 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348578 GeneID:382109 MGI:3646662
definition	codon_start : 1 product : hypothetical protein LOC382109 protein_id : NP_941076.1

name	1700124P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260378 GeneID:76998 MGI:1924248
definition	codon_start : 1 product : hypothetical protein LOC76998 isoform 3 protein_id : XP_001481072.1

name	1700124P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260376 GeneID:76998 MGI:1924248
definition	codon_start : 1 product : hypothetical protein LOC76998 isoform 2 protein_id : XP_001481071.1

name	1700124P09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260374 GeneID:76998 MGI:1924248
definition	codon_start : 1 product : hypothetical protein LOC76998 isoform 1 protein_id : XP_001481069.1

name	Spink8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114145596 GeneID:78709 MGI:1925959
definition	codon_start : 1 product : serine protease inhibitor Kazal type 8 protein_id : NP_898959.2

name	Nme6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055290 CCDS:CCDS23558.1 GeneID:54369 MGI:1861676
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004550 - nucleoside diphosphate kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006241 - CTP biosynthesis [Evidence IEA]; GO:0006183 - GTP biosynthesis [Evidence IEA]; GO:0009117 - nucleotide metabolism [Evidence IEA]; GO:0006228 - UTP biosynthesis [Evidence IEA] codon_start : 1 note : nucleoside diphosphate kinase type 6; nm23/nucleoside diphosphate kinase 6; expressed in non-metastatic cells 6, protein (nucleoside diphosphate kinase) product : expressed in non-metastatic cells 6, protein protein_id : NP_061227.1

name	Camp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753472 GeneID:12796 MGI:108443
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_process : GO:0006952 - defense response [Evidence IEA]; GO:0042742 - defense response to bacterium [Evidence IEA]; GO:0051707 - response to other organism [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : cathelin-like protein product : cathelicidin antimicrobial peptide protein_id : NP_034051.1

name	Cdc25a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:92373436 CCDS:CCDS23559.1 GeneID:12530 MGI:103198
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0000087 - M phase of mitotic cell cycle [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : cell division cycle 25A product : cell division cycle 25 homolog A protein_id : NP_031684.3

name	Mtap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106363 GeneID:17758 MGI:97178
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005519 - cytoskeletal regulatory protein binding [Evidence IEA] GO_process : GO:0007017 - microtubule-based process [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IEA] citation : [PUBMED 1718985] codon_start : 1 exception : mismatches in translation note : MAP 4 product : microtubule-associated protein 4 protein_id : NP_032659.1

name	Dhx30 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19111156 CCDS:CCDS23560.1 GeneID:72831 MGI:1920081
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003725 - double-stranded RNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : HELG protein_id : NP_579925.1

name	Smarcc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421097 CCDS:CCDS23561.1 GeneID:20588 MGI:1203524
definition	GO_component : GO:0005622 - intracellular [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0016514 - SWI/SNF complex [Evidence TAS] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006323 - DNA packaging [Evidence TAS]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 protein_id : NP_033237.2

name	Cspg5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328224 GeneID:29873 MGI:1352747
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0050804 - regulation of synaptic transmission [Evidence IMP] codon_start : 1 exception : mismatches in translation note : chondroitin sulfate proteoglycan 5 (neuroglycan C) product : chondroitin sulfate proteoglycan 5 protein_id : NP_038912.2

name	Tmem103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82931329 GeneID:72341 MGI:1919349
definition	codon_start : 1 product : transmembrane protein 103 isoform 2 protein_id : XP_900230.1

name	Tmem103 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765197 GeneID:72341 MGI:1919349
definition	codon_start : 1 product : transmembrane protein 103 isoform 1 protein_id : XP_135177.3

name	Scap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564088 CCDS:CCDS23564.1 GeneID:235623 MGI:2135958
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence TAS] [Evidence IDA] GO_function : GO:0015485 - cholesterol binding [Evidence TAS]; GO:0005515 - protein binding [Evidence TAS] [Evidence IPI] GO_process : GO:0008203 - cholesterol metabolism [Evidence IDA]; GO:0019217 - regulation of fatty acid metabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Sreb cleavage-activating protein product : SREBP cleavage activating protein protein_id : NP_001001144.1

name	Ptpn23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517678 GeneID:104831 MGI:2144837
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 product : protein tyrosine phosphatase, non-receptor type 23 protein_id : NP_001074512.1

name	Ngp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679054 CCDS:CCDS23566.1 GeneID:18054 MGI:105983
definition	codon_start : 1 exception : mismatches in translation note : clone B6; myeloid granule protein product : neutrophilic granule protein protein_id : NP_032720.1

name	Klhl18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55925602 CCDS:CCDS23567.1 GeneID:270201 MGI:2143315
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 18 protein_id : NP_808439.2

name	Kif9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754442 CCDS:CCDS23568.1 GeneID:16578 MGI:1098237
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : mismatches in translation function : motor protein note : kinesin 9 product : kinesin family member 9 protein_id : NP_034758.1

name	Setd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486751 GeneID:235626 MGI:1918177
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : SET domain containing 2 protein_id : NP_001074809.1

name	Nradd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22902118 CCDS:CCDS23569.1 GeneID:67169 MGI:1914419
definition	GO_component : GO:0030027 - lamellipodium [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0005641 - nuclear envelope lumen [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : death domain containing membrane protein NRADD protein_id : NP_080288.1

name	Nbeal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260328 GeneID:235627 MGI:2448554
definition	codon_start : 1 note : overriding stop codons product : similar to FLJ00341 protein protein_id : XP_982666.2 transl_except : (pos:complement(110533284..110533286),aa:OTHER)

name	Ccdc12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33469009 CCDS:CCDS23570.1 GeneID:72654 MGI:1919904
definition	codon_start : 1 exception : mismatches in translation product : coiled-coil domain containing 12 protein_id : NP_082588.1

name	Pthr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755222 GeneID:19228 MGI:97801
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004991 - parathyroid hormone receptor activity [Evidence TAS] [Evidence IMP]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0030282 - bone mineralization [Evidence IMP]; GO:0045453 - bone resorption [Evidence IMP]; GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0002062 - chondrocyte differentiation [Evidence IMP] [Evidence IGI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007189 - G-protein signaling, adenylate cyclase activating pathway [Evidence IMP]; GO:0007200 - G-protein signaling, coupled to IP3 second messenger (phospholipase C activating) [Evidence IMP]; GO:0008285 - negative regulation of cell proliferation [Evidence IMP]; GO:0001503 - ossification [Evidence IMP]; GO:0002076 - osteoblast development [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IGI]; GO:0007165 - signal transduction [Evidence IEA]; GO:0001501 - skeletal development [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy note : PTH-related peptide receptor; PTH/PTHrP receptor product : parathyroid hormone receptor 1 protein_id : NP_035329.1

name	Myl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563264 CCDS:CCDS23571.1 GeneID:17897 MGI:97268
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016459 - myosin [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : myosin light chain, alkali, cardiac ventricles; ventricular; myosin, light polypeptide 3, alkali; ventricular, skeletal, slow; slow skeletal product : myosin, light polypeptide 3 protein_id : NP_034989.1

name	9430025E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260381 GeneID:442818 MGI:3045282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481103.1

name	Tessp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346527 CCDS:CCDS23572.1 GeneID:235628 MGI:2665280
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : testis serine protease 2 protein_id : NP_694739.1

name	1700036D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625928 GeneID:73336 MGI:1920586
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : serine protease-like 1; testis specific serine protease 4 product : testis serine protease 4 protein_id : NP_683742.2

name	Tessp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054966 CCDS:CCDS23574.1 GeneID:272643 MGI:2684822
definition	GO_function : GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : testis serine protease 3 protein_id : NP_955765.1

name	BC107230 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346626 CCDS:CCDS23575.1 GeneID:260408 MGI:3605764
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : trypsin-like protease p98 product : testis serine protease 5 protein_id : NP_694812.1

name	1700112C13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147081 CCDS:CCDS23576.1 GeneID:74306 MGI:1921556
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : testis serine protease 6 protein_id : NP_898926.1

name	Tsp50 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981922 CCDS:CCDS23577.1 GeneID:235631 MGI:2447303
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : testes-specific protease 50 protein_id : NP_666339.2

name	Tmie (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122855 CCDS:CCDS23578.1 GeneID:20776 MGI:2159400
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0042472 - inner ear morphogenesis [Evidence IMP]; GO:0007605 - sensory perception of sound [Evidence IMP] codon_start : 1 note : spinner product : integral membrane protein TMIE protein_id : NP_666372.1

name	Als2cl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53749674 CCDS:CCDS23579.1 GeneID:235633 MGI:2447532
definition	GO_component : GO:0016023 - cytoplasmic membrane-bound vesicle [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IPI]; GO:0017112 - Rab guanyl-nucleotide exchange factor activity [Evidence IDA]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0007032 - endosome organization and biogenesis [Evidence ISS]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : mFLJ00189 protein product : Als2 C-terminal like protein_id : NP_666340.2

name	Gm590 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20895364 GeneID:235634 MGI:2685436
definition	codon_start : 1 product : similar to ALG-2 interacting protein 1 protein_id : XP_150244.1

name	Tdgf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134053945 GeneID:21667 MGI:98658
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0019897 - extrinsic to plasma membrane [Evidence IDA] GO_function : GO:0008083 - growth factor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0000187 - activation of MAPK activity [Evidence ISS]; GO:0010002 - cardioblast differentiation [Evidence IMP]; GO:0030154 - cell differentiation [Evidence TAS]; GO:0008595 - determination of anterior/posterior axis, embryo [Evidence IMP]; GO:0001701 - embryonic development (sensu Mammalia) [Evidence IMP]; GO:0007173 - epidermal growth factor receptor signaling pathway [Evidence ISS]; GO:0007507 - heart development [Evidence IDA]; GO:0001763 - morphogenesis of a branching structure [Evidence IDA]; GO:0030335 - positive regulation of cell migration [Evidence IDA]; GO:0008284 - positive regulation of cell proliferation [Evidence ISS]; GO:0001954 - positive regulation of cell-matrix adhesion [Evidence IMP]; GO:0048146 - positive regulation of fibroblast proliferation [Evidence IMP]; GO:0030334 - regulation of cell migration [Evidence IMP]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 product : teratocarcinoma-derived growth factor protein_id : NP_035692.2

name	Lrrc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037353 CCDS:CCDS23580.1 GeneID:74249 MGI:1921499
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : leucine-rich repeat-containing 2 product : leucine rich repeat containing 2 protein_id : NP_083114.1

name	Rtp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346529 GeneID:235636 MGI:2446841
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : receptor transporting protein 3 product : transmembrane protein 7 protein_id : NP_694740.1

name	ENSMUSG00000057802 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260330 GeneID:791282 MGI:3641798
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472620.1

name	Ltf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560677 CCDS:CCDS23581.1 GeneID:17002 MGI:96837
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0008199 - ferric iron binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IDA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : lactoferrin; minisatellite 10r detected by probe MMS10 product : lactotransferrin protein_id : NP_032548.2

name	Ccrl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980870 CCDS:CCDS23582.1 GeneID:54199 MGI:1920904
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence ISS] [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-C) receptor 1,-like 2; chemokine (C-C) receptor 1-like 2 product : lipopolysaccharide inducible C-C chemokine receptor related protein_id : NP_059494.2

name	Lrrfip2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625827 CCDS:CCDS23583.1 GeneID:71268 MGI:1918518
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 product : leucine rich repeat (in FLII) interacting protein 2 protein_id : NP_082018.1

name	Mlh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19387852 GeneID:17350 MGI:101938
definition	GO_component : GO:0005694 - chromosome [Evidence IDA]; GO:0000793 - condensed chromosome [Evidence IDA] [Evidence IMP]; GO:0005634 - nucleus [Evidence IEA]; GO:0000795 - synaptonemal complex [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0008630 - DNA damage response, signal transduction resulting in induction of apoptosis [Evidence IMP]; GO:0006281 - DNA repair [Evidence IMP]; GO:0007140 - male meiosis [Evidence IMP]; GO:0007060 - male meiosis chromosome segregation [Evidence IMP]; GO:0007126 - meiosis [Evidence IDA] [Evidence TAS]; GO:0007131 - meiotic recombination [Evidence IMP]; GO:0006298 - mismatch repair [Evidence IDA]; GO:0045950 - negative regulation of mitotic recombination [Evidence IMP]; GO:0006974 - response to DNA damage stimulus [Evidence IMP] codon_start : 1 exception : mismatches in translation note : DNA mismatch repair protein MLH1; colon cancer, nonpolyposis type 2 product : MutL protein homolog 1 protein_id : NP_081086.1

name	Epm2aip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424918 GeneID:77781 MGI:1925031
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence ISS] [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : EPM2A (laforin) interacting protein 1 protein_id : NP_780475.1

name	Lba1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260383 GeneID:320429 MGI:1341834
definition	codon_start : 1 product : lupus brain antigen 1 protein_id : XP_001481117.1

name	LOC100043782 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043782
definition	number : 1 pseudo : _no_value

name	LOC665549 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665549
definition	number : 2 pseudo : _no_value

name	LOC665549 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665549
definition	number : 1 pseudo : _no_value

name	LOC100039275 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039275
definition	number : 2 pseudo : _no_value

name	LOC100039275 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039275
definition	number : 1 pseudo : _no_value

name	E330001B16Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260372 GeneID:546160 MGI:3588266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 9 Proteins product : RIKEN cDNA E330001B16 gene transcript_id : XR_034946.1

name	LOC100049540 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260379 GeneID:100049540
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 195 ESTs, 13 Proteins product : similar to ribosomal protein L7 pseudo : _no_value transcript_id : XR_034952.1

clone name	MSMg01-481K07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527K16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-319K05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-514D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-380B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-231E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-203C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471K01
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-374G09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-432F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304L07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214L24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469M05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407P03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396K08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115N21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-217M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-088H05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289D23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-167G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173H09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294D11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-133J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-059P14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079M01
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-068M19.b	B6Ng01-068M19.g
ACC	DH887283	DH887284
length	1,167	374
definition	DH887283\|Mus musculus domesticus DNA, BAC clone: B6Ng01-068M19, 5' end.	DH887284\|Mus musculus domesticus DNA, BAC clone: B6Ng01-068M19, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaatatggaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaatacaaccctgagat tccacctcacaccagccagaatggctaagatcaaaacttcaggtcacagc agatgctggcaaggatgtggagaaagaggaacactcctccattgttggtg ggattgcaagcttgtacaaccactctggaaatcagtctggtagttcctta gaaaattggacggacatagtactactggaggatccagcaatacctctctt gggcatatatccagagatgtcacaaccggtaagaaaggcacatgctccac tatgttcatagcagccttatttataatagccagaagctggaaagaaccca gatgcccctcaacagaggaatggatacagaaaatttggtacatttacaca atggagtactattcagctattaaaaagaatggatttttgaaattcctagc caaatggatggacctggagggcatcatctttagtgaggtaacacaatcac aaaggaactcacacaatatgtactcactgataagtggatattggccccaa tcttagcatacccaagatataagatacaatttgctaaacgcaggaaactc aagaagaaggaagaccaaagtgtggacactgtgctccttcttagaattgg gggaaaaaaaaacacccatggaaggaattacagagacaaattctggagct gtgatgaaagaatggaccatctagagactgccatatccaaagatccaccc cataatcagcttccaaatgctgacaccattgcatacactagcaagatttt gctgaaaggacccagatatagctctctcttgtgagactatgccgggccct accaaacacagaagtggatgctcacaatcagctattagatggatcacagg ctcccaaaggaggagctagagaagtaccttagagctaaagggatctgcac cctataggtggaacaacatatgactaacagtaccctggagccctgactct agctgctttgtatcaatgatgctagtcgcatcactggaagaaagccattg acaccaacttttatgcctagtaggaacgcaggcaaaaatggaatggctgt agggaaatagaaggaga	caagcaattggagtggtggtgtctctgattcttttgcctgcatgtgggac ctatttccttctactgggttgccttgacaaaggctgataagagagcatat gtctaatcttattgtatctagttaagccagctattttcttaagggagaca aaggaacagcatttcaggggcttagggtagatgatagagaattgggagga gagaaaggaggggatactgtggttgggatttatcacatgagagaaaaaca aaaacaaacaagcaagcaaaaagtaaaatctctattccaccaaatttcaa agtctaaaataaaaggatagttcttcatatttataatcttttaaagctaa cttaaaatcggagaagcacttaaa
quality values	Open. Hide. 50 43 35 38 61 53 61 38 31 61 61 61 61 61 61 61 61 55 39 61 49 61 61 61 55 49 52 19 36 10 12 21 10 19 22 45 59 59 59 61 61 61 59 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 39 29 44 30 30 30 36 32 55 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 59 59 59 43 43 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 42 61 61 61 61 47 46 61 61 61 53 61 61 61 61 61 61 53 61 61 61 53 61 61 61 50 61 43 61 52 61 52 61 61 61 57 45 53 53 53 57 57 57 57 57 57 53 57 57 53 53 53 53 53 50 57 57 53 57 50 57 53 40 57 50 57 57 42 57 57 42 57 47 57 50 47 28 47 42 47 57 52 47 57 52 57 53 53 38 50 53 57 57 45 53 52 50 50 53 45 53 50 45 50 40 37 57 42 38 41 50 53 57 47 47 50 57 57 57 57 57 57 57 50 45 43 32 39 47 31 42 53 53 52 50 30 52 38 34 30 43 45 52 42 38 57 26 30 30 26 43 45 41 32 32 45 53 50 52 24 44 47 38 30 40 52 30 38 38 57 42 42 44 40 42 53 37 33 12 21 30 42 42 47 40 32 50 29 37 33 31 53 35 44 26 52 32 31 32 53 38 46 38 33 37 36 36 53 20 24 53 53 53 30 40 37 27 27 35 37 25 34 28 39 29 37 24 57 47 34 48 37 40 40 37 29 23 32 34 18 21 48 40 37 23 33 29 33 21 33 39 39 28 30 22 40 27 23 18 51 46 30 21 28 31 27 31 51 32 24 30 18 11 39 24 15 28 43 28 28 28 16 28 29 43 28 29 21 19 29 22 20 24 18 28 35 29 39 23 28 25 29 29 17 36 22 51 34 5 39 6 11 24 28 32 28 43 14 7 11 9 10 24 33 29 15 38 28 28 13 16 25 27 29 29 28 33 26 27 26 25 34 23 23 23 25 17 36 33 15 24 13 32 24 19 26 25 16 23 7 21 23 14 28 21 51 29 13 46 27 20 21 14 28 15 23 12 27 29 14 14 14 7 23 40 12 21 23 28 26 27 20 25 12 9 11 18 20 24 51 23 30 51 20 15 26 23 19 16 9 30 22 38 28 27 16 17 15 23 15 16 18 22 17 31 17 8 24 14 6 32 15 28 19 36 13 17 19 9 24 11 17 6 5 17 35 18 28 20 5 30 11 21 35 13 17 19 4 8 14 14 10 15 6 18 31 19 6 4 4 6 12 6 5 7 17 14 18 5 10 19 11 10 4 6 12 5 5 5 14 7 10 29 13 12 12 15 21 13 18 16 6 10 4 3 3 3 17 7 28 8 23 6 7 9 6 20 5 22 9 18 26 9 5 5 14 10 24 23 5 4 3 5 3 3 10 7 14 4 8 23 7 18 11 22 18 32 36 32 23 15 23 15 9 11 7 15 3 1 4 4 7 3 8 16 3 5 10 11 6 4 4 4 5 9 13 4 4 7	Open. Hide. 18 12 9 12 12 12 18 18 18 36 35 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 59 45 59 35 30 28 28 32 30 49 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 59 55 59 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 52 59 36 23 23 23 26 27 36 39 59 27 59 49 44 38 39 35 36 36 43 52 44 39 39 59 35 52 49 59 52 61 59 59 52 52 59 59 41 43 59 40 43 45 43 52 41 29 36 32 24 27 32 36 36 52 44 44 49 52 52 52 59 37 36 32 33 23 27 49 32 37 36 35 44 41 43 43 39 23 27 32 37 30 59 59 52 52 32 25 32 22 8 27 18 13 19 17 18 13 13 11 18 13 19 52 44 49 44 36 36 36 31 36 35 49 37 39 18 13 12 16 10 10 15 30 32 27 18 37 55 27 59 49 39 39 32 43 43 16 20 30 39

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_110256684_110256727
seq2: B6Ng01-068M19.g_321_359

seq1  AAAACAAAAAAAAAAAGCAAGCAAGCAAAAAGTCAAAATTCTCT  44
      |||||||||| |||   ||||||||||||||||  ||| |||||
seq2  AAAACAAAAACAAA---CAAGCAAGCAAAAAGT--AAAATCTCT  39

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information