MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-102O15
Chromosome	9 (Build37)
Map Location	19,297,458 - 19,298,619
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Muc16, Olfr24, Olfr828, Olfr829, Olfr830, Olfr831-ps1, Olfr832, GA_x5J8B7W6RL5-13870817-13871726, Olfr834, Olfr835, Olfr836, Olfr837, GA_x5J8B7W6RL5-13695863-13696754, Olfr839-ps1, GA_x5J8B7W6RL5-13645512-13646298, Olfr841-ps1, Olfr842-ps1, Olfr843, Olfr845, Olfr1522-ps1, Olfr846, LOC665697, Olfr847, GA_x5J8B7W6RL5-13451244-13452122, Olfr849, Olfr850
Downstream gene	Olfr851, Olfr852-ps1, Olfr853, Olfr854, Olfr855, Zfp75, EG624341, LOC665751, Olfr857, Olfr858-ps1, Olfr58, Olfr859, Olfr860, GA_x5J8B7W6RL5-13004417-13003354, Olfr862, Olfr77, EG665823, Olfr863-ps1, Olfr864-ps1, Olfr865-ps1, Olfr866, Olfr867, Olfr868, Olfr869, Olfr870, Olfr871, Olfr872, Olfr39, Olfr873, Olfr18, Zfp560, 4921534A09Rik, EG624824, Zfp26, Zfp426
Link	Open Mouse BAC browser

Click to get alignment info.

name	Muc16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73732 MGI:1920982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein

name	Olfr24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18322 MGI:109311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr828 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258598 MGI:3030662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259070 MGI:3030663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr830 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258559 MGI:3030664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr831-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404431 MGI:3030665
definition	note : olfactory receptor 831, pseudogene 1 pseudo : _no_value

name	Olfr832 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258075 MGI:3030666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13870817-13871726 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257755
definition	note : olfactory receptor GA_x5J8B7W6RL5-13870817-13871726 pseudo : _no_value

name	Olfr834 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258074 MGI:3030668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr835 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257872 MGI:3030669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr836 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258557 MGI:3030670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr837 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258558 MGI:3030671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13695863-13696754 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257756
definition	note : olfactory receptor GA_x5J8B7W6RL5-13695863-13696754 pseudo : _no_value

name	Olfr839-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258184 MGI:3030673
definition	gene_synonym : MOR152-4P note : olfactory receptor 839, pseudogene 1 pseudo : _no_value

name	GA_x5J8B7W6RL5-13645512-13646298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257757
definition	note : olfactory receptor GA_x5J8B7W6RL5-13645512-13646298 pseudo : _no_value

name	Olfr841-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258072 MGI:3030675
definition	gene_synonym : MOR266-7P note : olfactory receptor 841, pseudogene 1 pseudo : _no_value

name	Olfr842-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258073 MGI:3030676
definition	gene_synonym : MOR154-2P; MOR154-3_p note : olfactory receptor 842, pseudogene 1 pseudo : _no_value

name	Olfr843 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258560 MGI:3030677
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr845 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258249 MGI:3030679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1522-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258176 MGI:3031356
definition	gene_synonym : MOR150-1P note : olfactory receptor 1522, pseudogene 1 pseudo : _no_value

name	Olfr846 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258279 MGI:3030680
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Olfr847 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258518 MGI:3030681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13451244-13452122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257758
definition	note : olfactory receptor GA_x5J8B7W6RL5-13451244-13452122 pseudo : _no_value

name	Olfr849 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258520 MGI:3030683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr850 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258516 MGI:3030684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr851 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258907 MGI:3030685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr852-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404436 MGI:3030686
definition	note : olfactory receptor 852, pseudogene 1 pseudo : _no_value

name	Olfr853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258908 MGI:3030687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr854 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258515 MGI:3030688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258517 MGI:3030689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp75 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:244713 MGI:107775
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624341 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624341 MGI:3645477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2105 Proteins

name	LOC665751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Olfr857 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257963 MGI:3030691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr858-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258058 MGI:3030692
definition	gene_synonym : MOR146-6P note : olfactory receptor 858, pseudogene 1 pseudo : _no_value

name	Olfr58 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18358 MGI:1333790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr859 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258519 MGI:3030693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr860 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258521 MGI:3030694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	GA_x5J8B7W6RL5-13004417-13003354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:257718
definition	note : olfactory receptor GA_x5J8B7W6RL5-13004417-13003354 pseudo : _no_value

name	Olfr862 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258555 MGI:3030696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr77 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258336 MGI:2153206
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665823 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665823 MGI:3643360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 689 ESTs, 16 Proteins

name	Olfr863-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258070 MGI:3030697
definition	gene_synonym : MOR146-5P note : olfactory receptor 863, pseudogene 1 pseudo : _no_value

name	Olfr864-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258071 MGI:3030698
definition	gene_synonym : MOR146-4 note : olfactory receptor 864, pseudogene 1 pseudo : _no_value

name	Olfr865-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404438 MGI:3030699
definition	note : olfactory receptor 865, pseudogene 1 pseudo : _no_value

name	Olfr866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258551 MGI:3030700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr867 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257898 MGI:3030701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258552 MGI:3030702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr869 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258550 MGI:3030703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr870 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57251 MGI:3030704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258905 MGI:3030705
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr872 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258553 MGI:3030706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr39 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258822 MGI:1313142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr873 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258554 MGI:3030707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18315 MGI:109317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp560 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434377 MGI:1915280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921534A09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320674 MGI:2444504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG624824 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624824 MGI:3647240
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Zfp26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22688 MGI:99173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp426 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235028 MGI:1920248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Muc16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259833 GeneID:73732 MGI:1920982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 1 Protein product : mucin 16 transcript_id : XM_911929.3

name	Olfr24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33238877 GeneID:18322 MGI:109311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 24 transcript_id : NM_146606.1

name	Olfr828 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239271 GeneID:258598 MGI:3030662
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 828 transcript_id : NM_146605.1

name	Olfr829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22128822 GeneID:259070 MGI:3030663
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 829 transcript_id : NM_147067.1

name	Olfr830 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129510 GeneID:258559 MGI:3030664
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 830 transcript_id : NM_146566.1

name	Olfr832 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801411 GeneID:258075 MGI:3030666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 832 transcript_id : NM_001011824.1

name	Olfr834 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801409 GeneID:258074 MGI:3030668
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 834 transcript_id : NM_001011823.1

name	Olfr835 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676582 GeneID:257872 MGI:3030669
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 835 transcript_id : NM_001012266.1

name	Olfr836 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129514 GeneID:258557 MGI:3030670
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 836 transcript_id : NM_146564.1

name	Olfr837 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129516 GeneID:258558 MGI:3030671
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 837 transcript_id : NM_146565.1

name	Olfr843 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129512 GeneID:258560 MGI:3030677
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 843 transcript_id : NM_146567.1

name	Olfr845 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46369496 GeneID:258249 MGI:3030679
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 845 transcript_id : NM_207145.1

name	Olfr846 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129722 GeneID:258279 MGI:3030680
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 846 transcript_id : NM_146282.1

name	Olfr847 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239265 GeneID:258518 MGI:3030681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 847 transcript_id : NM_146525.1

name	Olfr849 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239267 GeneID:258520 MGI:3030683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 849 transcript_id : NM_146527.1

name	Olfr850 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239273 GeneID:258516 MGI:3030684
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 850 transcript_id : NM_146523.1

name	Olfr851 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112982692 GeneID:258907 MGI:3030685
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 851 transcript_id : NM_146905.2

name	Olfr853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129072 GeneID:258908 MGI:3030687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 853 transcript_id : NM_146906.1

name	Olfr854 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239275 GeneID:258515 MGI:3030688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 854 transcript_id : NM_146522.1

name	Olfr855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239269 GeneID:258517 MGI:3030689
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 855 transcript_id : NM_146524.1

name	Zfp75 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254382 GeneID:244713 MGI:107775
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 75 transcript_id : NM_172918.3

name	EG624341 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259839 GeneID:624341 MGI:3645477
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2105 Proteins product : predicted gene, EG624341 transcript_id : XM_888877.3

name	Olfr857 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:59676578 GeneID:257963 MGI:3030691
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 857 transcript_id : NM_001012265.1

name	Olfr58 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114520615 GeneID:18358 MGI:1333790
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 58 transcript_id : NM_011001.2

name	Olfr859 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:120953179 GeneID:258519 MGI:3030693
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 859 transcript_id : NM_146526.2

name	Olfr860 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239277 GeneID:258521 MGI:3030694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 860 transcript_id : NM_146528.1

name	Olfr862 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129520 GeneID:258555 MGI:3030696
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 862 transcript_id : NM_146562.1

name	Olfr77 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328370 GeneID:258336 MGI:2153206
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 77 transcript_id : NM_146339.2

name	EG665823 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259848 GeneID:665823 MGI:3643360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 689 ESTs, 16 Proteins product : predicted gene, EG665823 transcript_id : XM_979710.2

name	Olfr866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129524 GeneID:258551 MGI:3030700
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 866 transcript_id : NM_146558.1

name	Olfr867 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801283 GeneID:257898 MGI:3030701
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 867 transcript_id : NM_001011748.1

name	Olfr868 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129518 GeneID:258552 MGI:3030702
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 868 transcript_id : NM_146559.1

name	Olfr869 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170039 GeneID:258550 MGI:3030703
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 869 transcript_id : NM_146557.1

name	Olfr870 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22380660 GeneID:57251 MGI:3030704
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 870 transcript_id : NM_146904.1

name	Olfr871 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129076 GeneID:258905 MGI:3030705
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 871 transcript_id : NM_146903.1

name	Olfr872 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170047 GeneID:258553 MGI:3030706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 872 transcript_id : NM_146560.1

name	Olfr39 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129206 GeneID:258822 MGI:1313142
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 39 transcript_id : NM_146825.1

name	Olfr873 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:49170043 GeneID:258554 MGI:3030707
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 873 transcript_id : NM_146561.1

name	Olfr18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032326 GeneID:18315 MGI:109317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 18 transcript_id : NM_146563.1

name	Zfp560 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131087 GeneID:434377 MGI:1915280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 560 transcript_id : NM_001004190.3

name	4921534A09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259843 GeneID:320674 MGI:2444504
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4921534A09 gene transcript_id : XM_001474893.1

name	Zfp26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801412 GeneID:22688 MGI:99173
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 26 transcript_id : NM_011753.2

name	Zfp426 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803273 GeneID:235028 MGI:1920248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 426 transcript_id : NM_146221.3

name	Muc16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259834 GeneID:73732 MGI:1920982
definition	codon_start : 1 product : mucin 16 protein_id : XP_917022.3

name	Olfr24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33238878 CCDS:CCDS22846.1 GeneID:18322 MGI:109311
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12498544-12497603; olfactory receptor MOR132-1 product : olfactory receptor 24 protein_id : NP_666817.1

name	Olfr828 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239272 GeneID:258598 MGI:3030662
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12559294-12558356; olfactory receptor MOR149-1 product : olfactory receptor 828 protein_id : NP_666816.1

name	Olfr829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128823 CCDS:CCDS22847.1 GeneID:259070 MGI:3030663
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12599710-12600648; olfactory receptor MOR147-1 product : olfactory receptor 829 protein_id : NP_667278.1

name	Olfr830 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129511 CCDS:CCDS22848.1 GeneID:258559 MGI:3030664
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12618399-12619337; olfactory receptor MOR152-1 product : olfactory receptor 830 protein_id : NP_666777.1

name	Olfr832 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801412 CCDS:CCDS22849.1 GeneID:258075 MGI:3030666
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12687800-12688738; olfactory receptor MOR153-1 product : olfactory receptor 832 protein_id : NP_001011824.1

name	Olfr834 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801410 CCDS:CCDS22850.1 GeneID:258074 MGI:3030668
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12724921-12725859; olfactory receptor MOR153-2 product : olfactory receptor 834 protein_id : NP_001011823.1

name	Olfr835 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676583 CCDS:CCDS22851.1 GeneID:257872 MGI:3030669
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12771995-12772930; GA_x5J8B7TUND4-2-664; GA_x5J8B7TUND5-1082-669; olfactory receptor MOR150-3 product : olfactory receptor 835 protein_id : NP_001012266.1

name	Olfr836 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129515 CCDS:CCDS22852.1 GeneID:258557 MGI:3030670
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12857805-12858749; olfactory receptor MOR152-3 product : olfactory receptor 836 protein_id : NP_666775.1

name	Olfr837 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129517 GeneID:258558 MGI:3030671
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-12873838-12874776; olfactory receptor MOR152-2 product : olfactory receptor 837 protein_id : NP_666776.1

name	Olfr843 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129513 CCDS:CCDS22853.1 GeneID:258560 MGI:3030677
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-12986331-12985390; olfactory receptor MOR155-2 product : olfactory receptor 843 protein_id : NP_666778.1

name	Olfr845 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46369497 CCDS:CCDS22854.1 GeneID:258249 MGI:3030679
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13076685-13077623; olfactory receptor MOR150-2 product : olfactory receptor 845 protein_id : NP_997028.1

name	Olfr846 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129723 CCDS:CCDS22855.1 GeneID:258279 MGI:3030680
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13098546-13097608; olfactory receptor MOR149-3 product : olfactory receptor 846 protein_id : NP_666394.1

name	Olfr847 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239266 CCDS:CCDS22856.1 GeneID:258518 MGI:3030681
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13113073-13112135; olfactory receptor MOR149-2 product : olfactory receptor 847 protein_id : NP_666736.1

name	Olfr849 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239268 CCDS:CCDS22857.1 GeneID:258520 MGI:3030683
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13176842-13177780; olfactory receptor MOR151-1 product : olfactory receptor 849 protein_id : NP_666738.1

name	Olfr850 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239274 CCDS:CCDS22858.1 GeneID:258516 MGI:3030684
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13214162-13213224; olfactory receptor MOR147-2 product : olfactory receptor 850 protein_id : NP_666734.1

name	Olfr851 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112982693 CCDS:CCDS22859.1 GeneID:258907 MGI:3030685
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13234278-13235216; olfactory receptor MOR155-1 product : olfactory receptor 851 protein_id : NP_667116.2

name	Olfr853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129073 CCDS:CCDS22860.1 GeneID:258908 MGI:3030687
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13277703-13276786; olfactory receptor MOR154-1 product : olfactory receptor 853 protein_id : NP_667117.1

name	Olfr854 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239276 CCDS:CCDS22861.1 GeneID:258515 MGI:3030688
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13313295-13312357; olfactory receptor MOR147-3 product : olfactory receptor 854 protein_id : NP_666733.1

name	Olfr855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239270 GeneID:258517 MGI:3030689
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-13330461-13331399; olfactory receptor MOR148-1 product : olfactory receptor 855 protein_id : NP_666735.1

name	Zfp75 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254383 CCDS:CCDS22862.1 GeneID:244713 MGI:107775
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 75 protein_id : NP_766506.3

name	EG624341 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259840 GeneID:624341 MGI:3645477
definition	codon_start : 1 product : similar to olfactory receptor Olr1158 protein_id : XP_893970.3

name	Olfr857 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:59676579 GeneID:257963 MGI:3030691
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13452606-13453535; GA_x5J8B7W6RL5-13162713-13162216; olfactory receptor MOR146-8P product : olfactory receptor 857 protein_id : NP_001012265.1

name	Olfr58 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53828657 CCDS:CCDS22863.1 GeneID:18358 MGI:1333790
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR146-7P; GA_x6K02T2PVTD-13523015-13523944 product : olfactory receptor 58 protein_id : NP_035131.1

name	Olfr859 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:120953180 CCDS:CCDS22864.1 GeneID:258519 MGI:3030693
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13548326-13549255; MOR146-10_p; olfactory receptor MOR146-3 product : olfactory receptor 859 protein_id : NP_666737.2

name	Olfr860 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239278 CCDS:CCDS22865.1 GeneID:258521 MGI:3030694
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13586614-13585661; olfactory receptor MOR146-2 product : olfactory receptor 860 protein_id : NP_666739.1

name	Olfr862 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129521 CCDS:CCDS22866.1 GeneID:258555 MGI:3030696
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13624132-13623212; olfactory receptor MOR146-1 product : olfactory receptor 862 protein_id : NP_666773.1

name	Olfr77 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129623 CCDS:CCDS22867.1 GeneID:258336 MGI:2153206
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence ISS] [Evidence TAS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence ISS] [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR143-1; GA_x6K02T2PVTD-13660026-13660964 product : olfactory receptor 77 protein_id : NP_666451.1

name	EG665823 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386017 GeneID:665823 MGI:3643360
definition	codon_start : 1 product : similar to ubiquitin A-52 residue ribosomal protein fusion product 1 protein_id : XP_984804.1

name	Olfr866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129525 CCDS:CCDS22868.1 GeneID:258551 MGI:3030700
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13768406-13767468; olfactory receptor MOR145-5 product : olfactory receptor 866 protein_id : NP_666769.1

name	Olfr867 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801284 CCDS:CCDS22869.1 GeneID:257898 MGI:3030701
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13795933-13794938; olfactory receptor MOR143-2 product : olfactory receptor 867 protein_id : NP_001011748.1

name	Olfr868 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129519 CCDS:CCDS22870.1 GeneID:258552 MGI:3030702
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13841888-13842802; olfactory receptor MOR145-4 product : olfactory receptor 868 protein_id : NP_666770.1

name	Olfr869 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170040 CCDS:CCDS22871.1 GeneID:258550 MGI:3030703
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13878275-13879204; olfactory receptor MOR145-6 product : olfactory receptor 869 protein_id : NP_666768.1

name	Olfr870 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22380661 CCDS:CCDS22872.1 GeneID:57251 MGI:3030704
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor MOR141-1; GA_x6K02T2PVTD-13912679-13911744; olfactory receptor 72 product : olfactory receptor 870 protein_id : NP_667115.1

name	Olfr871 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129077 CCDS:CCDS22873.1 GeneID:258905 MGI:3030705
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GA_x6K02T2PVTD-13952555-13953490; olfactory receptor MOR141-2 product : olfactory receptor 871 protein_id : NP_667114.1

name	Olfr872 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170048 CCDS:CCDS22874.1 GeneID:258553 MGI:3030706
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-13999915-14000844; olfactory receptor MOR145-3 product : olfactory receptor 872 protein_id : NP_666771.1

name	Olfr39 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129207 CCDS:CCDS22875.1 GeneID:258822 MGI:1313142
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14025733-14026668 product : olfactory receptor 39 protein_id : NP_667036.1

name	Olfr873 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:49170044 CCDS:CCDS22876.1 GeneID:258554 MGI:3030707
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14040245-14041204; olfactory receptor MOR145-2 product : olfactory receptor 873 protein_id : NP_666772.1

name	Olfr18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032327 GeneID:18315 MGI:109317
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2PVTD-14054886-14053957 product : olfactory receptor 18 protein_id : NP_666774.1

name	Zfp560 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677614 CCDS:CCDS22877.1 GeneID:434377 MGI:1915280
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : zinc finger protein 560 protein_id : NP_001004190.2

name	4921534A09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259844 GeneID:320674 MGI:2444504
definition	codon_start : 1 product : hypothetical protein LOC320674 protein_id : XP_001474943.1

name	Zfp26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249206 GeneID:22688 MGI:99173
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 81, related sequence 1 product : zinc finger protein 26 protein_id : NP_035883.1

name	Zfp426 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122781 GeneID:235028 MGI:1920248
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : zinc finger protein 68, related sequence 1 product : zinc finger protein 426 protein_id : NP_666333.1

name	LOC665697 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665697
definition	number : 1 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 6 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 5 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 4 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 3 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 2 pseudo : _no_value

name	EG624824 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624824
definition	number : 1 pseudo : _no_value

name	LOC665751 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259841 GeneID:665751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to BCL2/adenovirus E1B 19kDa-interacting protein 1, NIP2 isoform alpha pseudo : _no_value transcript_id : XR_031834.1

clone name	MSMg01-312I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-358L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295B20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-346L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-088E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-321F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154E02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-542H13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-235H07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498P13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-418O04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-475M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-531F01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060I10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-067F03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232G15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-354G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147E09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-235D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-406B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-486D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-399M19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-298N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-470I21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-521M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-132L24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-057K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-362C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-521L18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351G05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-047C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-213L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-307M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-101E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251J10
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-102O15.b	B6Ng01-102O15.g
ACC	DH911667	DH911668
length	1,154	1,175
definition	DH911667\|Mus musculus domesticus DNA, BAC clone: B6Ng01-102O15, 5' end.	DH911668\|Mus musculus domesticus DNA, BAC clone: B6Ng01-102O15, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcaatatcaaatatatttgaaaaaagaagatgaatgaagagaaata ttcaaggaataaattttatatgtttattactttgttattttagaaagtta tgaaatacatcaatatatctaacctgattaattgtgtcaagaagcatggt attgtcatgtgtatcttttaccaaaataaaggacttgcctccctggttct tctgatttctatcttatacatttaagtgatacatagacacccctaaacct tatgaaacaagaaatctgaagatttgatttttctgcaaactcaaagacaa ccaaaaatatttaattacttttaagccatcaattttagccattttaaaag agaaacttagcaaactaacattttcatcaaatctctggatactactacca cagcaccttaaagtaatatgtgaatgatttaagatagccattatagtcaa gaaatgaccaatgtctggtcataagaaaatgggcagtgttcgtctagata gtattttacaggcaaaatgaaatatatgtgtattacagtataaatatgtg tgttaaacacaccaaaaatttacaagtgaagtaaagctcttatttctcat aaattatgttacatgcccttacttcctctaagaatagaattgtaagcctt accatgtaccagtaagatactatgataatgtatttgctaccttactgaca ataatcctcagaatctcacctggaagttgtacaagattggctgccttagg actcaatgggcccctggagaaccatgatcatctttggttgatgcaaatct ttggttggatgatgtttcattctaacacacaaagaacattaaggagttag tcacagggtgagtttgacagtaaagtataggtatcataggtatttaatat ccaaggcttcccactagaccctgtatttcattgtaattccaatcccaagg gagcactgcttaatgactgagtatatagaagttgtagaattaaatgtgca tgatttgatgacccatgagtagaatactattctattatttctgatccctt catgaagagtattttcaagctcttccaacagagttaccagaaggttccat ttttgttttttccatttatatagaattccagttatgtttttatgatatgc tcct	gaattctttgtttagctctgtaccccagttttttaatagggttgtttgat tttctgaggtccatgttcttgagttctttatatatattggatatcagttc cctatctgatttaggattggtaaagatcctttcccaatcagttggtagct ttttgtcttattgacagtgtcttttgacttgcagaatctttgtaatttta tgaggtcccatatgtcaattcttgatcttacagcacaagccattgctgtt ctgttcaggaatttttcctgtgtccatatcttcgaggcttttccccactc tctcctctataagtttcagtgtctctggttttatgtggagttccttgatc cacttagacttgagctttgtacaagaagataacaatggatcaattgggtt catttctgggactgtctattgctgtaccagtgccatgcagcttttatcac aattgctctgtagtacaacttgaagtcaggcatgacccagaggttctttt attgttgagaatagtttttgctatcctcagtgttttgttattccagatga atttgcaaattgtcctttctaacttggtgaggaattgagttggaaatttg atggagattgcattaaatccatagattgctttctgcaagatagctaattt tactgtattgattctgcaaatccatgagcaaggacaattgttccattgtc tgagatcttcaatttctttcttcagagacttgaatttcttatcatacata tattttcacttccttagttagagcacaccaaggttttttatatttatctg tgactattgttgaaggttgctgtttccctaatttctttctcagcctgttt atcctttgtatagaaaaaggccactgatttgtttgacttaaaattatatc cagctactgcactgaagctgtttattaggtttaggagttctctgggtgga atttttaggatcacttatatatactgtcaatttcatctgctaaaagtcat attttacttcttcctttccaatttggtatccccctgacctcctttttgtt tttctaatttctctgggctataaactattcagtgggatatgtgaatactt agggaggaagttgtaaggcccttctaatcctgaatctagggggatgaatt ccaattctcccatttgatggatttg
quality values	Open. Hide. 61 47 24 27 61 33 23 61 61 55 47 38 36 61 61 61 55 49 61 49 61 61 59 61 61 61 61 13 11 20 24 12 12 16 13 16 43 36 40 59 61 61 61 61 59 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 35 37 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 55 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 47 61 61 61 61 61 61 61 53 61 61 61 61 61 57 57 57 57 53 47 57 57 53 53 57 53 53 53 57 53 53 47 57 43 46 47 47 53 57 53 53 57 57 57 57 53 57 53 53 57 57 53 57 53 57 47 50 57 38 57 37 33 57 50 57 43 38 57 57 38 53 53 47 52 57 53 53 45 52 57 50 53 57 52 50 57 47 37 50 41 36 57 50 52 30 47 53 52 50 52 57 37 40 52 52 52 57 42 52 50 57 57 52 50 53 50 53 46 52 53 52 53 46 57 52 50 37 46 32 39 43 47 53 52 52 52 45 33 46 45 30 50 53 41 42 47 41 37 52 38 52 53 34 50 52 52 37 31 42 23 52 44 52 34 33 53 38 37 53 53 17 37 37 44 52 14 52 40 24 52 33 31 26 37 53 53 52 36 46 46 53 33 40 53 52 31 43 45 11 46 30 34 52 34 23 40 31 36 43 53 57 33 47 53 29 38 32 41 28 41 32 20 57 41 29 39 39 57 30 45 37 22 41 53 37 39 32 40 38 21 45 32 51 32 32 23 14 22 47 35 36 31 39 20 32 27 32 30 51 32 32 30 37 30 25 29 39 32 30 25 36 31 21 15 34 31 33 34 39 28 29 22 30 39 39 34 39 47 16 16 51 48 38 29 16 29 35 28 38 51 29 28 33 34 32 12 22 11 8 24 29 30 29 35 29 14 33 20 33 31 51 39 26 29 29 31 29 28 34 21 15 25 27 28 25 33 29 39 31 20 28 28 29 21 23 12 39 36 34 43 22 28 28 51 29 28 25 29 23 34 31 33 24 28 34 22 33 21 22 33 31 43 39 20 13 16 44 20 35 20 28 19 28 28 41 23 29 29 20 26 28 31 31 29 21 29 19 12 23 20 19 15 25 15 20 28 33 11 13 7 13 7 31 9 9 33 13 13 22 38 19 17 30 23 32 26 31 22 21 34 20 44 19 24 24 22 34 28 14 34 20 10 23 21 27 30 9 14 4 30 30 10 8 12 9 6 10 15 4 7 22 29 30 12 16 37 29 23 24 22 29 18 7 12 14 12 17 7 7 13 7 11 16 5 6 4 9 10 5 23 21 13 8 23 29 11 5 6 8 5 20 11 9 7 3 7 4 4 7 4 13 20 5 15 9 6 5 7 24 8 10 19 10 24 10 5 24 18 31 24 10 16 10 15 26 23 9 4 3 2 7 12 22 12 8 11 10 14 9 13 7 4 2 3 5 5 4 1 3 3 3 3 9 7 24 29 25 6 8 13 9 6 5 11 9 9 3 3 11 17 10	Open. Hide. 55 61 49 49 61 49 24 24 22 19 27 33 41 21 16 24 55 59 59 61 61 59 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 59 61 59 61 61 59 61 61 61 61 61 61 61 59 61 59 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 52 61 61 59 59 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 59 59 59 59 61 59 61 61 59 59 61 59 59 59 61 61 61 59 61 61 59 59 49 52 59 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 29 61 55 61 40 61 61 55 61 61 61 55 61 53 61 50 47 47 61 43 61 61 52 61 47 53 61 61 61 61 61 47 61 53 61 53 61 61 61 50 50 45 61 61 61 61 61 43 20 37 52 38 61 61 61 47 39 61 53 50 61 52 53 53 50 50 47 29 50 50 47 61 46 47 47 47 47 52 61 45 50 53 53 47 61 61 61 61 40 61 61 47 47 61 45 39 53 53 61 45 53 52 42 53 57 57 39 40 53 53 50 53 52 53 53 53 45 47 25 57 57 50 38 39 52 57 57 57 45 57 47 40 52 35 38 47 45 53 53 50 53 57 45 52 52 47 42 33 52 30 52 23 45 45 52 40 43 50 50 57 53 53 45 53 53 57 45 47 39 40 53 45 32 46 43 45 45 40 28 57 37 41 50 57 34 52 57 52 27 53 37 23 10 47 24 32 50 53 32 34 52 20 53 36 52 39 57 53 53 39 38 37 41 36 9 52 38 39 23 36 45 38 42 37 26 15 29 47 47 30 39 42 33 40 29 28 41 18 38 21 33 43 35 33 57 38 53 33 42 35 50 42 42 38 30 33 35 42 38 52 42 52 19 25 53 36 10 17 25 11 24 21 19 11 9 25 36 19 13 26 40 42 53 29 40 42 37 25 33 28 34 24 21 11 4 4 9 21 57 38 30 36 30 17 30 35 37 37 41 37 47 28 37 37 29 18 13 30 31 33 13 6 23 53 30 22 22 6 33 40 28 35 43 28 57 30 23 51 48 33 33 48 30 45 44 32 31 51 30 29 21 32 35 20 30 30 12 32 25 44 19 18 13 12 33 25 51 28 35 20 28 28 20 33 39 48 47 39 27 22 29 9 45 16 29 28 34 34 18 46 29 33 20 46 33 25 22 9 10 8 9 15 27 46 26 32 27 24 26 21 11 9 11 23 26 11 19 35 29 41 25 16 29 20 26 29 43 17 31 19 26 14 51 30 27 28 33 28 23 41 28 46 19 16 25 19 36 13 20 27 34 31 31 17 26 51 23 15 27 34 39 34 27 51 29 17 10 7 6 15 34 17 25 15 43 28 24 25 20 28 9 7 6 7 9 14 35 10 11 5 5 9 29 35 27 11 14 17 7 20 31 31 28 8 7 7 7 13 9 5 7 9 18 33 38 22 8 17 35 14 20 24 29 22 23 21 38 21 23 27 9 22 14 38 30 10 5 8 8 8 19 26 25 35 6 13 8 12 21 9 26 11 28 11 28 14 42 10 29 10 39 28 34 8 6 4 17 13 17 37 29 23 12 7 5 24 37 26 9 10 5 9 7 27 15 25 15 8 16 19 16 20 5 4 20 29 18 6 6 8 14 6 5 9 27 21 6 14 18 7 10 14 15 27 5 12 9 6 12 18 4 4 6 9 2 6 16 7 8 23 26 16 10 7 27 6 5 5 11 24 6 2 2 8 18 5 4 17 5 6 12 19 22 12 15 6 10 5 6 13 8 6 6 4 10 9 7 10 6 9 12 12 5 8 18 17 8 3 2 1 3 5 5 3 8 10

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_19297458_19298619
seq2: B6Ng01-102O15.b_46_1199 (reverse)

seq1  AGGAGCATATCAATAAAAACATAGATTGAAATTTTCTATATAAATTGTAA  50
      ||||||||||| |||||||||||  | |||   |||||||||||| | ||
seq2  AGGAGCATATC-ATAAAAACATAACTGGAA---TTCTATATAAATGGAAA  46

seq1  AAACAAAAATGGAA-CTTCTTGTAAAACTCTGTT-GAAGAGCTTTGAAAA  98
      |||||||||||||| ||||| ||  ||||||||| ||||||| |||||||
seq2  AAACAAAAATGGAACCTTCTGGT--AACTCTGTTGGAAGAGC-TTGAAAA  93

seq1  TACTCTTCATGAAAGGGATCAGAAATAATAGAATAGTATTCTTAACCTCA  148
      ||||||||||| ||||||||||||||||||||||||||||||    ||||
seq2  TACTCTTCATG-AAGGGATCAGAAATAATAGAATAGTATTCT---ACTCA  139

seq1  TGGGTCATCAAATCATGCACATTTAATTCTAC-ACTTCTATATACTCAGT  197
      |||||||||||||||||||||||||||||||| |||||||||||||||||
seq2  TGGGTCATCAAATCATGCACATTTAATTCTACAACTTCTATATACTCAGT  189

seq1  CATTAAGCAGTGCTCCCTTGGGATTGGAATTACAATGAAATACAGGGTCT  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTAAGCAGTGCTCCCTTGGGATTGGAATTACAATGAAATACAGGGTCT  239

seq1  AGTGGGAAGCCTTGGATATTAAATACCTATGATACCTATACTTTACTGTC  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGGAAGCCTTGGATATTAAATACCTATGATACCTATACTTTACTGTC  289

seq1  AAACTCACCCTGTGACTAACTCCTTAATGTTCTTTGTGTGTTAGAATGAA  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCACCCTGTGACTAACTCCTTAATGTTCTTTGTGTGTTAGAATGAA  339

seq1  ACATCATCCAACCAAAGATTTGCATCAACCAAAGATGATCATGGTTCTCC  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCATCCAACCAAAGATTTGCATCAACCAAAGATGATCATGGTTCTCC  389

seq1  AGGGGCCCATTGAGTCCTAAGGCAGCCAATCTTGTACAACTTCCAGGTGA  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGGCCCATTGAGTCCTAAGGCAGCCAATCTTGTACAACTTCCAGGTGA  439

seq1  GATTCTGAGGATTATTGTCAGTAAGGTAGCAAATACATTATCATAGTATC  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTCTGAGGATTATTGTCAGTAAGGTAGCAAATACATTATCATAGTATC  489

seq1  TTACTGGTACATGGTAAGGCTTACAATTCTATTCTTAGAGGAAGTAAGGG  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTGGTACATGGTAAGGCTTACAATTCTATTCTTAGAGGAAGTAAGGG  539

seq1  CATGTAACATAATTTATGAGAAATAAGAGCTTTACTTCACTTGTAAATTT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGTAACATAATTTATGAGAAATAAGAGCTTTACTTCACTTGTAAATTT  589

seq1  TTGGTGTGTTTAACACACATATTTATACTGTAATACACATATATTTCATT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTGTGTTTAACACACATATTTATACTGTAATACACATATATTTCATT  639

seq1  TTGCCTGTAAAATACTATCTAGACGAACACTGCCCATTTTCTTATGACCA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCCTGTAAAATACTATCTAGACGAACACTGCCCATTTTCTTATGACCA  689

seq1  GACATTGGTCATTTCTTGACTATAATGGCTATCTTAAATCATTCACATAT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATTGGTCATTTCTTGACTATAATGGCTATCTTAAATCATTCACATAT  739

seq1  TACTTTAAGGTGCTGTGGTAGTAGTATCCAGAGATTTGATGAAAATGTTA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTTAAGGTGCTGTGGTAGTAGTATCCAGAGATTTGATGAAAATGTTA  789

seq1  GTTTGCTAAGTTTCTCTTTTAAAATGGCTAAAATTGATGGCTTAAAAGTA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGCTAAGTTTCTCTTTTAAAATGGCTAAAATTGATGGCTTAAAAGTA  839

seq1  ATTAAATATTTTTGGTTGTCTTTGAGTTTGCAGAAAAATCAAATCTTCAG  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAAATATTTTTGGTTGTCTTTGAGTTTGCAGAAAAATCAAATCTTCAG  889

seq1  ATTTCTTGTTTCATAAGGTTTAGGGGTGTCTATGTATCACTTAAATGTAT  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCTTGTTTCATAAGGTTTAGGGGTGTCTATGTATCACTTAAATGTAT  939

seq1  AAGATAGAAATCAGAAGAACCAGGGAGGCAAGTCCTTTATTTTGGTAAAA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATAGAAATCAGAAGAACCAGGGAGGCAAGTCCTTTATTTTGGTAAAA  989

seq1  GATACACATGACAATACCATGCTTCTTGACACAATTAATCAGGTTAGATA  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATACACATGACAATACCATGCTTCTTGACACAATTAATCAGGTTAGATA  1039

seq1  TATTGATGTATTTCATAACTTTCTAAAATAACAAAGTAATAAACATATAA  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGATGTATTTCATAACTTTCTAAAATAACAAAGTAATAAACATATAA  1089

seq1  AATTTATTCCTTGAATATTTCTCTTCATTCATCTTCTTTTTTCAAATATA  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTATTCCTTGAATATTTCTCTTCATTCATCTTCTTTTTTCAAATATA  1139

seq1  TTTGATATTGAATTC  1162
      |||||||||||||||
seq2  TTTGATATTGAATTC  1154

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information