MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-176G09
Chromosome	9 (Build37)
Map Location	104,977,633 - 105,155,672
singlet/doublet	doublet
Overlap gene	Mrpl3, Nudt16, 1700080E11Rik, Nek11
Upstream gene	Acad11, Ccrl1, Hmgb1-rs16, Acpp, LOC100040921, Cpne4
Downstream gene	Aste1, Atp2c1, EG434434, LOC664981, Pik3r4, E330026B02Rik, EG665033, 1110001D15Rik, LOC669311, 6230410P16Rik, Wdr82, Ppm1m, Twf2, Tlr9, Alas1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Acad11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102632 MGI:2143169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccrl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:252837 MGI:2181676
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmgb1-rs16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15296 MGI:104765
definition	gene_synonym : Hmg1-rs16 note : high mobility group box 1, related sequence 16 pseudo : _no_value

name	Acpp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56318 MGI:1928480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Cpne4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74020 MGI:1921270
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrpl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94062 MGI:2137204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75686 MGI:1922936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700080E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73532 MGI:1920782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nek11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208583 MGI:2442276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aste1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66595 MGI:1913845
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235574 MGI:1889008
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434434 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434434 MGI:3646701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1414 ESTs, 9 Proteins

name	LOC664981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:664981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins pseudo : _no_value

name	Pik3r4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75669 MGI:1922919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	E330026B02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245026 MGI:2444259
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665033 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665033 MGI:3648134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins pseudo : _no_value

name	1110001D15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68553 MGI:1915803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669311 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	6230410P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wdr82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77305 MGI:1924555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 226 ESTs, 4 Proteins

name	Ppm1m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67905 MGI:1915155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Twf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23999 MGI:1346078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81897 MGI:1932389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alas1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11655 MGI:87989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acad11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803267 GeneID:102632 MGI:2143169
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-Coenzyme A dehydrogenase family, member 11 transcript_id : NM_175324.3

name	Ccrl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21746186 GeneID:252837 MGI:2181676
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor-like 1 transcript_id : NM_145700.1

name	Acpp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:92373432 GeneID:56318 MGI:1928480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acid phosphatase, prostate transcript_id : NM_207668.2

name	Acpp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46575783 GeneID:56318 MGI:1928480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acid phosphatase, prostate transcript_id : NM_019807.2

name	Cpne4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037332 GeneID:74020 MGI:1921270
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : copine IV transcript_id : NM_028719.1

name	Mrpl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131171 GeneID:94062 MGI:2137204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein L3 transcript_id : NM_053159.3

name	Nudt16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125656156 GeneID:75686 MGI:1922936
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 16 transcript_id : NM_029385.2

name	1700080E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802385 GeneID:73532 MGI:1920782
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700080E11 gene transcript_id : NM_028562.2

name	Nek11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363104 GeneID:208583 MGI:2442276
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NIMA (never in mitosis gene a)-related expressed kinase 11 transcript_id : NM_172461.2

name	Aste1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381893 GeneID:66595 MGI:1913845
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : asteroid homolog 1 (Drosophila) transcript_id : NM_025651.3

name	Atp2c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33186871 GeneID:235574 MGI:1889008
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++-sequestering transcript_id : NM_175025.2

name	EG434434 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260314 GeneID:434434 MGI:3646701
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 mRNAs, 1414 ESTs, 9 Proteins product : predicted gene, EG434434, transcript variant 2 transcript_id : XM_889722.3

name	Pik3r4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486788 GeneID:75669 MGI:1922919
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 transcript_id : NM_001081309.1

name	E330026B02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142353746 GeneID:245026 MGI:2444259
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E330026B02 gene transcript_id : NM_172927.2

name	1110001D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286815 GeneID:68553 MGI:1915803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110001D15 gene transcript_id : NM_026763.1

name	6230410P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759351 GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230410P16 gene transcript_id : NM_001039586.1

name	6230410P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759353 GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230410P16 gene transcript_id : NM_174846.4

name	Wdr82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386558 GeneID:77305 MGI:1924555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 226 ESTs, 4 Proteins product : WD repeat domain containing 82, transcript variant 1 transcript_id : XM_135109.7

name	Ppm1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801846 GeneID:67905 MGI:1915155
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1M transcript_id : NM_198931.2

name	Ppm1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802086 GeneID:67905 MGI:1915155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1M transcript_id : NM_026447.3

name	Twf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891654 GeneID:23999 MGI:1346078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : twinfilin, actin-binding protein, homolog 2 (Drosophila) transcript_id : NM_011876.3

name	Tlr9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13626029 GeneID:81897 MGI:1932389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 9 transcript_id : NM_031178.1

name	Alas1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956101 GeneID:11655 MGI:87989
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminolevulinic acid synthase 1 transcript_id : NM_020559.1

name	Acad11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74271799 CCDS:CCDS23458.1 GeneID:102632 MGI:2143169
definition	GO_function : GO:0003995 - acyl-CoA dehydrogenase activity [Evidence IEA]; GO:0050660 - FAD binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : acyl-Coenzyme A dehydrogenase family, member 11 protein_id : NP_780533.2

name	Ccrl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746187 CCDS:CCDS23459.1 GeneID:252837 MGI:2181676
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : chemokine receptor CCX-CKR; chemokine receptor CCR11; chemokine (C-C) receptor-like 1 product : chemokine (C-C motif) receptor-like 1 protein_id : NP_663746.1

name	Acpp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575782 CCDS:CCDS23460.1 GeneID:56318 MGI:1928480
definition	GO_function : GO:0003993 - acid phosphatase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; lysosomal acid phosphatase product : acid phosphatase, prostate isoform 1 protein_id : NP_997551.1

name	Acpp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46575784 GeneID:56318 MGI:1928480
definition	GO_function : GO:0003993 - acid phosphatase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; lysosomal acid phosphatase product : acid phosphatase, prostate isoform 2 protein_id : NP_062781.2

name	Cpne4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037333 CCDS:CCDS23461.1 GeneID:74020 MGI:1921270
definition	codon_start : 1 product : copine IV protein_id : NP_082995.1

name	Mrpl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981470 CCDS:CCDS23462.1 GeneID:94062 MGI:2137204
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005762 - mitochondrial large ribosomal subunit [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence TAS] codon_start : 1 product : mitochondrial ribosomal protein L3 protein_id : NP_444389.2

name	Nudt16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125656157 GeneID:75686 MGI:1922936
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 product : nudix-type motif 16 protein_id : NP_083661.2

name	1700080E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386322 CCDS:CCDS23463.1 GeneID:73532 MGI:1920782
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73532 protein_id : NP_082838.1

name	Nek11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369621 CCDS:CCDS23464.1 GeneID:208583 MGI:2442276
definition	GO_component : GO:0005730 - nucleolus [Evidence ISS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0031573 - intra-S DNA damage checkpoint [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 exception : mismatches in translation note : NIMA (never in mitosis gene a)- related kinase 11 product : NIMA (never in mitosis gene a)-related expressed kinase 11 protein_id : NP_766049.1

name	Aste1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560235 CCDS:CCDS23465.1 GeneID:66595 MGI:1913845
definition	codon_start : 1 product : asteroid homolog 1 protein_id : NP_079927.2

name	Atp2c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33186872 GeneID:235574 MGI:1889008
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence TAS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence TAS] [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0045045 - secretory pathway [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : ATPase, Ca++ transporting, type 2C, member 1 product : calcium-transporting ATPase 2C1 protein_id : NP_778190.2

name	EG434434 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82931053 GeneID:434434 MGI:3646701
definition	codon_start : 1 product : similar to QM protein isoform 2 protein_id : XP_894815.1

name	Pik3r4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486789 GeneID:75669 MGI:1922919
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 protein_id : NP_001074778.1

name	E330026B02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370430 CCDS:CCDS23468.1 GeneID:245026 MGI:2444259
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245026 protein_id : NP_766515.1

name	1110001D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286816 GeneID:68553 MGI:1915803
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : collagen type VI alpha 4 protein_id : NP_081039.1

name	6230410P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759352 CCDS:CCDS23469.1 GeneID:235582 MGI:2444085
definition	codon_start : 1 product : CG9886-like protein_id : NP_001034675.1

name	6230410P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759354 CCDS:CCDS23469.1 GeneID:235582 MGI:2444085
definition	codon_start : 1 product : CG9886-like protein_id : NP_777271.3

name	Wdr82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765108 GeneID:77305 MGI:1924555
definition	codon_start : 1 product : WD repeat domain containing 82 isoform 1 protein_id : XP_135109.3

name	Ppm1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39573724 CCDS:CCDS23471.1 GeneID:67905 MGI:1915155
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008420 - CTD phosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; protein phosphatase 2C eta product : protein phosphatase 2C eta isoform 2 protein_id : NP_945149.1

name	Ppm1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980930 CCDS:CCDS23472.1 GeneID:67905 MGI:1915155
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008420 - CTD phosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; protein phosphatase 2C eta product : protein phosphatase 2C eta isoform 1 protein_id : NP_080723.2

name	Twf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755224 CCDS:CCDS23473.1 GeneID:23999 MGI:1346078
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 note : twinfilin-2; protein tyrosine kinase 9 related protein; PTK9 protein typrotein tyrosine kinase 9-like (A6-related protein); protein tyrosine kinase 9-like (A6-related protein) product : twinfilin-like protein protein_id : NP_036006.1

name	Tlr9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626030 GeneID:81897 MGI:1932389
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0035197 - siRNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045356 - positive regulation of interferon-alpha biosynthesis [Evidence ISS]; GO:0045359 - positive regulation of interferon-beta biosynthesis [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence ISS]; GO:0009615 - response to virus [Evidence IMP] codon_start : 1 exception : mismatches in translation product : toll-like receptor 9 protein_id : NP_112455.1

name	Alas1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956102 GeneID:11655 MGI:87989
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003870 - 5-aminolevulinate synthase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006783 - heme biosynthesis [Evidence IEA] codon_start : 1 note : aminolevulinate synthase H; 5-aminolevulinate synthase; succinyl-CoA: glycine C-succinyl transferase product : aminolevulinic acid synthase 1 protein_id : NP_065584.1

name	LOC100040921 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040921
definition	number : 3 pseudo : _no_value

name	LOC100040921 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040921
definition	number : 2 pseudo : _no_value

name	LOC100040921 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040921
definition	number : 1 pseudo : _no_value

name	LOC669311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669311
definition	number : 2 pseudo : _no_value

name	LOC669311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669311
definition	number : 1 pseudo : _no_value

name	LOC664981 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260296 GeneID:664981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : hypothetical LOC664981 pseudo : _no_value transcript_id : XR_032330.1

name	EG665033 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260297 GeneID:665033 MGI:3648134
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 2 Proteins product : predicted gene, EG665033 pseudo : _no_value transcript_id : XR_035671.1

clone name	MSMg01-356L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-164E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141C23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-137E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526G09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515K18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481G17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-071K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-172G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151M21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373K10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-324K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362J17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-117I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022B01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-272M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016I03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-176G09.b	B6Ng01-176G09.g
ACC	GA003941	GA003942
length	1,236	1,125
definition	B6Ng01-176G09.b	B6Ng01-176G09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(105,154,430 - 105,155,672)	(104,977,633 - 104,978,752)
sequence	gaattcaggttacaaagtcaagttgtctgccaggaactagaaaaataaac caggactagggatgaagctcaatggtagagcataccccctccagcataca tacacatgcacactcatacgcacacgcttgcgcacgcatacacacacaca cactcacacaaacacacacacacacacatacacctgtctctgcctggacc aggggtcatccaaacaaaggcccttttaactgtgtctgtaaaggaaagct atcaaattctttattagggggccagccccggaaagcagacagaaagccat actgagattcctgtgctgagttctgttggcagtgagggctcactgaagga gttggtgtttcagcaagatttgcagtccactgtggaagaccatggaggtg tgagacaggagctctgcagagctggctgttaaaaactatatggactgtgc atttgtccctcagcctatgagtgtgctcatgtcactggaggcctccacat cctccactggactgtacatcagtctaaattgtcccttagcaaatgtgcag ctgcaagcaccagccccactaaatgttacagtgattgaaaattgcaatcc cttcccacgggcccagaaaagggctctttgtaatgaaatacagaggcagc agccatttgttgtgtggaataactgcctctctgggacttccacaatggac ccacagtgtcagtaaaaggcaggttcaccaagagaagaaatgacagctgc ctttattgcaggggaccctttattctccacggcttctgaacttggtgagt aattctaatggccgccttcaggaactgggacaccctgagaatagtctcag gcccggctggtgattcaccaaacagcccagatgaaccatctcctggttca cagcagggacagatggcttacaaaactgaaaacaaacaataaaccaacac tagcttgaagtttagaaattgataaataccctttctcagtcagcaaagtt ttggagcctttttcttcagttgggtgggcgaagttgtggtgctatccacg gtggacgtcgagtgccccattggctatggagaagaatgagatgagggtta gaaacataatacctattgatgagtctatcggaaggctatctctctcctct cttggggaggtgttgttctagccgtgttctgtctatcatgccttaggact gaaataggattaccccaagttcagcctagataactg	cggaattctctccgctcgctcgctcgctcgctcgctctgttctgcagctt ctaaagaagcgcctctgctgccgcgtgccctgccccggctctctttgtag gagcgtctcagaaacaacaaaagccgcgctggaaataatacgctgcacac tggagccaggagtccagcagtctgtggcaaagaaggcttcagggagggga gccattgcccagtgtccctcatctgtctttccagaaatttggggaaagaa taagaagtgctgaagtggaggccagggtcttactgacatgccactcagtc acacctgcctccccaaacacctgctgtccttgtcagaactaaagagaaag ggaaaagggaaataagactaacgtgtagaccagatagactgaggtaaagc ctgggcgcttccgaggatctgccgtgtgagtgggctcatagctgaggtga gcccgtcgctgatgccccagcagaaacaaatagagaccacagtgtgagct gtatacttactacattagatgtgttcatttatactgggaacagcatcaga gctttgagacgggaaaccctcaggtatggtggatacataaaagtgatgag aagtcactacttgcatcctatgtgacaatgtttatcagattagcacacag ttttcttatagggtgttttcctagttaaagctgagcctaaggttgggcat tggagaaaacggaatgtgatggttccctgggcagcgtcttggccacttcc cgatcaattgtaatgaggggcattaaaatagaactctttttatatactta gttgttcctaacagctgctgactaattttgactaaattatttatttctca ttgttaaaatgaaccagccctattttattgtttatgtaagtgtatttttt tttctctgaattgagtctacagaagctttgaggatcccaatattatccca aaactaaagtttcagcatccttgggatctttatcagcacctctgctaagg acatctgcttgtgaattccagacataatctgaaagttttcaggccataat tgttcttcaggagcttctgttaacctgtggcttctttctctgttttgctg atgtccgtcattctgtcctttaact
quality values	Open. Hide. 58 41 27 32 62 31 24 56 49 56 56 54 56 42 62 62 54 62 47 51 49 54 62 62 59 62 62 62 59 59 47 59 62 62 59 62 62 62 59 54 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 59 62 49 54 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 46 62 62 62 62 58 58 52 58 58 58 58 58 49 58 54 49 58 58 54 58 58 51 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 58 52 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 46 58 54 58 54 54 58 52 54 58 58 47 39 54 54 58 48 58 54 54 58 52 51 54 51 51 58 50 58 53 51 58 58 58 58 58 42 45 58 51 47 46 58 51 51 47 58 58 58 50 51 58 52 51 49 58 58 49 58 51 50 50 58 58 58 49 40 58 44 29 51 52 58 58 58 51 52 50 58 50 54 58 58 43 49 50 51 37 50 51 39 37 50 46 50 51 52 46 54 51 52 53 58 58 53 42 58 51 35 58 50 58 31 47 43 35 50 58 50 51 58 50 51 54 53 53 53 40 58 58 44 33 32 39 50 52 53 42 53 50 46 42 54 50 35 30 38 46 34 52 41 51 40 54 39 49 22 39 40 40 54 54 50 33 51 31 39 37 51 30 37 38 32 33 47 39 42 33 54 37 51 39 28 51 54 22 26 52 47 27 37 32 45 52 45 37 47 45 54 53 35 34 40 52 28 37 22 54 54 51 31 13 49 44 40 53 53 52 52 37 37 37 40 52 32 36 32 45 31 47 40 34 32 31 32 42 32 32 31 33 40 40 42 53 24 33 33 26 23 52 32 36 52 34 34 41 41 22 53 34 26 47 31 52 36 18 27 10 28 33 34 31 32 47 46 30 25 30 32 41 30 32 30 25 13 46 30 23 31 23 23 31 31 25 12 24 18 12 51 43 26 32 23 43 31 46 29 31 31 29 31 36 33 32 31 31 46 30 29 31 33 31 46 30 31 13 43 25 32 32 35 21 28 25 36 38 43 29 27 29 42 32 30 28 29 32 32 27 35 34 9 17 32 23 33 19 30 13 27 14 22 36 25 41 37 16 14 44 46 46 39 21 22 38 30 41 48 35 31 15 44 33 30 26 18 21 37 48 31 20 30 16 21 33 24 31 33 27 24 33 37 28 42 26 37 22 28 44 26 31 13 22 47 29 16 23 31 24 14 44 47 32 25 19 27 43 26 22 48 31 32 28 20 14 28 22 34 21 24 21 17 37 16 21 29 48 48 25 24 16 32 11 23 8 24 43 43 48 22 34 14 30 10 6 4 4 11 12 5 9 15 23 48 22 20 9 26 24 15 27 7 15 7 16 6 6 16 20 20 10 10 24 20 13 11 21 24 8 28 15 3 6 20 19 28 12 20 10 9 11 9 34 29 24 16 15 20 13 15 12 9 7 5 3 6 8 6 16 6 8 6 30 7 6 4 3 3 12 14 28 10 29 17 7 3 4 12 3 19 15 13 10 9 6 4 3 2 5 17 8 5 7 4 8 10 6 18 5 8 13 20 7 5 15 11 5 4 4 2 2 11 9 5 4 6 5 8 6 5 7 7 10 5 5 6 4 6 4 7 17 20 27 9 16 6 6 6 7 9 6 6 4 4 7 6 4 4 6 7 6 4 4 10 5 5 6 13 9 11 5 5 6 5 2 1 4 6 6 2 5 5 3 1 2 6 7 14 6 5 7 5 6 5 5 6 6 9 6 8 22 20 5 10 5 6 6 4 4 18 10 6 7 3 3 3 7 7 18 14 5 7 8	Open. Hide. 42 58 58 42 52 47 58 47 62 62 62 62 62 62 62 62 62 62 56 56 46 56 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 49 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 41 62 62 62 62 62 62 62 62 54 54 58 52 54 58 58 54 54 58 58 58 58 58 54 54 58 54 54 58 58 58 54 58 58 58 54 58 58 58 58 54 41 58 54 58 52 54 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 52 58 58 58 52 58 47 58 54 58 52 58 54 50 58 58 58 52 54 54 58 58 58 58 58 58 58 49 52 58 58 50 51 54 50 50 51 48 54 54 51 58 51 58 52 53 48 48 58 54 54 58 51 41 58 58 58 54 42 35 58 52 50 53 58 58 39 58 58 54 32 43 58 46 53 58 58 58 58 51 51 58 39 29 58 58 51 58 54 53 53 54 34 53 58 58 58 51 58 58 52 37 49 46 50 40 50 52 58 50 51 47 38 37 49 51 58 42 58 54 36 36 39 39 32 51 41 53 53 41 51 50 50 36 51 50 58 41 49 58 54 53 45 53 51 40 39 47 58 51 33 58 25 49 38 49 51 54 37 53 39 39 49 39 54 38 49 52 52 49 46 19 49 49 37 39 47 12 33 12 49 54 54 44 32 37 41 32 51 37 49 24 54 54 52 42 42 42 53 51 39 38 54 26 53 53 39 54 39 28 37 52 54 33 34 45 54 54 37 34 37 40 53 29 45 32 45 53 23 21 36 32 39 42 54 34 54 37 35 37 35 37 31 46 25 41 39 24 38 37 33 45 45 31 53 53 53 33 31 30 39 29 52 46 25 32 32 32 53 32 34 45 53 32 52 52 53 32 40 33 34 31 31 31 31 46 31 30 43 42 38 23 42 39 42 32 35 37 35 34 34 43 31 37 35 34 45 33 29 31 45 32 42 51 51 30 31 39 30 34 32 47 20 32 38 34 20 48 31 31 20 47 32 30 31 36 31 26 33 30 9 11 9 15 16 41 21 32 19 22 25 31 25 31 42 48 40 26 38 31 46 48 31 27 30 26 37 7 46 14 25 24 41 32 30 23 32 28 39 24 24 30 46 46 48 46 46 46 46 31 32 23 31 30 31 27 27 26 27 27 25 34 33 31 27 21 37 13 25 23 17 26 35 29 48 25 28 26 16 14 25 28 25 41 17 5 8 27 32 34 35 31 34 20 44 12 28 36 44 32 33 32 27 36 22 22 21 33 21 31 18 27 32 11 20 21 18 11 14 12 48 9 32 24 17 6 37 8 14 29 34 24 15 11 9 23 29 32 34 24 32 24 28 20 19 13 13 4 9 13 30 29 12 19 17 14 10 15 9 23 14 20 9 13 21 15 18 13 12 15 7 16 24 28 28 28 11 19 13 40 21 7 13 38 47 24 21 10 21 13 11 21 10 16 7 3 5 5 3 3 14 20 13 6 4 3 5 8 23 9 11 15 8 23 9 8 5 4 3 5 5 3 2 2 5 24 5 1 5 7 2 3 16 9 10 7 14 5 3 3 23 28 16 3 5 4 6 24 5 21 5 9 15 13 16 23 13 20 10 19 8 25 19 7 13 17 16 5 15 9 6 15

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_105154430_105155672
seq2: B6Ng01-176G09.b_46_1281 (reverse)

seq1  CAGTTATCTA-GCTGACATGTGGGCTGAATCAT-TATCAGTACATAAAGG  48
      |||||||||| ||||| |  |||| | |||| | | ||||| |   ||||
seq2  CAGTTATCTAGGCTGA-ACTTGGGGT-AATCCTATTTCAGTCC--TAAGG  46

seq1  CACTGATAGACAGAACA--GCTAGAGACAAACACTCCCC---AGA-GAGA  92
      || ||||||||||||||  |||||| ||||   ||||||   ||| ||||
seq2  CA-TGATAGACAGAACACGGCTAGA-ACAACACCTCCCCAAGAGAGGAGA  94

seq1  GAGATAGCCTGTCTGATAGACTCCATC-ATAGTTAATATGTTTCCTAAAC  141
      |||||||||| || |||||||| |||| |||| || ||||||||   |||
seq2  GAGATAGCCT-TCCGATAGACT-CATCAATAGGTATTATGTTTC--TAAC  140

seq1  CCTCATCCTTCATTC-TCTCCATAGCCAATGGGGCACTCGACGTCCCACC  190
      |||||||  |||||| ||||||||||||||||||||||||||||||   |
seq2  CCTCATC--TCATTCTTCTCCATAGCCAATGGGGCACTCGACGTCC--AC  186

seq1  CGTGGATAGCA-CACAACTTCGCCCACACAACCTGAAGAAAAAGGCTCCA  239
      ||||||||||| ||||||||||||||| ||| ||||||||||||||||||
seq2  CGTGGATAGCACCACAACTTCGCCCACCCAA-CTGAAGAAAAAGGCTCCA  235

seq1  AAACTTTGCTGACTGAGAAAGGGTATTTTATCAATTTCTAAACTTCAAGC  289
      ||||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  AAACTTTGCTGACTGAGAAAGGGTA-TTTATCAATTTCTAAACTTCAAGC  284

seq1  TAGTGTTGGTTTATTGTTTGTTTTCAGTTTTTGTAAGCCATCTGTCCCCT  339
      ||||||||||||||||||||||||||| ||||||||||||||||| ||||
seq2  TAGTGTTGGTTTATTGTTTGTTTTCAG-TTTTGTAAGCCATCTGT-CCCT  332

seq1  GCTGTGAACCAGGAGATGGTTCATCTGGGCTGTTTGGTGAATCACCAGCC  389
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGTGAACCAGGAGATGGTTCATCTGGGCTGTTTGGTGAATCACCAGCC  382

seq1  GGGCCTGAGACTATTCTCAGGGTGTCCCAGTTCCTGAAGGCGGCCATTAG  439
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCCTGAGACTATTCTCAGGGTGTCCCAGTTCCTGAAGGCGGCCATTAG  432

seq1  AATTACTCACCAAGTTCAGAAGCCGTGGAGAATAAAGGGTCCCCTGCAAT  489
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTACTCACCAAGTTCAGAAGCCGTGGAGAATAAAGGGTCCCCTGCAAT  482

seq1  AAAGGCAGCTGTCATTTCTTCTCTTGGTGAACCTGCCTTTTACTGACACT  539
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGCAGCTGTCATTTCTTCTCTTGGTGAACCTGCCTTTTACTGACACT  532

seq1  GTGGGTCCATTGTGGAAGTCCCAGAGAGGCAGTTATTCCACACAACAAAT  589
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGTCCATTGTGGAAGTCCCAGAGAGGCAGTTATTCCACACAACAAAT  582

seq1  GGCTGCTGCCTCTGTATTTCATTACAAAGAGCCCTTTTCTGGGCCCGTGG  639
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCTGCCTCTGTATTTCATTACAAAGAGCCCTTTTCTGGGCCCGTGG  632

seq1  GAAGGGATTGCAATTTTCAATCACTGTAACATTTAGTGGGGCTGGTGCTT  689
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGATTGCAATTTTCAATCACTGTAACATTTAGTGGGGCTGGTGCTT  682

seq1  GCAGCTGCACATTTGCTAAGGGACAATTTAGACTGATGTACAGTCCAGTG  739
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCTGCACATTTGCTAAGGGACAATTTAGACTGATGTACAGTCCAGTG  732

seq1  GAGGATGTGGAGGCCTCCAGTGACATGAGCACACTCATAGGCTGAGGGAC  789
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGATGTGGAGGCCTCCAGTGACATGAGCACACTCATAGGCTGAGGGAC  782

seq1  AAATGCACAGTCCATATAGTTTTTAACAGCCAGCTCTGCAGAGCTCCTGT  839
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGCACAGTCCATATAGTTTTTAACAGCCAGCTCTGCAGAGCTCCTGT  832

seq1  CTCACACCTCCATGGTCTTCCACAGTGGACTGCAAATCTTGCTGAAACAC  889
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACACCTCCATGGTCTTCCACAGTGGACTGCAAATCTTGCTGAAACAC  882

seq1  CAACTCCTTCAGTGAGCCCTCACTGCCAACAGAACTCAGCACAGGAATCT  939
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTCCTTCAGTGAGCCCTCACTGCCAACAGAACTCAGCACAGGAATCT  932

seq1  CAGTATGGCTTTCTGTCTGCTTTCCGGGGCTGGCCCCCTAATAAAGAATT  989
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTATGGCTTTCTGTCTGCTTTCCGGGGCTGGCCCCCTAATAAAGAATT  982

seq1  TGATAGCTTTCCTTTACAGACACAGTTAAAAGGGCCTTTGTTTGGATGAC  1039
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATAGCTTTCCTTTACAGACACAGTTAAAAGGGCCTTTGTTTGGATGAC  1032

seq1  CCCTGGTCCAGGCAGAGACAGGTGTATGTGTGTGTGTGTGTGTTTGTGTG  1089
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGGTCCAGGCAGAGACAGGTGTATGTGTGTGTGTGTGTGTTTGTGTG  1082

seq1  AGTGTGTGTGTGTGTATGCGTGCGCAAGCGTGTGCGTATGAGTGTGCATG  1139
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTGTGTGTGTGTATGCGTGCGCAAGCGTGTGCGTATGAGTGTGCATG  1132

seq1  TGTATGTATGCTGGAGGGGGTATGCTCTACCATTGAGCTTCATCCCTAGT  1189
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATGTATGCTGGAGGGGGTATGCTCTACCATTGAGCTTCATCCCTAGT  1182

seq1  CCTGGTTTATTTTTCTAGTTCCTGGCAGACAACTTGACTTTGTAACCTGA  1239
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGTTTATTTTTCTAGTTCCTGGCAGACAACTTGACTTTGTAACCTGA  1232

seq1  ATTC  1243
      ||||
seq2  ATTC  1236

seq1: chr9_104977633_104978752
seq2: B6Ng01-176G09.g_58_1180

seq1  GAATTCTCTCCGCTCGCTCGCTCGCTCGCTCGCTCTGTTCTGCAGCTTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTCCGCTCGCTCGCTCGCTCGCTCGCTCTGTTCTGCAGCTTCT  50

seq1  AAAGAAGCGCCTCTGCTGCCGCGTGCCCTGCCCCGGCTCTCTTTGTAGGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGAAGCGCCTCTGCTGCCGCGTGCCCTGCCCCGGCTCTCTTTGTAGGA  100

seq1  GCGTCTCAGAAACAACAAAAGCCGCGCTGGAAATAATACGCTGCACACTG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCGTCTCAGAAACAACAAAAGCCGCGCTGGAAATAATACGCTGCACACTG  150

seq1  GAGCCAGGAGTCCAGCAGTCTGTGGCAAAGAAGGCTTCAGGGAGGGGAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCAGGAGTCCAGCAGTCTGTGGCAAAGAAGGCTTCAGGGAGGGGAGC  200

seq1  CATTGCCCAGTGTCCCTCATCTGTCTTTCCAGAAATTTGGGGAAAGAATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGCCCAGTGTCCCTCATCTGTCTTTCCAGAAATTTGGGGAAAGAATA  250

seq1  AGAAGTGCTGAAGTGGAGGCCAGGGTCTTACTGACATGCCACTCAGTCAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGTGCTGAAGTGGAGGCCAGGGTCTTACTGACATGCCACTCAGTCAC  300

seq1  ACCTGCCTCCCCAAACACCTGCTGTCCTTGTCAGAACTAAAGAGAAAGGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTGCCTCCCCAAACACCTGCTGTCCTTGTCAGAACTAAAGAGAAAGGG  350

seq1  AAAAGGGAAATAAGACTAACGTGTAGACCAGATAGACTGAGGTAAAGCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGGAAATAAGACTAACGTGTAGACCAGATAGACTGAGGTAAAGCCT  400

seq1  GGGCGCTTCCGAGGATCTGCCGTGTGAGTGGGCTCATAGCTGAGGTGAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGCGCTTCCGAGGATCTGCCGTGTGAGTGGGCTCATAGCTGAGGTGAGC  450

seq1  CCGTCGCTGATGCCCCAGCAGAAACAAATAGAGACCACAGTGTGAGCTGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGTCGCTGATGCCCCAGCAGAAACAAATAGAGACCACAGTGTGAGCTGT  500

seq1  ATACTTACTACATTAGATGTGTTCATTTATACTGGGAACAGCATCAGAGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACTTACTACATTAGATGTGTTCATTTATACTGGGAACAGCATCAGAGC  550

seq1  TTTGAGACGGGAAACCCTCAGGTATGGTGGATACATAAAAGTGATGAGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAGACGGGAAACCCTCAGGTATGGTGGATACATAAAAGTGATGAGAA  600

seq1  GTCACTACTTGCATCCTATGTGACAATGTTTATCAGATTAGCACACAGTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCACTACTTGCATCCTATGTGACAATGTTTATCAGATTAGCACACAGTT  650

seq1  TTCTTATAGGGTGTTTTCCTAGTTAAAGCTGAGCCTAAGGTTGGGCATTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTATAGGGTGTTTTCCTAGTTAAAGCTGAGCCTAAGGTTGGGCATTG  700

seq1  GAGAAAACGGAATGTGATGGTTCCCTGGGCAGCGTCTTGGCCACTTCCCG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAAAACGGAATGTGATGGTTCCCTGGGCAGCGTCTTGGCCACTTCCCG  750

seq1  ATCAATTGTAATGAGGGGCATTAAAATAGAACTCTTTTTATATACTTAGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAATTGTAATGAGGGGCATTAAAATAGAACTCTTTTTATATACTTAGT  800

seq1  TGTTCCTAACAGCTGCTGACTAATTTTGACTAAATTATTTATTTCTCATT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTCCTAACAGCTGCTGACTAATTTTGACTAAATTATTTATTTCTCATT  850

seq1  GTTAAAATGAACCAGCCCTATTTTATTGTTTATGTAAGTGTATTTTTTTT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAAATGAACCAGCCCTATTTTATTGTTTATGTAAGTGTATTTTTTTT  900

seq1  TCTCTGAATTGAGTCTACAGAAGCTTTGAGGATCCCAATATTAT-CCAAA  949
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  TCTCTGAATTGAGTCTACAGAAGCTTTGAGGATCCCAATATTATCCCAAA  950

seq1  ACTAAAG-TTCAGCATC--TTGGATC-TTATCAGCACCTCTGCTAAGGGA  995
      ||||||| |||||||||  | ||||| ||||||||||||||||||| |||
seq2  ACTAAAGTTTCAGCATCCTTGGGATCTTTATCAGCACCTCTGCTAA-GGA  999

seq1  CATCTGC-TGTGAA-TCCAGACATAATCTGAAAGTTTTCAGGCCATAAAA  1043
      ||||||| |||||| ||||||||||||||||||||||||||||||| || 
seq2  CATCTGCTTGTGAATTCCAGACATAATCTGAAAGTTTTCAGGCCAT-AAT  1048

seq1  TGTTC-TCA-GAGCTTCTGTAAACACTTGTGGGTTTCTTTCTCTTGTTTT  1091
      ||||| ||| |||||||||| |  || ||| || ||||||||||   |||
seq2  TGTTCTTCAGGAGCTTCTGTTA--ACCTGT-GGCTTCTTTCTCT--GTTT  1093

seq1  TGCTGAATGT-CGTCATTCTGT-CTTTAACT  1120
      ||||| |||| ||||||||||| ||||||||
seq2  TGCTG-ATGTCCGTCATTCTGTCCTTTAACT  1123

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information