MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-183L24
Chromosome	9 (Build37)
Map Location	106,940,408 - 107,016,090
singlet/doublet	doublet
Overlap gene	Dock3
Upstream gene	1110001D15Rik, LOC669311, 6230410P16Rik, Wdr82, Ppm1m, Twf2, Tlr9, Alas1, Wdr51a, Dusp7, Rpl29, Acy1, Abhd14a, Abhd14b, Pcbp4, Parp3, Rrp9, Iqcf1, Iqcf5, Iqcf3, Iqcf4, LOC100041096, Grm2, Tex264, Rad54l2, LOC100041128, Vprbp, Armet
Downstream gene	Mapkapk3, Cish, Hemk1, 6430571L13Rik, Cacna2d2, Tmem115, Cyb561d2, Tusc4, Zmynd10, Rassf1, Tusc2, Hyal2, Hyal1, Nat6, Hyal3, Ifrd2, BY080835, Sema3b, Gnai2, Slc38a3, Gnat1, Sema3f, Rbm5, Rbm6, Mon1a, Mst1r, 4921517D21Rik, Camkv, Traip, Ube1l, D330022A01Rik, 6230427J02Rik, 1700021K14Rik, Ihpk1, Gmppb, Rnf123, Amigo3, Mst1, Apeh, Bsn
Link	Open Mouse BAC browser

Click to get alignment info.

name	1110001D15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68553 MGI:1915803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669311 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669311
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	6230410P16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Wdr82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77305 MGI:1924555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 226 ESTs, 4 Proteins

name	Ppm1m (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67905 MGI:1915155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Twf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23999 MGI:1346078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81897 MGI:1932389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Alas1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11655 MGI:87989
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Wdr51a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70235 MGI:1917485
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dusp7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235584 MGI:2387100
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19944 MGI:99687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acy1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109652 MGI:87913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68644 MGI:1915894
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abhd14b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76491 MGI:1923741
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcbp4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59092 MGI:1890471
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235587 MGI:1891258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rrp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27966 MGI:2384313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74267 MGI:1921517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs, 6 Proteins

name	Iqcf5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75470 MGI:1922720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein

name	Iqcf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68265 MGI:1915515
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Iqcf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67320 MGI:1914570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041096 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Grm2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108068 MGI:1351339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 7 Proteins

name	Tex264 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21767 MGI:1096570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rad54l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:81000 MGI:1933196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041128 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Vprbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:321006 MGI:2445220
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armet (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74840 MGI:1922090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dock3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208869 MGI:2429763
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mapkapk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102626 MGI:2143163
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cish (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12700 MGI:103159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hemk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69536 MGI:1916786
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6430571L13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235599 MGI:2445137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cacna2d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56808 MGI:1929813
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem115 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56395 MGI:1930765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyb561d2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56368 MGI:1929280
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tusc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56032 MGI:1914482
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmynd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114602 MGI:2387863
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rassf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56289 MGI:1928386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tusc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80385 MGI:1931086
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyal2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15587 MGI:1196334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15586 MGI:96298
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nat6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56441 MGI:1888902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hyal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109685 MGI:1330288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ifrd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15983 MGI:1316708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BY080835 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434436 MGI:3612240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20347 MGI:107561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Gnai2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14678 MGI:95772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc38a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76257 MGI:1923507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gnat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14685 MGI:95778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sema3f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20350 MGI:1096347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83486 MGI:1933204
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19654 MGI:1338037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Mon1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72825 MGI:1920075
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mst1r (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19882 MGI:99614
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921517D21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67722 MGI:1914972
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Camkv (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235604 MGI:2384296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Traip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22036 MGI:1096377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74153 MGI:1349462
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D330022A01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320169 MGI:2443519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	6230427J02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68176 MGI:1915426
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700021K14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69398 MGI:1916648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	Ihpk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27399 MGI:1351633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gmppb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331026 MGI:2660880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84585 MGI:2148796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amigo3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320844 MGI:2444854
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mst1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15235 MGI:96080
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apeh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235606 MGI:88041
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12217 MGI:1277955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1110001D15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286815 GeneID:68553 MGI:1915803
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110001D15 gene transcript_id : NM_026763.1

name	6230410P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759351 GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230410P16 gene transcript_id : NM_001039586.1

name	6230410P16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88759353 GeneID:235582 MGI:2444085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230410P16 gene transcript_id : NM_174846.4

name	Wdr82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386558 GeneID:77305 MGI:1924555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 226 ESTs, 4 Proteins product : WD repeat domain containing 82, transcript variant 1 transcript_id : XM_135109.7

name	Ppm1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801846 GeneID:67905 MGI:1915155
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1M transcript_id : NM_198931.2

name	Ppm1m (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802086 GeneID:67905 MGI:1915155
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein phosphatase 1M transcript_id : NM_026447.3

name	Twf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133891654 GeneID:23999 MGI:1346078
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : twinfilin, actin-binding protein, homolog 2 (Drosophila) transcript_id : NM_011876.3

name	Tlr9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13626029 GeneID:81897 MGI:1932389
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 9 transcript_id : NM_031178.1

name	Alas1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956101 GeneID:11655 MGI:87989
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminolevulinic acid synthase 1 transcript_id : NM_020559.1

name	Wdr51a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037200 GeneID:70235 MGI:1917485
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 51A transcript_id : NM_027354.1

name	Dusp7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385539 GeneID:235584 MGI:2387100
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 7 transcript_id : NM_153459.3

name	Rpl29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982039 GeneID:19944 MGI:99687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L29 transcript_id : NM_009082.2

name	Acy1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802669 GeneID:109652 MGI:87913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminoacylase 1 transcript_id : NM_025371.2

name	Abhd14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22095336 GeneID:68644 MGI:1915894
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 14A transcript_id : NM_145919.1

name	Abhd14b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27753959 GeneID:76491 MGI:1923741
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : abhydrolase domain containing 14b transcript_id : NM_029631.2

name	Pcbp4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386736 GeneID:59092 MGI:1890471
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly(rC) binding protein 4 transcript_id : NM_021567.3

name	Parp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25014094 GeneID:235587 MGI:1891258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 3 transcript_id : NM_145619.2

name	Rrp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893319 GeneID:27966 MGI:2384313
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RRP9, small subunit (SSU) processome component, homolog (yeast) transcript_id : NM_145620.4

name	Iqcf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386562 GeneID:74267 MGI:1921517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 6 Proteins product : IQ motif containing F1, transcript variant 1 transcript_id : XM_486254.3

name	Iqcf5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260315 GeneID:75470 MGI:1922720
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 7 ESTs, 1 Protein product : IQ motif containing F5 transcript_id : XM_356185.4

name	Iqcf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354675 GeneID:68265 MGI:1915515
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing F3 transcript_id : NM_026645.3

name	Iqcf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54020726 GeneID:67320 MGI:1914570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif containing F4 transcript_id : NM_026090.2

name	LOC100041096 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260300 GeneID:100041096
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : similar to hCG1789065 transcript_id : XM_001475797.1

name	Grm2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260303 GeneID:108068 MGI:1351339
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 7 Proteins product : G protein-coupled receptor, family C, group 1, member B transcript_id : XM_001475814.1

name	Tex264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090462 GeneID:21767 MGI:1096570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 264 transcript_id : NM_001081654.1

name	Tex264 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090849 GeneID:21767 MGI:1096570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 264 transcript_id : NM_011573.2

name	Rad54l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126090611 GeneID:81000 MGI:1933196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rad54 like 2 (S. cerevisiae) transcript_id : NM_030730.2

name	LOC100041128 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260305 GeneID:100041128
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : similar to TAF4A RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : XM_001475846.1

name	Vprbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82617568 GeneID:321006 MGI:2445220
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Vpr (HIV-1) binding protein transcript_id : NM_001015507.1

name	Armet (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365315 GeneID:74840 MGI:1922090
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine-rich, mutated in early stage tumors transcript_id : NM_029103.3

name	Dock3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23510296 GeneID:208869 MGI:2429763
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dedicator of cyto-kinesis 3 transcript_id : NM_153413.1

name	Mapkapk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388197 GeneID:102626 MGI:2143163
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase-activated protein kinase 3 transcript_id : NM_178907.2

name	Cish (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129844 GeneID:12700 MGI:103159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytokine inducible SH2-containing protein transcript_id : NM_009895.3

name	Hemk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21539656 GeneID:69536 MGI:1916786
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HemK methyltransferase family member 1 transcript_id : NM_133984.1

name	6430571L13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368001 GeneID:235599 MGI:2445137
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430571L13 gene transcript_id : NM_175486.2

name	Cacna2d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475642 GeneID:56808 MGI:1929813
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium channel, voltage-dependent, alpha 2/delta subunit 2 transcript_id : NM_020263.2

name	Tmem115 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130595 GeneID:56395 MGI:1930765
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 115 transcript_id : NM_019704.2

name	Cyb561d2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363770 GeneID:56368 MGI:1929280
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-561 domain containing 2 transcript_id : NM_019720.3

name	Tusc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9256542 GeneID:56032 MGI:1914482
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor suppressor candidate 4 transcript_id : NM_018879.1

name	Zmynd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803032 GeneID:114602 MGI:2387863
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYND domain containing 10 transcript_id : NM_053253.3

name	Rassf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130657 GeneID:56289 MGI:1928386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras association (RalGDS/AF-6) domain family 1 transcript_id : NM_019713.3

name	Tusc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354375 GeneID:80385 MGI:1931086
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor suppressor candidate 2 transcript_id : NM_019742.3

name	Hyal2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45331201 GeneID:15587 MGI:1196334
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronoglucosaminidase 2 transcript_id : NM_010489.2

name	Hyal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354500 GeneID:15586 MGI:96298
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronoglucosaminidase 1 transcript_id : NM_008317.3

name	Nat6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365492 GeneID:56441 MGI:1888902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase 6 transcript_id : NM_019750.3

name	Hyal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30842787 GeneID:109685 MGI:1330288
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hyaluronoglucosaminidase 3 transcript_id : NM_178020.2

name	Ifrd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801695 GeneID:15983 MGI:1316708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interferon-related developmental regulator 2 transcript_id : NM_025903.2

name	BY080835 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486968 GeneID:434436 MGI:3612240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BY080835 transcript_id : NM_001081244.1

name	Sema3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421093 GeneID:20347 MGI:107561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B transcript_id : NM_001042779.1

name	Sema3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112421072 GeneID:20347 MGI:107561
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B transcript_id : NM_009153.2

name	Gnai2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387600 GeneID:14678 MGI:95772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha inhibiting 2 transcript_id : NM_008138.4

name	Slc38a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328321 GeneID:76257 MGI:1923507
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 38, member 3 transcript_id : NM_023805.2

name	Gnat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542897 GeneID:14685 MGI:95778
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein, alpha transducing 1 transcript_id : NM_008140.2

name	Sema3f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801980 GeneID:20350 MGI:1096347
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3 F transcript_id : NM_011349.3

name	Rbm5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328369 GeneID:83486 MGI:1933204
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 5 transcript_id : NM_148930.2

name	Rbm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357262 GeneID:19654 MGI:1338037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 6 transcript_id : NM_011251.2

name	Rbm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803537 GeneID:19654 MGI:1338037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 6 transcript_id : NM_029169.2

name	Mon1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363576 GeneID:72825 MGI:1920075
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MON1 homolog A (yeast) transcript_id : NM_028369.2

name	Mst1r (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677764 GeneID:19882 MGI:99614
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage stimulating 1 receptor (c-met-related tyrosine kinase) transcript_id : NM_009074.1

name	4921517D21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802953 GeneID:67722 MGI:1914972
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4921517D21 gene transcript_id : NM_026338.2

name	Camkv (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130190 GeneID:235604 MGI:2384296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CaM kinase-like vesicle-associated transcript_id : NM_145621.2

name	Traip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130111 GeneID:22036 MGI:1096377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TRAF-interacting protein transcript_id : NM_011634.3

name	Ube1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802750 GeneID:74153 MGI:1349462
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-activating enzyme E1-like transcript_id : NM_023738.3

name	D330022A01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351769 GeneID:320169 MGI:2443519
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330022A01 gene transcript_id : NM_177090.3

name	6230427J02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802918 GeneID:68176 MGI:1915426
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6230427J02 gene transcript_id : NM_026597.2

name	1700021K14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260307 GeneID:69398 MGI:1916648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : RIKEN cDNA 1700021K14 gene transcript_id : XM_001476112.1

name	Ihpk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254567 GeneID:27399 MGI:1351633
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inositol hexaphosphate kinase 1 transcript_id : NM_013785.2

name	Gmppb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626021 GeneID:331026 MGI:2660880
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GDP-mannose pyrophosphorylase B transcript_id : NM_177910.3

name	Rnf123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54027903 GeneID:84585 MGI:2148796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 123 transcript_id : NM_032543.1

name	Amigo3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373780 GeneID:320844 MGI:2444854
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adhesion molecule with Ig like domain 3 transcript_id : NM_177275.3

name	Mst1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982292 GeneID:15235 MGI:96080
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : macrophage stimulating 1 (hepatocyte growth factor-like) transcript_id : NM_008243.2

name	Apeh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122788 GeneID:235606 MGI:88041
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acylpeptide hydrolase transcript_id : NM_146226.1

name	Bsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487406 GeneID:12217 MGI:1277955
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bassoon transcript_id : NM_007567.2

name	1110001D15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286816 GeneID:68553 MGI:1915803
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 product : collagen type VI alpha 4 protein_id : NP_081039.1

name	6230410P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759352 CCDS:CCDS23469.1 GeneID:235582 MGI:2444085
definition	codon_start : 1 product : CG9886-like protein_id : NP_001034675.1

name	6230410P16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88759354 CCDS:CCDS23469.1 GeneID:235582 MGI:2444085
definition	codon_start : 1 product : CG9886-like protein_id : NP_777271.3

name	Wdr82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765108 GeneID:77305 MGI:1924555
definition	codon_start : 1 product : WD repeat domain containing 82 isoform 1 protein_id : XP_135109.3

name	Ppm1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39573724 CCDS:CCDS23471.1 GeneID:67905 MGI:1915155
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008420 - CTD phosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; protein phosphatase 2C eta product : protein phosphatase 2C eta isoform 2 protein_id : NP_945149.1

name	Ppm1m (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980930 CCDS:CCDS23472.1 GeneID:67905 MGI:1915155
definition	GO_component : GO:0005634 - nucleus [Evidence IDA]; GO:0008287 - protein serine/threonine phosphatase complex [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0008420 - CTD phosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA] [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IDA]; GO:0004722 - protein serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; protein phosphatase 2C eta product : protein phosphatase 2C eta isoform 1 protein_id : NP_080723.2

name	Twf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755224 CCDS:CCDS23473.1 GeneID:23999 MGI:1346078
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005856 - cytoskeleton [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence ISS]; GO:0005080 - protein kinase C binding [Evidence ISS] GO_process : GO:0007242 - intracellular signaling cascade [Evidence ISS] codon_start : 1 note : twinfilin-2; protein tyrosine kinase 9 related protein; PTK9 protein typrotein tyrosine kinase 9-like (A6-related protein); protein tyrosine kinase 9-like (A6-related protein) product : twinfilin-like protein protein_id : NP_036006.1

name	Tlr9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13626030 GeneID:81897 MGI:1932389
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0035197 - siRNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IMP]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045356 - positive regulation of interferon-alpha biosynthesis [Evidence ISS]; GO:0045359 - positive regulation of interferon-beta biosynthesis [Evidence ISS]; GO:0045078 - positive regulation of interferon-gamma biosynthesis [Evidence ISS]; GO:0009615 - response to virus [Evidence IMP] codon_start : 1 exception : mismatches in translation product : toll-like receptor 9 protein_id : NP_112455.1

name	Alas1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956102 GeneID:11655 MGI:87989
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0003870 - 5-aminolevulinate synthase activity [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006783 - heme biosynthesis [Evidence IEA] codon_start : 1 note : aminolevulinate synthase H; 5-aminolevulinate synthase; succinyl-CoA: glycine C-succinyl transferase product : aminolevulinic acid synthase 1 protein_id : NP_065584.1

name	Wdr51a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037201 CCDS:CCDS23474.1 GeneID:70235 MGI:1917485
definition	codon_start : 1 exception : mismatches in translation product : WD repeat domain 51A protein_id : NP_081630.1

name	Dusp7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83816911 CCDS:CCDS23475.1 GeneID:235584 MGI:2387100
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0004721 - phosphoprotein phosphatase activity [Evidence IEA]; GO:0004725 - protein tyrosine phosphatase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dual specificity phosphatase 7 protein_id : NP_703189.2

name	Rpl29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677781 CCDS:CCDS23476.1 GeneID:19944 MGI:99687
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 product : ribosomal protein L29 protein_id : NP_033108.1

name	Acy1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384746 CCDS:CCDS23477.1 GeneID:109652 MGI:87913
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0004046 - aminoacylase activity [Evidence IEA]; GO:0046983 - protein dimerization activity [Evidence IEA] codon_start : 1 product : aminoacylase 1 protein_id : NP_079647.1

name	Abhd14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22095337 GeneID:68644 MGI:1915894
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0006725 - aromatic compound metabolism [Evidence IEA]; GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : unclassified translation discrepancy note : down-regulated in Zic1 deficient cerebellar primordium; downregulated in Zic1 deficient cerebellum product : abhydrolase domain containing 14A protein_id : NP_666031.1

name	Abhd14b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27753960 CCDS:CCDS23478.1 GeneID:76491 MGI:1923741
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation product : abhydrolase domain containing 14b protein_id : NP_083907.2

name	Pcbp4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981202 CCDS:CCDS23479.1 GeneID:59092 MGI:1890471
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : poly(rC)-binding protein 4 product : poly(rC) binding protein 4 protein_id : NP_067542.2

name	Parp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25014095 CCDS:CCDS23480.1 GeneID:235587 MGI:1891258
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 note : NAD+ ADP-ribosyltransferase 3; Poly[ADP-ribose] synthetase-3; A DP-ribosyltransferase (NAD+; poly (ADP-ribose polymerase)-like 3; ADP-ribosyltransferase (NAD+; poly (ADP-ribose polymerase)-like 3; ADP-ribosyltransferase (NAD+, poly (ADP-ribose polymerase)-like 3 product : poly (ADP-ribose) polymerase family, member 3 protein_id : NP_663594.2

name	Rrp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704248 CCDS:CCDS23481.1 GeneID:27966 MGI:2384313
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006364 - rRNA processing [Evidence IEA] codon_start : 1 note : U3 snoRNP-associated 55-kDa protein; RNA, U3 small nucleolar interacting protein 2 product : U3 snoRNP-associated protein protein_id : NP_663595.1

name	Iqcf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765111 GeneID:74267 MGI:1921517
definition	codon_start : 1 product : IQ motif containing F1 isoform 1 protein_id : XP_486254.1

name	Iqcf5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38090080 GeneID:75470 MGI:1922720
definition	codon_start : 1 product : IQ motif containing F5 protein_id : XP_356185.1

name	Iqcf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83627711 GeneID:68265 MGI:1915515
definition	codon_start : 1 note : testis-specific IQ motif containing protein 2 product : IQ motif containing F3 protein_id : NP_080921.2

name	Iqcf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54020727 CCDS:CCDS23482.1 GeneID:67320 MGI:1914570
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 note : testis-specific IQ motif containing protein 1 product : IQ motif containing F4 protein_id : NP_080366.2

name	LOC100041096 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260301 GeneID:100041096
definition	codon_start : 1 product : similar to hCG1789065 protein_id : XP_001475847.1

name	Grm2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260304 GeneID:108068 MGI:1351339
definition	codon_start : 1 product : G protein-coupled receptor, family C, group 1, member B protein_id : XP_001475864.1

name	Tex264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090463 GeneID:21767 MGI:1096570
definition	codon_start : 1 product : testis expressed gene 264 protein_id : NP_001075123.1

name	Tex264 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090850 CCDS:CCDS23483.1 GeneID:21767 MGI:1096570
definition	codon_start : 1 product : testis expressed gene 264 protein_id : NP_035703.2

name	Rad54l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126090612 GeneID:81000 MGI:1933196
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0019901 - protein kinase binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0003712 - transcription cofactor activity [Evidence IDA] codon_start : 1 note : HCMV-interacting protein product : steroid receptor-interacting SNF2 domain protein protein_id : NP_109655.2

name	LOC100041128 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260306 GeneID:100041128
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475896.1

name	Vprbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82617569 CCDS:CCDS23485.1 GeneID:321006 MGI:2445220
definition	codon_start : 1 product : Vpr-binding protein protein_id : NP_001015507.1

name	Armet (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625813 CCDS:CCDS23486.1 GeneID:74840 MGI:1922090
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : arginine-rich, mutated in early stage tumors protein_id : NP_083379.2

name	Dock3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23510297 GeneID:208869 MGI:2429763
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0051020 - GTPase binding [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 exception : unclassified translation discrepancy note : presenilin-binding protein; modifier of cell adhesion product : dedicator of cyto-kinesis 3 protein_id : NP_700462.1

name	Mapkapk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542089 CCDS:CCDS23487.1 GeneID:102626 MGI:2143163
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : mitogen-activated protein kinase-activated protein kinase 3 protein_id : NP_849238.1

name	Cish (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753426 GeneID:12700 MGI:103159
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0009968 - negative regulation of signal transduction [Evidence IEA]; GO:0007205 - protein kinase C activation [Evidence IDA]; GO:0001558 - regulation of cell growth [Evidence IEA] codon_start : 1 note : cytokine-inducible SH2 protein product : cytokine inducible SH2-containing protein protein_id : NP_034025.1

name	Hemk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21539657 CCDS:CCDS23488.1 GeneID:69536 MGI:1916786
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : HemK methyltransferase family member 1 protein_id : NP_598745.1

name	6430571L13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28202049 CCDS:CCDS23489.1 GeneID:235599 MGI:2445137
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC235599 protein_id : NP_780695.1

name	Cacna2d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15529968 GeneID:56808 MGI:1929813
definition	GO_component : GO:0005786 - signal recognition particle (sensu Eukaryota) [Evidence IEA]; GO:0005891 - voltage-gated calcium channel complex [Evidence IDA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0005245 - voltage-gated calcium channel activity [Evidence IDA] GO_process : GO:0006816 - calcium ion transport [Evidence IC]; GO:0006614 - SRP-dependent cotranslational protein targeting to membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : alpha 2 delta calcium channel subunit; ducky product : calcium channel, voltage-dependent, alpha 2/delta subunit 2 protein_id : NP_064659.1

name	Tmem115 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790165 CCDS:CCDS23490.1 GeneID:56395 MGI:1930765
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : placental protein 6 product : PL6 protein protein_id : NP_062678.1

name	Cyb561d2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790029 CCDS:CCDS23491.1 GeneID:56368 MGI:1929280
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006118 - electron transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gene for 101F6 protein product : tumor suppressor, region 10 protein_id : NP_062694.1

name	Tusc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256543 CCDS:CCDS23492.1 GeneID:56032 MGI:1914482
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : nitrogen permase homolog product : G21 protein protein_id : NP_061367.1

name	Zmynd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982595 CCDS:CCDS23493.1 GeneID:114602 MGI:2387863
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : zinc finger, MYND domain-containing 10 protein_id : NP_444483.2

name	Rassf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790187 CCDS:CCDS23494.1 GeneID:56289 MGI:1928386
definition	codon_start : 1 note : 123F protein product : Ras association (RalGDS/AF-6) domain family 1 protein_id : NP_062687.1

name	Tusc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789955 CCDS:CCDS23495.1 GeneID:80385 MGI:1931086
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lung cancer candidiate, FUS; fusion 1; PDGFA associated protein 2 product : tumor suppressor candidate 2 protein_id : NP_062716.1

name	Hyal2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45331202 CCDS:CCDS23496.1 GeneID:15587 MGI:1196334
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0004415 - hyalurononglucosaminidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hyaluronidase 2 protein_id : NP_034619.2

name	Hyal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982262 CCDS:CCDS23497.1 GeneID:15586 MGI:96298
definition	GO_function : GO:0004415 - hyalurononglucosaminidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : hyaluronidase 1 protein_id : NP_032343.2

name	Nat6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789957 CCDS:CCDS23498.1 GeneID:56441 MGI:1888902
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007049 - cell cycle [Evidence IEA]; GO:0045786 - negative regulation of progression through cell cycle [Evidence IEA] codon_start : 1 note : fusion 2 product : N-acetyltransferase 6 protein_id : NP_062724.1

name	Hyal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29788991 CCDS:CCDS23499.1 GeneID:109685 MGI:1330288
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hyaluronidase 3 protein_id : NP_821139.1

name	Ifrd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385396 CCDS:CCDS23500.1 GeneID:15983 MGI:1316708
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : interferon-related developmental regulator 2 protein_id : NP_080179.1

name	BY080835 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486969 GeneID:434436 MGI:3612240
definition	codon_start : 1 product : hypothetical LOC434436 protein_id : NP_001074713.1

name	Sema3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421094 GeneID:20347 MGI:107561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : semaphorin 3B protein_id : NP_001036244.1

name	Sema3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112421073 CCDS:CCDS23501.1 GeneID:20347 MGI:107561
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : semaphorin 3B protein_id : NP_033179.2

name	Gnai2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054806 CCDS:CCDS23502.1 GeneID:14678 MGI:95772
definition	GO_function : GO:0005525 - GTP binding [Evidence ISS] [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007213 - acetylcholine receptor signaling, muscarinic pathway [Evidence IMP]; GO:0008283 - cell proliferation [Evidence IPI]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence TAS]; GO:0007193 - G-protein signaling, adenylate cyclase inhibiting pathway [Evidence ISS] [Evidence IMP]; GO:0008016 - regulation of heart contraction [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein, alpha inhibiting 2 protein_id : NP_032164.2

name	Slc38a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328322 CCDS:CCDS23503.1 GeneID:76257 MGI:1923507
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015297 - antiporter activity [Evidence IEA]; GO:0015186 - L-glutamine transporter activity [Evidence IDA]; GO:0005290 - L-histidine transporter activity [Evidence IDA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0006868 - glutamine transport [Evidence IDA]; GO:0015817 - histidine transport [Evidence IDA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : N system amino acids transporter NAT-1 protein_id : NP_076294.2

name	Gnat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680041 CCDS:CCDS23504.1 GeneID:14685 MGI:95778
definition	GO_component : GO:0005834 - heterotrimeric G-protein complex [Evidence ISS] [Evidence TAS]; GO:0005624 - membrane fraction [Evidence TAS] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence TAS] [Evidence ISS]; GO:0019001 - guanyl nucleotide binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0008283 - cell proliferation [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IDA]; GO:0007199 - G-protein signaling, coupled to cGMP nucleotide second messenger [Evidence TAS]; GO:0007602 - phototransduction [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence TAS] codon_start : 1 product : guanine nucleotide binding protein, alpha transducing 1 protein_id : NP_032166.1

name	Sema3f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543683 CCDS:CCDS23505.1 GeneID:20350 MGI:1096347
definition	GO_function : GO:0045499 - chemorepellant activity [Evidence IDA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0050919 - negative chemotaxis [Evidence IGI] [Evidence IDA]; GO:0001755 - neural crest cell migration [Evidence IMP] codon_start : 1 product : sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3 F protein_id : NP_035479.2

name	Rbm5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507333 CCDS:CCDS23506.1 GeneID:83486 MGI:1933204
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : RNA binding motif protein 5 protein_id : NP_683732.1

name	Rbm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755294 GeneID:19654 MGI:1338037
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy note : isoform a is encoded by transcript variant 1 product : RNA binding motif protein 6 isoform a protein_id : NP_035381.1

name	Rbm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82524276 CCDS:CCDS23507.1 GeneID:19654 MGI:1338037
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : RNA binding motif protein 6 isoform b protein_id : NP_083445.1

name	Mon1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312179 CCDS:CCDS23508.1 GeneID:72825 MGI:1920075
definition	GO_function : GO:0003674 - molecular_function [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : MON1 homolog A protein_id : NP_082645.1

name	Mst1r (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677765 CCDS:CCDS23509.1 GeneID:19882 MGI:99614
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0001725 - stress fiber [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation note : c-met-related tyrosine kinase; friend virus susceptibility 2; receptor protein tyrosine kinase, c-met-related product : macrophage stimulating 1 receptor protein_id : NP_033100.1

name	4921517D21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385842 CCDS:CCDS23510.1 GeneID:67722 MGI:1914972
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67722 protein_id : NP_080614.1

name	Camkv (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704242 GeneID:235604 MGI:2384296
definition	codon_start : 1 product : vesicle-associated calmodulin-binding protein protein_id : NP_663596.1

name	Traip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560535 CCDS:CCDS23511.1 GeneID:22036 MGI:1096377
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005057 - receptor signaling protein activity [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IPI] [Evidence IDA] codon_start : 1 product : TRAF-interacting protein protein_id : NP_035764.2

name	Ube1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794156 GeneID:74153 MGI:1349462
definition	GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0019782 - ISG15 activating enzyme activity [Evidence IDA]; GO:0004839 - ubiquitin activating enzyme activity [Evidence IEA] GO_process : GO:0032020 - ISG15-protein conjugation [Evidence IDA]; GO:0019941 - modification-dependent protein catabolism [Evidence IDA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : ubiquitin activating enzyme E1-like product : ubiquitin-activating enzyme E1-like protein_id : NP_076227.1

name	6230427J02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037107 GeneID:68176 MGI:1915426
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC68176 protein_id : NP_080873.1

name	D330022A01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893013 GeneID:320169 MGI:2443519
definition	codon_start : 1 product : hypothetical protein LOC320169 protein_id : NP_796064.1

name	1700021K14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260308 GeneID:69398 MGI:1916648
definition	codon_start : 1 product : hypothetical protein LOC69398 protein_id : XP_001476162.1

name	Ihpk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254568 CCDS:CCDS23514.1 GeneID:27399 MGI:1351633
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0050517 - inositol hexakisphosphate kinase activity [Evidence IEA] [Evidence ISS]; GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence ISS]; GO:0008440 - inositol trisphosphate 3-kinase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006020 - myo-inositol metabolism [Evidence ISS]; GO:0016310 - phosphorylation [Evidence ISS] codon_start : 1 note : inositol hexakisphosphate kinase 6 product : inositol hexaphosphate kinase 1 protein_id : NP_038813.2

name	Gmppb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244556 CCDS:CCDS23515.1 GeneID:331026 MGI:2660880
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004475 - mannose-1-phosphate guanylyltransferase activity [Evidence ISS]; GO:0016779 - nucleotidyltransferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA] codon_start : 1 product : GDP-mannose pyrophosphorylase B protein_id : NP_808578.1

name	Rnf123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54027904 GeneID:84585 MGI:2148796
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ubiquitin ligase product : ring finger protein 123 protein_id : NP_115932.1

name	Amigo3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893353 CCDS:CCDS23516.1 GeneID:320844 MGI:2444854
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence ISS] codon_start : 1 note : alivin 3; amphoterin induced gene and ORF 3 product : adhesion molecule with Ig like domain 3 protein_id : NP_796249.1

name	Mst1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982293 GeneID:15235 MGI:96080
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0007596 - blood coagulation [Evidence IEA]; GO:0007566 - embryo implantation [Evidence IC]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : hepatocyte growth factor-like product : macrophage stimulating 1 (hepatocyte growth factor-like) protein_id : NP_032269.2

name	Apeh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122789 GeneID:235606 MGI:88041
definition	GO_function : GO:0004254 - acylaminoacyl-peptidase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : N-acylaminoacyl peptide hydrolase product : acylpeptide hydrolase protein_id : NP_666338.1

name	Bsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487407 CCDS:CCDS23517.1 GeneID:12217 MGI:1277955
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0000300 - peripheral to membrane of membrane fraction [Evidence ISS]; GO:0045202 - synapse [Evidence ISS] [Evidence IDA]; GO:0019717 - synaptosome [Evidence IEA] [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : presynaptic cytomatrix protein product : bassoon protein protein_id : NP_031593.2

name	LOC669311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669311
definition	number : 2 pseudo : _no_value

name	LOC669311 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669311
definition	number : 1 pseudo : _no_value

clone name	MSMg01-529F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-279H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-121I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270K13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387N07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067I17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362J17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-117I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336H14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-350L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-236A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328P04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-535C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-234J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-445G16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394N08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-309D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454N11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159E19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111O10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359M20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-291E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-161L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-536N19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-089G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284K23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270C23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-183L24.b	B6Ng01-183L24.g
ACC	GA009297	GA009298
length	1,208	977
definition	B6Ng01-183L24.b	B6Ng01-183L24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(106,940,408 - 106,941,593)	(107,015,114 - 107,016,090)
sequence	gaattctctctcccagctctttcagtttagttgctatgcttcatgtctgg caatccctggagacagatgctcaccacttagcacctctctcatgataact ggccaggtgcttgaaaactggcaagtagccccaaggttgtcctacagtgt acatcctgcagattttaggaaatctaatatttcctcctagagtcatttct taacttagatcgcttagctttatttttcaagttcctccagtttccccggc acattatcacagatagagcaaacatgctcaaagggtttgtttcataaaag caatgagagcccagtgccatggcctccatattcatttttattttctgctt tcctcttctcttcaacaaaatcttactgttcatcaacacaggagaaacta aagagcagagctactttggtggcatcagaacatgtctgtaacaaatgcag ggtcttcttacaatgttcccagcccttgcccttttactttttcaacaaat tgtcactgactttcatcatgtttttagagctggaatccagcacatccttt tccagggtagagctgggtgattctgccatatgccctcctaaaccagccag gtatatcctggggtcaacatccagtgccctggctttgtcaggtcatccct gcttgcatagcaacttacctttaagattccaccaagactcacacactgct gcacttcacccaacctactcacccacccagaccaccacacccttctccag gtctagtccattgactctgactctcccctgcatacactctctccaaccag acagatgtaatctggaccccatatcctgtgcctaggcctagtctggctag tcctgcttgcacaataaaccaattcttggactccctctgggacccactcc acctacctctcaatccatattctaacttcacaacctctcacaccacacct atcttcttcacacaggcagatctaccccagacatttcaggcttgggacca gaagacaacatccttgtattaccagttcagttcttctggttcacctgact tcatgttcaccccaaagctattttcctatattaaggctcacttggccttg cacattcttcttttcttccccaaacttgctctattcttatatccattctt tagaacaaagggagttccacatggcctcagatctcaattggcaatatgac caatatga	gaattctagtggcaggttgagtttcttcttctctgctgtcttagatttag aatgacccacagaaacagttaccacggacacacatcacacatcaccctca ccagagtatattcttagtaaaaacaaaataggaagtctccctaagacaga ctagaactgttgtgtctgtattaacttggagatatcaggaaggtctagtt cgtgaaggcaacaacaacagaggcgaagcttgtcatgcttaccaataccc tttcctgtacaaagagtaaaaagctgaaggacctactgagctaactttag gttttcttaaagcctcagctagcctgtggaggaaaagggcagtgctcccc ttctgtaaataccctgtctaattttgtcagagctgacaagtttcttacca cagttttcttgggagggggctctcagcctgtatccgttatggcattataa tcctaagccaagggctgctggtctgagaagagtttattttctaggaaggt ggctattggagggtttgagcaaatagtttatctgtatgccttgttgcttc ctcccaggtcctctgttttacctcaaaatgcaagaaatctgattaagtat ggaccattctaacttttagccacatttcactatcacacatcgtttattgg agttaaaacggtgttacaataaaatattagttctctgtggagtgaagtga taagaagtgccttagcctggggcacactgccattactgcccttgaaaaac atccagcaagaagcttcatgcctggggctcctggcacttgcactgctttg ggacaggagcttcagctccctttgtgtacagacaacagtaagcacctagc tagtgccccttcccccatccctaccatccctctgagcctcagggaaagtg ataggaggtgaaaggaggatagaaagaaagagtgactaaaagatggcaca tttgttagacgatgagagagagggaga
quality values	Open. Hide. 58 24 27 30 58 58 58 58 58 58 58 58 58 38 31 62 62 62 62 62 62 62 39 37 62 62 62 47 41 62 62 62 11 13 13 12 11 11 11 20 13 10 16 10 22 13 30 24 59 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 59 62 62 62 62 54 49 62 62 56 46 28 23 24 12 22 23 23 28 28 28 30 28 36 36 46 59 62 59 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 54 59 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 54 49 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 39 43 32 38 59 56 43 56 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 36 41 58 58 58 49 45 54 49 58 58 58 58 58 58 58 58 58 47 58 58 58 58 58 54 54 58 58 58 58 58 49 39 58 58 54 58 54 58 58 58 58 58 58 43 52 58 58 54 58 58 58 54 54 58 54 58 43 49 58 54 46 58 58 58 58 58 58 58 54 39 40 58 50 51 50 58 48 58 58 49 58 58 58 51 58 50 50 51 51 52 51 54 58 49 51 58 50 37 58 58 58 34 36 58 52 46 47 54 51 48 50 37 44 34 51 41 39 31 58 52 52 52 51 52 52 54 52 58 49 54 54 41 48 43 51 58 48 42 50 58 48 32 51 49 58 40 50 49 58 44 44 47 58 49 50 43 43 39 36 41 51 29 42 40 30 41 33 50 50 40 43 43 52 53 33 41 39 40 37 53 53 35 49 49 43 50 40 50 34 37 54 53 39 34 35 51 49 34 33 39 27 49 49 53 16 46 54 42 32 39 32 45 53 45 53 39 49 52 53 49 50 39 39 47 29 40 45 46 37 32 51 20 35 52 53 29 45 33 27 53 39 53 32 46 44 47 18 44 46 40 42 37 28 45 42 52 37 49 22 27 28 40 32 41 18 49 20 32 32 35 32 23 32 35 30 32 21 31 34 34 35 32 42 25 33 31 34 40 40 31 19 33 41 33 33 18 52 19 45 31 27 20 12 51 27 24 41 22 6 30 23 31 31 51 31 41 30 32 30 46 30 33 14 40 24 24 27 27 26 30 31 26 35 19 35 28 25 10 27 31 31 22 27 27 27 33 26 27 12 15 31 31 31 27 33 21 24 31 31 26 31 28 31 25 33 32 31 30 19 27 18 23 14 19 26 15 16 12 18 23 21 30 31 30 30 31 31 32 19 5 6 14 15 10 9 22 21 37 31 32 22 22 13 19 32 31 38 26 19 21 26 6 9 9 44 44 23 18 9 38 7 11 25 8 17 6 20 8 21 21 20 31 31 14 32 6 6 6 12 14 30 11 33 10 7 13 8 23 11 10 15 30 22 29 8 11 10 17 14 6 20 24 20 9 24 20 21 22 20 11 25 13 13 16 23 11 16 18 9 19 9 15 22 22 32 8 10 5 13 17 13 43 24 9 21 9 9 16 14 8 7 27 34 20 18 18 10 8 7 6 11 28 9 8 17 14 16 24 7 19 5 15 11 9 7 13 20 6 5 9 8 6 6 3 3 7 6 7 20 10 11 30 38 24 6 5 5 3 5 19 25 9 40 28 16 7 8 6 8 11 6 8 6 4 11 6 10 5 6 10 7 23 9 8 18 22 11 11 5 12 14 12 7 14 7 10 9 28 18 6 8 8 18 5 4 5 18 5 4 6 7 5 7 6 12 8 17 9 5 5 13 2 4 9 9 6 3 3 9 10 4 4 3 2 6 4 8 2 3 2 3 8 7 4 5 3 1 4	Open. Hide. 62 47 56 47 62 62 62 54 62 62 62 14 10 10 10 21 13 25 25 27 30 30 22 23 29 34 50 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 46 56 51 43 50 38 30 31 28 48 56 43 45 28 33 56 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 59 62 54 59 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 49 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 49 46 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 54 52 54 46 54 54 54 58 58 58 58 54 40 48 58 58 58 54 58 58 58 58 58 58 58 58 52 49 41 45 58 58 58 58 54 48 54 58 58 54 58 54 54 54 52 43 28 38 42 58 58 58 38 41 58 54 58 58 58 58 58 54 58 54 52 54 52 58 58 58 51 50 58 58 51 58 58 53 54 53 58 54 58 58 58 58 58 58 52 58 58 58 50 58 50 58 58 50 33 15 58 46 51 51 42 58 58 49 50 49 40 54 49 40 58 58 48 46 53 58 53 39 47 54 53 50 53 50 58 58 37 36 48 48 42 50 49 46 51 39 41 51 39 40 40 51 50 58 46 37 39 53 20 46 54 49 50 31 36 44 50 40 58 58 58 34 52 40 32 46 34 33 41 49 26 38 54 29 39 45 53 46 44 44 40 27 41 31 54 47 52 52 40 31 45 28 53 34 37 32 49 32 31 36 41 37 39 37 33 31 26 45 51 23 47 37 45 54 54 46 33 51 32 46 45 52 51 32 33 31 20 54 41 31 32 33 33 37 32 36 49 31 31 51 40 32 30 27 10 47 38 31 32 34 24 21 21 21 30 53 23 32 25 32 52 36 32 31 41 32 29 31 34 42 28 18 31 31 31 31 23 33 33 26 22 28 34 26 37 31 31 26 31 31 31 26 29 42 30 51 46 22 30 51 31 45 41 40 35 31 37 24 46 33 31 31 25 37 29 37 38 46 25 22 31 32 31 42 31 21 18 19 13 6 7 26 12 33 41 31 27 31 31 32 25 14 25 22 37 13 39 18 29 27 31 32 24 30 15 18 24 23 19 27 11 18 31 11 8 22 32 19 15 38 14 19 21 21 24 32 33 41 38 29 21 21 21 11 31 31 18 31 25 30 31 34 29 24 28 20 5 20 22 6 29 23 12 31 14 12 6 10 5 31 14 20 17 8 6 11

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_106940408_106941593
seq2: B6Ng01-183L24.b_49_1256

seq1  GAATTCTCTCTCCCAGCTCTTTCAGTTTAGTTGCTATGCTTCATGTCTGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTCTCCCAGCTCTTTCAGTTTAGTTGCTATGCTTCATGTCTGG  50

seq1  CAATCCCTGGAGACAGATGCTCACCACTTAGCACCTCTCTCATGATAACT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATCCCTGGAGACAGATGCTCACCACTTAGCACCTCTCTCATGATAACT  100

seq1  GGCCAGGTGCTTGAAAACTGGCAAGTAGCCCCAAGGTTGTCCTACAGTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAGGTGCTTGAAAACTGGCAAGTAGCCCCAAGGTTGTCCTACAGTGT  150

seq1  ACATCCTGCAGATTTTAGGAAATCTAATATTTCCTCCTAGAGTCATTTCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATCCTGCAGATTTTAGGAAATCTAATATTTCCTCCTAGAGTCATTTCT  200

seq1  TAACTTAGATCGCTTAGCTTTATTTTTCAAGTTCCTCCAGTTTCCCCGGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACTTAGATCGCTTAGCTTTATTTTTCAAGTTCCTCCAGTTTCCCCGGC  250

seq1  ACATTATCACAGATAGAGCAAACATGCTCAAAGGGTTTGTTTCATAAAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATTATCACAGATAGAGCAAACATGCTCAAAGGGTTTGTTTCATAAAAG  300

seq1  CAATGAGAGCCCAGTGCCATGGCCTCCATATTCATTTTTATTTTCTGCTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGAGAGCCCAGTGCCATGGCCTCCATATTCATTTTTATTTTCTGCTT  350

seq1  TCCTCTTCTCTTCAACAAAATCTTACTGTTCATCAACACAGGAGAAACTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTTCTCTTCAACAAAATCTTACTGTTCATCAACACAGGAGAAACTA  400

seq1  AAGAGCAGAGCTACTTTGGTGGCATCAGAACATGTCTGTAACAAATGCAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCAGAGCTACTTTGGTGGCATCAGAACATGTCTGTAACAAATGCAG  450

seq1  GGTCTTCTTACAATGTTCCCAGCCCTTGCCCTTTTACTTTTTCAACAAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTTCTTACAATGTTCCCAGCCCTTGCCCTTTTACTTTTTCAACAAAT  500

seq1  TGTCACTGACTTTCATCATGTTTTTAGAGCTGGAATCCAGCACATCCTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCACTGACTTTCATCATGTTTTTAGAGCTGGAATCCAGCACATCCTTT  550

seq1  TCCAGGGTAGAGCTGGGTGATTCTGCCATATGCCCTCCTAAACCAGCCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGGGTAGAGCTGGGTGATTCTGCCATATGCCCTCCTAAACCAGCCAG  600

seq1  GTATATCCTGGGGTCAACATCCAGTGCCCTGGCTTTGTCAGGTCATCCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATATCCTGGGGTCAACATCCAGTGCCCTGGCTTTGTCAGGTCATCCCT  650

seq1  GCTTGCATAGCAACTTACCTTTAAGATTCCACCAAGACTCACACACTGCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGCATAGCAACTTACCTTTAAGATTCCACCAAGACTCACACACTGCT  700

seq1  GCACTTCACCCAACCTACTCACCCACCCAGACCACCACACCCTTCTCCAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTTCACCCAACCTACTCACCCACCCAGACCACCACACCCTTCTCCAG  750

seq1  GTCTAGTCCATTGACTCTGACTCTCCCCTGCATACACTCTCTCCAACCAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTAGTCCATTGACTCTGACTCTCCCCTGCATACACTCTCTCCAACCAG  800

seq1  ACAGATGTAATCTGGACCCCATATCCTGTGCCTAGGCCTAGTCTGGCTAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGATGTAATCTGGACCCCATATCCTGTGCCTAGGCCTAGTCTGGCTAG  850

seq1  TCCTGCTTGCACAAT-AACCAATTCTTGGACTCCCTCTGGGACCCACTCC  899
      ||||||||||||||| ||||||||||||||||||||||||||||||||||
seq2  TCCTGCTTGCACAATAAACCAATTCTTGGACTCCCTCTGGGACCCACTCC  900

seq1  ACCTACCTCTCAATCCATATTCTAACTTCACAACCTCTCACACCACACCT  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTACCTCTCAATCCATATTCTAACTTCACAACCTCTCACACCACACCT  950

seq1  ATCTTCTTCACACAGGCAGATCTACCCCAGACATTTCAGGCTT-GGACCA  998
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  ATCTTCTTCACACAGGCAGATCTACCCCAGACATTTCAGGCTTGGGACCA  1000

seq1  GAAGAC-ACATCC-TGTA-TACCAGTTCAGTTCTTCT-GTTCACCTGACT  1044
      |||||| |||||| |||| |||||||||||||||||| ||||||||||||
seq2  GAAGACAACATCCTTGTATTACCAGTTCAGTTCTTCTGGTTCACCTGACT  1050

seq1  TCATG-TCACCC--AAGCTA-TTTCCTATATT-AGGCTCAACTTGCC-TG  1088
      ||||| ||||||  |||||| ||||||||||| |||||||  | ||| ||
seq2  TCATGTTCACCCCAAAGCTATTTTCCTATATTAAGGCTCACTTGGCCTTG  1100

seq1  CACA-TCTTCTTTTCTGCCCCAAAC-TGCTCTAT--CTATAT-CATTC-T  1132
      |||| ||||||||||| |||||||| ||||||||   ||||| ||||| |
seq2  CACATTCTTCTTTTCTTCCCCAAACTTGCTCTATTCTTATATCCATTCTT  1150

seq1  TAGAACAAAGGAAG-TCCACATG--CTCAGATCTC-ATTGCAAATATGAA  1178
      ||||||||||| || ||||||||  |||||||||| ||||  ||||||| 
seq2  TAGAACAAAGGGAGTTCCACATGGCCTCAGATCTCAATTGGCAATATGAC  1200

seq1  CAATATGA  1186
      ||||||||
seq2  CAATATGA  1208

seq1: chr9_107015114_107016090
seq2: B6Ng01-183L24.g_70_1046 (reverse)

seq1  TCTCCCTCTCTCTCATCGTCTAACAAATGTGCCATCTTTTAGTCACTCTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCTCTCTCTCATCGTCTAACAAATGTGCCATCTTTTAGTCACTCTT  50

seq1  TCTTTCTATCCTCCTTTCACCTCCTATCACTTTCCCTGAGGCTCAGAGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTATCCTCCTTTCACCTCCTATCACTTTCCCTGAGGCTCAGAGGG  100

seq1  ATGGTAGGGATGGGGGAAGGGGCACTAGCTAGGTGCTTACTGTTGTCTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGTAGGGATGGGGGAAGGGGCACTAGCTAGGTGCTTACTGTTGTCTGT  150

seq1  ACACAAAGGGAGCTGAAGCTCCTGTCCCAAAGCAGTGCAAGTGCCAGGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAAAGGGAGCTGAAGCTCCTGTCCCAAAGCAGTGCAAGTGCCAGGAG  200

seq1  CCCCAGGCATGAAGCTTCTTGCTGGATGTTTTTCAAGGGCAGTAATGGCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGGCATGAAGCTTCTTGCTGGATGTTTTTCAAGGGCAGTAATGGCA  250

seq1  GTGTGCCCCAGGCTAAGGCACTTCTTATCACTTCACTCCACAGAGAACTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGCCCCAGGCTAAGGCACTTCTTATCACTTCACTCCACAGAGAACTA  300

seq1  ATATTTTATTGTAACACCGTTTTAACTCCAATAAACGATGTGTGATAGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTTTATTGTAACACCGTTTTAACTCCAATAAACGATGTGTGATAGTG  350

seq1  AAATGTGGCTAAAAGTTAGAATGGTCCATACTTAATCAGATTTCTTGCAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTGGCTAAAAGTTAGAATGGTCCATACTTAATCAGATTTCTTGCAT  400

seq1  TTTGAGGTAAAACAGAGGACCTGGGAGGAAGCAACAAGGCATACAGATAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAGGTAAAACAGAGGACCTGGGAGGAAGCAACAAGGCATACAGATAA  450

seq1  ACTATTTGCTCAAACCCTCCAATAGCCACCTTCCTAGAAAATAAACTCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATTTGCTCAAACCCTCCAATAGCCACCTTCCTAGAAAATAAACTCTT  500

seq1  CTCAGACCAGCAGCCCTTGGCTTAGGATTATAATGCCATAACGGATACAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGACCAGCAGCCCTTGGCTTAGGATTATAATGCCATAACGGATACAG  550

seq1  GCTGAGAGCCCCCTCCCAAGAAAACTGTGGTAAGAAACTTGTCAGCTCTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGAGAGCCCCCTCCCAAGAAAACTGTGGTAAGAAACTTGTCAGCTCTG  600

seq1  ACAAAATTAGACAGGGTATTTACAGAAGGGGAGCACTGCCCTTTTCCTCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAATTAGACAGGGTATTTACAGAAGGGGAGCACTGCCCTTTTCCTCC  650

seq1  ACAGGCTAGCTGAGGCTTTAAGAAAACCTAAAGTTAGCTCAGTAGGTCCT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGCTAGCTGAGGCTTTAAGAAAACCTAAAGTTAGCTCAGTAGGTCCT  700

seq1  TCAGCTTTTTACTCTTTGTACAGGAAAGGGTATTGGTAAGCATGACAAGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCTTTTTACTCTTTGTACAGGAAAGGGTATTGGTAAGCATGACAAGC  750

seq1  TTCGCCTCTGTTGTTGTTGCCTTCACGAACTAGACCTTCCTGATATCTCC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGCCTCTGTTGTTGTTGCCTTCACGAACTAGACCTTCCTGATATCTCC  800

seq1  AAGTTAATACAGACACAACAGTTCTAGTCTGTCTTAGGGAGACTTCCTAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTAATACAGACACAACAGTTCTAGTCTGTCTTAGGGAGACTTCCTAT  850

seq1  TTTGTTTTTACTAAGAATATACTCTGGTGAGGGTGATGTGTGATGTGTGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTTTACTAAGAATATACTCTGGTGAGGGTGATGTGTGATGTGTGT  900

seq1  CCGTGGTAACTGTTTCTGTGGGTCATTCTAAATCTAAGACAGCAGAGAAG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGTGGTAACTGTTTCTGTGGGTCATTCTAAATCTAAGACAGCAGAGAAG  950

seq1  AAGAAACTCAACCTGCCACTAGAATTC  977
      |||||||||||||||||||||||||||
seq2  AAGAAACTCAACCTGCCACTAGAATTC  977

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information