MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-184B17
Chromosome	9 (Build37)
Map Location	44,863,065 - 45,037,175
singlet/doublet	doublet
Overlap gene	A530065I17Rik, Amica1, Scn2b, Scn4b, Tmprss4
Upstream gene	Usp2, Mfrp, Rnf26, LOC100042569, Mcam, Cbl, BC038167, Pdzd3, Nlrx1, Abcg4, Mizf, Tmem24, Dpagt1, H2afx, Hmbs, Vps11, LOC100043172, Hyou1, LOC100043178, Slc37a4, Trappc4, Rps25, Ccdc84, Foxr1, Upk2, Bcl9l, Blr1, Ddx6, LOC667406, LOC100042660, Treh, Phldb1, Arcn1, 1500035H01Rik, Tmem25, BC021608, Mll1, Atp5l, Ube4a, Cd3g, Cd3d, Cd3e, Eva1
Downstream gene	Il10ra, Tmprss13, Fxyd6, Fxyd2, Dscaml1, Cep164, LOC640094, Bace1, Rnf214, Pcsk7, Tagln, Sidt2, Pafah1b2, 2610005M20Rik, BC033915, Apoa1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Usp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53376 MGI:1858178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mfrp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:259172 MGI:2385957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Rnf26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213211 MGI:2388131
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Mcam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:84004 MGI:1933966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cbl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12402 MGI:88279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC038167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270150 MGI:2448587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170761 MGI:2429554
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlrx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270151 MGI:2429611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcg4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192663 MGI:1890594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mizf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102423 MGI:2429620
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem24 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71764 MGI:1919014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpagt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13478 MGI:1196396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	H2afx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15270 MGI:102688
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hmbs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15288 MGI:96112
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vps11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71732 MGI:1918982
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043172 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 402 ESTs, 32 Proteins pseudo : _no_value

name	Hyou1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12282 MGI:108030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043178 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs

name	Slc37a4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14385 MGI:1316650
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trappc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60409 MGI:1926211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rps25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75617 MGI:1922867
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc84 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382073 MGI:2685960
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382074 MGI:2685961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Upk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22269 MGI:98913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcl9l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80288 MGI:1933114
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Blr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12145 MGI:103567
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ddx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13209 MGI:104976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC667406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100042660 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	Treh (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58866 MGI:1926230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phldb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102693 MGI:2143230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arcn1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213827 MGI:2387591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1500035H01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76568 MGI:1923818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71687 MGI:1918937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC021608 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192653 MGI:2384760
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mll1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214162 MGI:96995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp5l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27425 MGI:1351597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ube4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140630 MGI:2154580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12502 MGI:88333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd3d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12500 MGI:88331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd3e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12501 MGI:88332
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eva1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14012 MGI:1289160
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A530065I17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319742 MGI:2442647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Amica1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270152 MGI:2685484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn2b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72821 MGI:106921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Scn4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399548 MGI:2687406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214523 MGI:2384877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il10ra (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16154 MGI:96538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmprss13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214531 MGI:2682935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59095 MGI:1890226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fxyd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11936 MGI:1195260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dscaml1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:114873 MGI:2150309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cep164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214552 MGI:2384878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC640094 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:640094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 51 ESTs, 24 Proteins pseudo : _no_value

name	Bace1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23821 MGI:1346542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf214 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235315 MGI:2444451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcsk7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18554 MGI:107421
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tagln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21345 MGI:106012
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Sidt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214597 MGI:2446134
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pafah1b2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18475 MGI:108415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610005M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70308 MGI:1917558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs

name	BC033915 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70661 MGI:2446296
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apoa1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11806 MGI:88049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052497 GeneID:53376 MGI:1858178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 2 transcript_id : NM_198092.2

name	Usp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052501 GeneID:53376 MGI:1858178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 2 transcript_id : NM_016808.2

name	Usp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114052525 GeneID:53376 MGI:1858178
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 2 transcript_id : NM_198091.2

name	Mfrp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95147557 GeneID:259172 MGI:2385957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs product : membrane-type frizzled-related protein transcript_id : NM_147126.2

name	Rnf26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:86262132 GeneID:213211 MGI:2388131
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 26 transcript_id : NM_153762.3

name	LOC100042569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259915 GeneID:100042569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100042569 transcript_id : XM_001478439.1

name	Mcam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12746443 GeneID:84004 MGI:1933966
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma cell adhesion molecule transcript_id : NM_023061.1

name	Cbl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:80978931 GeneID:12402 MGI:88279
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Casitas B-lineage lymphoma transcript_id : NM_007619.2

name	BC038167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486952 GeneID:270150 MGI:2448587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC038167 transcript_id : NM_001081369.1

name	Pdzd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875383 GeneID:170761 MGI:2429554
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 3 transcript_id : NM_133226.1

name	Nlrx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341501 GeneID:270151 MGI:2429611
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NLR family member X1 transcript_id : NM_178420.2

name	Abcg4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144926010 GeneID:192663 MGI:1890594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family G (WHITE), member 4 transcript_id : NM_138955.3

name	Mizf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142385795 GeneID:102423 MGI:2429620
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MBD2-interacting zinc finger transcript_id : NM_172162.2

name	Tmem24 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900514 GeneID:71764 MGI:1919014
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 24 transcript_id : NM_027909.2

name	Dpagt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982408 GeneID:13478 MGI:1196396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dolichyl-phosphate (UDP-N-acetylglucosamine) acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase) transcript_id : NM_007875.2

name	H2afx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981698 GeneID:15270 MGI:102688
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : H2A histone family, member X transcript_id : NM_010436.2

name	Hmbs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794511 GeneID:15288 MGI:96112
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxymethylbilane synthase transcript_id : NM_013551.1

name	Vps11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037258 GeneID:71732 MGI:1918982
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vacuolar protein sorting 11 (yeast) transcript_id : NM_027889.1

name	Hyou1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542332 GeneID:12282 MGI:108030
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypoxia up-regulated 1 transcript_id : NM_021395.2

name	LOC100043178 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149259948 GeneID:100043178
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 14 ESTs product : hypothetical protein LOC100043178 transcript_id : XM_001479485.1

name	Slc37a4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51592075 GeneID:14385 MGI:1316650
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 37 (glucose-6-phosphate transporter), member 4 transcript_id : NM_008063.2

name	Trappc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982682 GeneID:60409 MGI:1926211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein particle complex 4 transcript_id : NM_021789.2

name	Rps25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491883 GeneID:75617 MGI:1922867
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S25 transcript_id : NM_024266.3

name	Ccdc84 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:89886488 GeneID:382073 MGI:2685960
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 84 transcript_id : NM_201372.3

name	Foxr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388011 GeneID:382074 MGI:2685961
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box R1 transcript_id : NM_001033469.2

name	Upk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949818 GeneID:22269 MGI:98913
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : uroplakin 2 transcript_id : NM_009476.2

name	Bcl9l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206399 GeneID:80288 MGI:1933114
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell CLL/lymphoma 9-like transcript_id : NM_030256.2

name	Blr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42475949 GeneID:12145 MGI:103567
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Burkitt lymphoma receptor 1 transcript_id : NM_007551.2

name	Ddx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342194 GeneID:13209 MGI:104976
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 transcript_id : NM_181324.2

name	Ddx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131155 GeneID:13209 MGI:104976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 transcript_id : NM_007841.3

name	Treh (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130466 GeneID:58866 MGI:1926230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trehalase (brush-border membrane glycoprotein) transcript_id : NM_021481.2

name	Phldb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38455421 GeneID:102693 MGI:2143230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology-like domain, family B, member 1 transcript_id : NM_153537.3

name	Arcn1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54020741 GeneID:213827 MGI:2387591
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : archain 1 transcript_id : NM_145985.3

name	1500035H01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802295 GeneID:76568 MGI:1923818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1500035H01 gene transcript_id : NM_023831.3

name	Tmem25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373326 GeneID:71687 MGI:1918937
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 25 transcript_id : NM_027865.2

name	BC021608 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20336733 GeneID:192653 MGI:2384760
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC021608 transcript_id : NM_138951.1

name	Mll1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486681 GeneID:214162 MGI:96995
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed-lineage leukemia 1 transcript_id : NM_001081049.1

name	Atp5l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47058957 GeneID:27425 MGI:1351597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g transcript_id : NM_013795.4

name	Ube4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34147054 GeneID:140630 MGI:2154580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitination factor E4A, UFD2 homolog (S. cerevisiae) transcript_id : NM_145400.2

name	Cd3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753349 GeneID:12502 MGI:88333
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD3 antigen, gamma polypeptide transcript_id : NM_009850.1

name	Cd3d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098089 GeneID:12500 MGI:88331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD3 antigen, delta polypeptide transcript_id : NM_013487.2

name	Cd3e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803351 GeneID:12501 MGI:88332
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD3 antigen, epsilon polypeptide transcript_id : NM_007648.2

name	Eva1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802455 GeneID:14012 MGI:1289160
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : epithelial V-like antigen 1 transcript_id : NM_007962.3

name	A530065I17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369836 GeneID:319742 MGI:2442647
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A530065I17 gene transcript_id : NM_176993.3

name	Amica1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347555 GeneID:270152 MGI:2685484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adhesion molecule, interacts with CXADR antigen 1 transcript_id : NM_001005421.3

name	Scn2b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:130504904 GeneID:72821 MGI:106921
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, voltage-gated, type II, beta transcript_id : NM_001014761.2

name	Scn4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61889069 GeneID:399548 MGI:2687406
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sodium channel, type IV, beta transcript_id : NM_001013390.2

name	Tmprss4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130127 GeneID:214523 MGI:2384877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 4 transcript_id : NM_145403.2

name	Il10ra (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110624777 GeneID:16154 MGI:96538
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 10 receptor, alpha transcript_id : NM_008348.2

name	Tmprss13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185929 GeneID:214531 MGI:2682935
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protease, serine 13 transcript_id : NM_001013373.2

name	Fxyd6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110671330 GeneID:59095 MGI:1890226
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 6 transcript_id : NM_022004.6

name	Fxyd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937379 GeneID:11936 MGI:1195260
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 2 transcript_id : NM_052823.2

name	Fxyd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:122937374 GeneID:11936 MGI:1195260
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FXYD domain-containing ion transport regulator 2 transcript_id : NM_007503.3

name	Dscaml1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486900 GeneID:114873 MGI:2150309
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Down syndrome cell adhesion molecule-like 1 transcript_id : NM_001081270.1

name	Cep164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487016 GeneID:214552 MGI:2384878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 164 transcript_id : NM_001081373.1

name	Bace1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366371 GeneID:23821 MGI:1346542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : beta-site APP cleaving enzyme 1 transcript_id : NM_011792.4

name	Rnf214 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802103 GeneID:235315 MGI:2444451
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 214 transcript_id : NM_178709.3

name	Pcsk7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112181189 GeneID:18554 MGI:107421
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proprotein convertase subtilisin/kexin type 7 transcript_id : NM_008794.2

name	Tagln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362320 GeneID:21345 MGI:106012
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transgelin transcript_id : NM_011526.3

name	Sidt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802169 GeneID:214597 MGI:2446134
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SID1 transmembrane family, member 2 transcript_id : NM_172257.2

name	Pafah1b2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71067117 GeneID:18475 MGI:108415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : platelet-activating factor acetylhydrolase, isoform 1b, alpha2 subunit transcript_id : NM_008775.3

name	2610005M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149259920 GeneID:70308 MGI:1917558
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs product : RIKEN cDNA 2610005M20 gene transcript_id : XM_001478675.1

name	BC033915 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51890216 GeneID:70661 MGI:2446296
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC033915 transcript_id : NM_027498.2

name	Apoa1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803330 GeneID:11806 MGI:88049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apolipoprotein A-I transcript_id : NM_009692.2

name	Usp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052502 GeneID:53376 MGI:1858178
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : isoform Usp2-69 is encoded by transcript variant 1; ubiquitin specific protease 2; deubiquitinating enzyme product : ubiquitin-specific protease 2 isoform Usp2-69 protein_id : NP_058088.2

name	Usp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114052498 CCDS:CCDS23094.1 GeneID:53376 MGI:1858178
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : isoform Usp2-69 is encoded by transcript variant 3; ubiquitin specific protease 2; deubiquitinating enzyme product : ubiquitin-specific protease 2 isoform Usp2-69 protein_id : NP_932760.2

name	Usp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674279 CCDS:CCDS23095.1 GeneID:53376 MGI:1858178
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : isoform Usp2-45 is encoded by transcript variant 2; ubiquitin specific protease 2; deubiquitinating enzyme product : ubiquitin-specific protease 2 isoform Usp2-45 protein_id : NP_932759.1

name	Mfrp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22128653 GeneID:259172 MGI:2385957
definition	GO_process : GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : retinal degeneration 6 product : membrane-type frizzled-related protein protein_id : NP_667337.1

name	Rnf26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46048336 CCDS:CCDS23096.1 GeneID:213211 MGI:2388131
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 26 protein_id : NP_717095.2

name	LOC100042569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259916 GeneID:100042569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478489.1

name	Mcam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12746444 CCDS:CCDS23097.1 GeneID:84004 MGI:1933966
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence ISS] [Evidence IEA]; GO:0007157 - heterophilic cell adhesion [Evidence ISS] codon_start : 1 exception : mismatches in translation note : l-gicerin protein; melanoma adhesion molecule product : melanoma cell adhesion molecule protein_id : NP_075548.1

name	Cbl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:80978932 GeneID:12402 MGI:88279
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : Casitas B-lineage lymphoma protein_id : NP_031645.2

name	BC038167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486953 GeneID:270150 MGI:2448587
definition	codon_start : 1 product : hypothetical protein LOC270150 protein_id : NP_001074838.1

name	Pdzd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875384 CCDS:CCDS23099.1 GeneID:170761 MGI:2429554
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0030251 - guanylate cyclase inhibitor activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI] [Evidence IEA] GO_process : GO:0007168 - receptor guanylyl cyclase signaling pathway [Evidence ISS] codon_start : 1 exception : mismatches in translation note : natrium-phosphate cotransporter IIa C-terminal-associated protein 2; sodium-phosphate cotransporter IIa C-terminal-associated protein 2 product : PDZ domain containing 2 protein_id : NP_573489.1

name	Nlrx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30410746 CCDS:CCDS23100.1 GeneID:270151 MGI:2429611
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : NOD9 protein protein_id : NP_848507.1

name	Abcg4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144926011 CCDS:CCDS23101.1 GeneID:192663 MGI:1890594
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA] codon_start : 1 product : ATP-binding cassette, sub-family G (WHITE), member 4 protein_id : NP_620405.3

name	Mizf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26080426 CCDS:CCDS23102.1 GeneID:102423 MGI:2429620
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : MBD2 (methyl-CpG-binding protein)-interacting zinc finger protein protein_id : NP_751894.1

name	Tmem24 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:88900515 CCDS:CCDS23103.1 GeneID:71764 MGI:1919014
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : transmembrane protein 24 protein_id : NP_082185.2

name	Dpagt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982409 CCDS:CCDS23104.1 GeneID:13478 MGI:1196396
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA]; GO:0003975 - UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity [Evidence IDA] GO_process : GO:0006488 - dolichol-linked oligosaccharide biosynthesis [Evidence TAS]; GO:0006629 - lipid metabolism [Evidence IEA] codon_start : 1 note : dolichyl-phosphate alpha-N-acetylglucosaminephosphotransferase 2 product : UDP-N-acetylglucosamine-dolichyl-phosphateN-acetylglucosaminephosphotransferase protein_id : NP_031901.2

name	H2afx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106331 CCDS:CCDS23105.1 GeneID:15270 MGI:102688
definition	GO_component : GO:0000785 - chromatin [Evidence IDA]; GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] [Evidence ISS]; GO:0005657 - replication fork [Evidence IDA] GO_function : GO:0003684 - damaged DNA binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0000077 - DNA damage checkpoint [Evidence IMP]; GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IDA] [Evidence IMP]; GO:0000724 - double-strand break repair via homologous recombination [Evidence IMP]; GO:0007126 - meiosis [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] codon_start : 1 note : histone 5 protein 2ax product : H2A histone family, member X protein_id : NP_034566.1

name	Hmbs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794512 CCDS:CCDS23106.1 GeneID:15288 MGI:96112
definition	GO_function : GO:0004418 - hydroxymethylbilane synthase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006783 - heme biosynthesis [Evidence IEA]; GO:0006779 - porphyrin biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : porphobilinogen deaminase product : hydroxymethylbilane synthase protein_id : NP_038579.1

name	Vps11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037259 GeneID:71732 MGI:1918982
definition	GO_component : GO:0005884 - actin filament [Evidence IDA]; GO:0005769 - early endosome [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005488 - binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : vacuolar protein sorting 11 protein_id : NP_082165.1

name	Hyou1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542333 CCDS:CCDS23107.1 GeneID:12282 MGI:108030
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006950 - response to stress [Evidence TAS]; GO:0006986 - response to unfolded protein [Evidence IEA] codon_start : 1 exception : mismatches in translation note : calcium binding protein, 140 kDa; 150-kDa oxygen regulated protein; calcium binding protein 140; 170 kDa glucose regulated protein GRP170 product : hypoxia up-regulated 1 protein_id : NP_067370.2

name	LOC100043178 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149259949 GeneID:100043178
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479535.1

name	Slc37a4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51592076 CCDS:CCDS23108.1 GeneID:14385 MGI:1316650
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005351 - sugar porter activity [Evidence IEA] codon_start : 1 note : glucose-6-phosphatase, transport protein 1; transporter; glucose 6-phosphate transporter; solute carrier family 37 (glycerol-6-phosphate transporter), member 4 product : solute carrier family 37 (glucose-6-phosphate transporter), member 4 protein_id : NP_032089.2

name	Trappc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11140825 CCDS:CCDS23109.1 GeneID:60409 MGI:1926211
definition	GO_component : GO:0030425 - dendrite [Evidence IDA]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005801 - Golgi cis face [Evidence IEA]; GO:0005795 - Golgi stack [Evidence IDA]; GO:0045202 - synapse [Evidence IDA]; GO:0008021 - synaptic vesicle [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016358 - dendrite development [Evidence IDA]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0045212 - neurotransmitter receptor biosynthesis [Evidence TAS]; GO:0006810 - transport [Evidence IEA]; GO:0016192 - vesicle-mediated transport [Evidence TAS] codon_start : 1 note : syndecan binding protein 2; synbindin product : trafficking protein particle complex 4 protein_id : NP_068561.1

name	Rps25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28372479 GeneID:75617 MGI:1922867
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : ribosomal protein S25 protein_id : NP_077228.1

name	Ccdc84 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70912391 CCDS:CCDS23110.1 GeneID:382073 MGI:2685960
definition	codon_start : 1 product : coiled-coil domain containing 84 protein_id : NP_958760.2

name	Foxr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701638 CCDS:CCDS23111.1 GeneID:382074 MGI:2685961
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : forkhead box R1 protein_id : NP_001028641.1

name	Upk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949819 CCDS:CCDS23112.1 GeneID:22269 MGI:98913
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_process : GO:0016044 - membrane organization and biogenesis [Evidence IEA] codon_start : 1 note : uroplakin II product : uroplakin 2 protein_id : NP_033502.2

name	Bcl9l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91206400 GeneID:80288 MGI:1933114
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 note : nuclear co-factor of beta-catenin signalling product : B-cell CLL/lymphoma 9-like protein_id : NP_084532.2

name	Blr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:42475950 CCDS:CCDS23115.1 GeneID:12145 MGI:103567
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004945 - angiotensin type II receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0048535 - lymph node development [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : Burkitt lymphoma receptor 1 protein_id : NP_031577.2

name	Ddx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681159 CCDS:CCDS23116.1 GeneID:13209 MGI:104976
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 protein_id : NP_031867.1

name	Ddx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044467 CCDS:CCDS23116.1 GeneID:13209 MGI:104976
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 6; DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 product : DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 protein_id : NP_851841.1

name	Treh (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946884 CCDS:CCDS23117.1 GeneID:58866 MGI:1926230
definition	GO_component : GO:0005903 - brush border [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 product : trehalase protein_id : NP_067456.1

name	Phldb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38455422 CCDS:CCDS23118.1 GeneID:102693 MGI:2143230
definition	codon_start : 1 note : Ll5alpha product : pleckstrin homology-like domain, family B, member 1 protein_id : NP_705765.3

name	Arcn1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54020742 GeneID:213827 MGI:2387591
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030125 - clathrin vesicle coat [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0019028 - viral capsid [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : archain 1 protein_id : NP_666097.2

name	1500035H01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541828 CCDS:CCDS23119.1 GeneID:76568 MGI:1923818
definition	codon_start : 1 product : hypothetical protein LOC76568 protein_id : NP_076320.2

name	Tmem25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313687 CCDS:CCDS23120.1 GeneID:71687 MGI:1918937
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : transmembrane protein 25 protein_id : NP_082141.1

name	BC021608 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20336734 CCDS:CCDS23121.1 GeneID:192653 MGI:2384760
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC192653 protein_id : NP_620401.1

name	Mll1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486682 GeneID:214162 MGI:96995
definition	GO_component : GO:0044428 - nuclear part [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0009952 - anterior/posterior pattern formation [Evidence IGI] [Evidence IMP]; GO:0006306 - DNA methylation [Evidence IMP]; GO:0035162 - embryonic hemopoiesis [Evidence IMP]; GO:0051569 - regulation of histone H3-K4 methylation [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : trithorax Drosophila product : myeloid/lymphoid or mixed-lineage leukemia 1 protein_id : NP_001074518.1

name	Atp5l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980744 GeneID:27425 MGI:1351597
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005753 - proton-transporting ATP synthase complex (sensu Eukaryota) [Evidence ISS]; GO:0045263 - proton-transporting ATP synthase complex, coupling factor F(o) [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0008553 - hydrogen-exporting ATPase activity, phosphorylative mechanism [Evidence ISS]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence ISS] [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : F1F0-ATP synthase g subunit product : ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G protein_id : NP_038823.2

name	Ube4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34147055 CCDS:CCDS23122.1 GeneID:140630 MGI:2154580
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0000151 - ubiquitin ligase complex [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IEA] GO_process : GO:0016567 - protein ubiquitination [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ubiquitination factor E4A protein_id : NP_663375.2

name	Cd3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753350 CCDS:CCDS23123.1 GeneID:12502 MGI:88333
definition	GO_component : GO:0042105 - alpha-beta T cell receptor complex [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0046982 - protein heterodimerization activity [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0030159 - receptor signaling complex scaffold activity [Evidence ISS]; GO:0042608 - T cell receptor binding [Evidence ISS]; GO:0004888 - transmembrane receptor activity [Evidence ISS] [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] [Evidence ISS]; GO:0007163 - establishment and/or maintenance of cell polarity [Evidence ISS]; GO:0006461 - protein complex assembly [Evidence ISS]; GO:0015031 - protein transport [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS]; GO:0042110 - T cell activation [Evidence ISS] codon_start : 1 product : CD3 antigen, gamma polypeptide protein_id : NP_033980.1

name	Cd3d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61098090 CCDS:CCDS23124.1 GeneID:12500 MGI:88331
definition	GO_component : GO:0042105 - alpha-beta T cell receptor complex [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA]; GO:0045059 - positive thymic T cell selection [Evidence IMP]; GO:0006461 - protein complex assembly [Evidence NAS]; GO:0042110 - T cell activation [Evidence NAS] codon_start : 1 exception : mismatches in translation product : CD3 antigen, delta polypeptide protein_id : NP_038515.2

name	Cd3e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680886 CCDS:CCDS23125.1 GeneID:12501 MGI:88332
definition	GO_component : GO:0042105 - alpha-beta T cell receptor complex [Evidence IDA]; GO:0009897 - external side of plasma membrane [Evidence IDA] [Evidence ISS]; GO:0001772 - immunological synapse [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS]; GO:0042101 - T cell receptor complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IDA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0046649 - lymphocyte activation [Evidence IMP]; GO:0045060 - negative thymic T cell selection [Evidence IDA]; GO:0050850 - positive regulation of calcium-mediated signaling [Evidence IDA]; GO:0050731 - positive regulation of peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0042102 - positive regulation of T cell proliferation [Evidence IDA]; GO:0050852 - T cell receptor signaling pathway [Evidence IDA] codon_start : 1 product : CD3 antigen, epsilon polypeptide protein_id : NP_031674.1

name	Eva1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542623 CCDS:CCDS23126.1 GeneID:14012 MGI:1289160
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : epithelial V-like antigen product : epithelial V-like antigen 1 protein_id : NP_031988.2

name	A530065I17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892839 GeneID:319742 MGI:2442647
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; myelin protein zero-like protein 3; Ig-like domain-containing protein UNQ2966 product : myelin protein zero-like protein 3 isoform 1 protein_id : NP_795967.1

name	Amica1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61657932 CCDS:CCDS23128.1 GeneID:270152 MGI:2685484
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : dendritic-cell specific protein Crea7 product : adhesion molecule AMICA protein_id : NP_001005421.2

name	Scn2b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:67906204 GeneID:72821 MGI:106921
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA]; GO:0005248 - voltage-gated sodium channel activity [Evidence ISS] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sodium channel, voltage-gated, type II, beta polypeptide product : sodium channel, voltage-gated, type II, beta protein_id : NP_001014761.1

name	Scn4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61656194 CCDS:CCDS23130.1 GeneID:399548 MGI:2687406
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005272 - sodium channel activity [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : sodium channel, type IV, beta polypeptide; voltage gated sodium channel beta 4 subunit; sodium channel accessory subunit product : sodium channel, type IV, beta protein_id : NP_001013408.1

name	Tmprss4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703806 GeneID:214523 MGI:2384877
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] codon_start : 1 note : membrane-type serine protease 2 product : transmembrane protease, serine 4 protein_id : NP_663378.1

name	Il10ra (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680389 CCDS:CCDS23131.1 GeneID:16154 MGI:96538
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 product : interleukin 10 receptor, alpha protein_id : NP_032374.1

name	Tmprss13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185930 CCDS:CCDS23132.1 GeneID:214531 MGI:2682935
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005044 - scavenger receptor activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : mosaic serine protease-like product : transmembrane protease, serine 13 protein_id : NP_001013391.2

name	Fxyd6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11612657 CCDS:CCDS23133.1 GeneID:59095 MGI:1890226
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : FXYD domain-containing ion transport regulator 6 protein_id : NP_071287.1

name	Fxyd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16554572 CCDS:CCDS23134.1 GeneID:11936 MGI:1195260
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant b; sodium pump gamma chain; sodium/potassium-transporting ATPase gamma chain; ATPase, Na+/K+ transporting, gamma 1 polypeptide product : FXYD domain-containing ion transport regulator 2 isoform b protein_id : NP_439888.1

name	Fxyd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16554570 GeneID:11936 MGI:1195260
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0030955 - potassium ion binding [Evidence IEA]; GO:0031402 - sodium ion binding [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant a; sodium pump gamma chain; sodium/potassium-transporting ATPase gamma chain; ATPase, Na+/K+ transporting, gamma 1 polypeptide product : FXYD domain-containing ion transport regulator 2 isoform a protein_id : NP_031529.2

name	Dscaml1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486901 GeneID:114873 MGI:2150309
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS]; GO:0016337 - cell-cell adhesion [Evidence IEA]; GO:0007156 - homophilic cell adhesion [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : Down syndrome cell adhesion molecule-like protein product : Down syndrome cell adhesion molecule-like 1 protein_id : NP_001074739.1

name	Cep164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487017 GeneID:214552 MGI:2384878
definition	codon_start : 1 product : centrosomal protein 164 protein_id : NP_001074842.1

name	Bace1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981412 CCDS:CCDS23135.1 GeneID:23821 MGI:1346542
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0005768 - endosome [Evidence ISS]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004190 - aspartic-type endopeptidase activity [Evidence IEA]; GO:0009049 - aspartic-type signal peptidase activity [Evidence IEA]; GO:0004175 - endopeptidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004194 - pepsin A activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA] GO_process : GO:0050435 - beta-amyloid metabolism [Evidence ISS]; GO:0006509 - membrane protein ectodomain proteolysis [Evidence ISS]; GO:0006508 - proteolysis [Evidence IDA] codon_start : 1 exception : mismatches in translation note : APP beta-secretase product : beta-site APP cleaving enzyme 1 protein_id : NP_035922.3

name	Rnf214 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520119 CCDS:CCDS23136.1 GeneID:235315 MGI:2444451
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : ring finger protein 214 protein_id : NP_848824.1

name	Pcsk7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112181190 GeneID:18554 MGI:107421
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0004289 - subtilase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : proprotein convertase subtilisin/kexin type 7 protein_id : NP_032820.2

name	Tagln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755714 CCDS:CCDS23137.1 GeneID:21345 MGI:106012
definition	GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IMP]; GO:0007517 - muscle development [Evidence IEA] codon_start : 1 note : SM-22 alpha product : transgelin protein_id : NP_035656.1

name	Sidt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986551 CCDS:CCDS23138.1 GeneID:214597 MGI:2446134
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : SID1 transmembrane family, member 2 protein_id : NP_758461.1

name	Pafah1b2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254624 CCDS:CCDS23139.1 GeneID:18475 MGI:108415
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003847 - 1-alkyl-2-acetylglycerophosphocholine esterase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016788 - hydrolase activity, acting on ester bonds [Evidence IEA] GO_process : GO:0016042 - lipid catabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0007283 - spermatogenesis [Evidence IMP] [Evidence IGI] codon_start : 1 product : platelet-activating factor acetylhydrolase, isoform 1b, alpha2 subunit protein_id : NP_032801.2

name	2610005M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149259921 GeneID:70308 MGI:1917558
definition	codon_start : 1 product : hypothetical protein LOC70308 protein_id : XP_001478725.1

name	BC033915 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51890217 CCDS:CCDS23140.1 GeneID:70661 MGI:2446296
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC70661 protein_id : NP_081774.2

name	Apoa1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753096 GeneID:11806 MGI:88049
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA]; GO:0005615 - extracellular space [Evidence IDA] GO_function : GO:0008289 - lipid binding [Evidence IEA]; GO:0005319 - lipid transporter activity [Evidence IMP]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008203 - cholesterol metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0006869 - lipid transport [Evidence IEA]; GO:0042157 - lipoprotein metabolism [Evidence IEA]; GO:0030300 - regulation of cholesterol absorption [Evidence IDA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation function : acts as a cofactor for the lecithin cholesterol acyltransferase product : apolipoprotein A-I protein_id : NP_033822.1

name	LOC667406 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667406
definition	number : 1 pseudo : _no_value

name	LOC100043172 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259947 GeneID:100043172
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 402 ESTs, 32 Proteins product : similar to myosin, light polypeptide 6, alkali, smooth muscle and non-muscle pseudo : _no_value transcript_id : XR_034218.1

name	LOC100042660 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259919 GeneID:100042660
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to RIKEN cDNA 5730427N09 gene pseudo : _no_value transcript_id : XR_033776.1

name	LOC640094 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149259950 GeneID:640094
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 51 ESTs, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudo : _no_value transcript_id : XR_034358.1

clone name	MSMg01-324H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-546A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-370L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056D22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-362L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-169I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-148N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-189H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452K16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-548A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-416H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-432I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405F04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-056K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390J09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-147G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-203J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-266M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-507A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-273B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-461I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374P12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110F08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-194M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529P10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-270I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-442J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-357N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-281O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-346N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288I17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350G02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130I07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-125N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-184N15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-184B17.b	B6Ng01-184B17.g
ACC	GA009565	GA009566
length	486	920
definition	B6Ng01-184B17.b	B6Ng01-184B17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(44,863,065 - 44,863,556)	(45,036,641 - 45,037,175)
sequence	cataaaaatagaactgttttttcagtctgtagccaatctgaagcagaaga gcgcaatcagatcctcctgagagtcaaagaaccgctgatgagggtaaccg ggtacgattctagtaacaatccttgtccctgattgaggttgggtccggga cggctctttcaaaggtgactcccgacatgacgtcacttccggcaccacct gcatggtccccgggaggcgtaaagagggtgtgtaagtatcggaagagctg tcgggatgcagctggcaagaggaacagtaggaggccgtggctgcgctctc tttccactgctgagcatcctagtcgtccagggtgagtgcgccagctggct ggactccacttccggcagggggcgggggggtcaggaaagatggtcgcttt tccggttccgggttggggggtctcagaaaagcccccgctcggcttctgcg aaggaaggaaggaaggaagggaaggagggggtgtgg	gaattccagggcacttgcaacatcttgattgtatttgagagaccaaatct tttaagttcagactccattgtagagaacctgacctaagtttgaattcggg taaagtaaccggttggtacctagcattagtttctaggtttctgcccaaca agcccaccttctgtctgacatgcaccaatgcagaaggaaacagaagttaa gtttatggtttgactcccagcaccagccaattatgctaaaggacacagta gctctccaattagatgcttgccaggctacaaacactcacctccctcttgc tgctttctataaaacattaccctggtagatgtctggggctcctctccacc aaaaccgaactatgtgtcagctgggggctgagaggcccaagctagctcga ataaaggccttggtgtgattgcatcagatcggctcctgtctggtcttttg gggttcactagcacttccctggcactacagattgagaggtgcctagggga ccagtaaagctcacttctttctataagggcattcccagagatgattggca tgtcagagaacaaataagagggtaaaacctgccctgaatgtgggtggcac catcacttagactgtaatcttcaaatatagtagctttgaacccttcttaa caatattaaggcattacttgaagaaagggcccaacactgtcttgttttgt gtcacagtggagaagctatggttggttaagtgactatgtctacctatcct gattcttgcaccaggaccaactttcacccttgtgctggtcctgcatagtg tttggtggcatctgtgtgaggccaagatgtcacccaggtgcagacatatg tcatatatccacatgccacttggataactgctatttcagaagacccttag accttagactgtcctaccca
quality values	Open. Hide. 26 14 62 56 56 62 62 32 44 47 59 62 62 62 59 59 62 62 62 62 62 62 59 36 59 62 62 15 12 10 9 9 9 11 12 23 13 18 13 23 23 46 39 49 59 62 54 49 54 62 62 59 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 49 59 20 19 30 13 18 18 13 31 28 46 40 32 28 40 46 59 62 62 62 59 62 62 62 62 62 54 49 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 54 62 62 62 62 62 62 54 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 42 42 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 47 56 33 47 47 47 38 56 56 56 62 62 62 62 62 62 62 47 54 62 62 62 43 62 62 62 62 52 52 54 50 47 47 40 41 48 54 62 62 52 62 62 62 62 62 62 52 58 46 22 58 58 58 58 54 54 54 46 52 52 47 34 52 52 58 54 58 47 58 58 54 58 45 42 54 52 41 30 29 36 12 13 6	Open. Hide. 62 38 43 42 62 62 33 22 62 62 49 35 11 13 11 8 8 8 9 13 8 14 8 8 9 9 11 14 45 62 62 62 62 59 62 62 62 62 62 62 62 59 46 59 44 62 62 62 62 62 62 62 59 62 59 62 62 24 19 10 10 23 28 28 27 23 22 28 28 28 16 17 18 59 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 38 54 59 62 62 59 62 62 62 62 62 62 62 59 59 54 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 62 49 49 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 51 50 50 48 48 32 32 32 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 34 29 45 30 25 23 43 56 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 59 50 56 47 62 62 62 62 56 62 62 62 62 56 62 62 56 56 56 44 50 44 47 62 62 62 56 62 62 62 56 62 62 62 62 62 56 62 62 62 47 51 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 56 56 54 47 47 47 62 62 56 62 62 56 38 52 52 42 26 22 13 10 43 20 54 44 47 50 42 33 62 52 62 41 62 22 62 62 62 48 62 62 38 47 62 62 62 48 62 52 58 58 58 58 44 54 30 58 58 54 42 58 58 36 42 41 58 54 58 37 41 54 58 54 40 21 52 52 52 54 54 42 58 54 52 54 58 52 52 52 52 48 52 33 27 18 18 25 14 54 58 58 41 42 54 52 47 52 54 36 49 52 58 47 45 48 47 54 52 54 52 42 38 52 50 40 58 29 26 58 54 47 34 33 47 53 58 49 37 58 47 50 50 58 50 17 27 20 16 21 21 42 50 51 58 37 42 38 45 45 27 52 51 35 22 22 47 50 41 21 35 34 37 28 27 37 58 9 50 58 13 47 34 46 38 58 51 52 42 58 58 30 32 38 38 31 49 39 39 39 39 53 39 49 27 39 42 43 52 50 52 39 51 41 53 41 52 51 18 51 32 24 21 41 17 9 16 23 40 13 42 21 21 52 33 25 28 29 21 14 11 13 19 54 52 39 30 54 43 45 32 33 42 54 39 41 39 39 50 31 25 20 41 14 14 32 32 51 12 35 41 24 44 44 18 32 52 39 35 44 24 31 31 26 27 7 27 13 37 23 47 11 20 12 14 15 28 27 28 25 27 22 17 30 37 47 30 14 6 39 13 32 53 18 17 31 10 12 15 27 20 12 20 34 20 28 26 24 12 24 25 33 53 30 21 12 18 31 34 33 18 6 6 14 26 34 19 32 24 20 35 16 9 9 6 51 29 10 18 11 33 31 14 6 8 10 34 30 30 30 33 23 6 13 16 14 11 17 30 21 8 6 25 31 31 22

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_44863065_44863556
seq2: B6Ng01-184B17.b_42_533

seq1  GAATTCCATAAAAATAGAACTGTTTTTTCAGTCTGTAGCCAATCTGAAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCATAAAAATAGAACTGTTTTTTCAGTCTGTAGCCAATCTGAAGC  50

seq1  AGAAGAGCGCAATCAGATCCTCCTGAGAGTCAAAGAACCGCTGATGAGGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGAGCGCAATCAGATCCTCCTGAGAGTCAAAGAACCGCTGATGAGGG  100

seq1  TAACCGGGTACGATTCTAGTAACAATCCTTGTCCCTGATTGAGGTTGGGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACCGGGTACGATTCTAGTAACAATCCTTGTCCCTGATTGAGGTTGGGT  150

seq1  CCGGGACGGCTCTTTCAAAGGTGACTCCCGACATGACGTCACTTCCGGCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCGGGACGGCTCTTTCAAAGGTGACTCCCGACATGACGTCACTTCCGGCA  200

seq1  CCACCTGCATGGTCCCCGGGAGGCGTAAAGAGGGTGTGTAAGTATCGGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCTGCATGGTCCCCGGGAGGCGTAAAGAGGGTGTGTAAGTATCGGAA  250

seq1  GAGCTGTCGGGATGCAGCTGGCAAGAGGAACAGTAGGAGGCCGTGGCTGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCTGTCGGGATGCAGCTGGCAAGAGGAACAGTAGGAGGCCGTGGCTGC  300

seq1  GCTCTCTTTCCACTGCTGAGCATCCTAGTCGTCCAGGGTGAGTGCGCCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCTCTTTCCACTGCTGAGCATCCTAGTCGTCCAGGGTGAGTGCGCCAG  350

seq1  CTGGCTGGACTCCACTTCCGGCAGGGGGCGGGGGGGTCAGGAAAGATGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTGGACTCCACTTCCGGCAGGGGGCGGGGGGGTCAGGAAAGATGGT  400

seq1  CGCTTTTCCGGTTCCGGGTTGGGGGGTCTCAGAAAAGCCCCCGCTCGGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCTTTTCCGGTTCCGGGTTGGGGGGTCTCAGAAAAGCCCCCGCTCGGCT  450

seq1  TCTGCGAAGGAAGGAAGGAAGGAAGGGAAGGAGGGGGTGTGG  492
      ||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCGAAGGAAGGAAGGAAGGAAGGGAAGGAGGGGGTGTGG  492

seq1: chr9_45036641_45037175
seq2: B6Ng01-184B17.g_68_602 (reverse)

seq1  GGAATGCCCTTATAGAAAGAAGTGAGCTTTACTGGTCCCCTAGGCACCTC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATGCCCTTATAGAAAGAAGTGAGCTTTACTGGTCCCCTAGGCACCTC  50

seq1  TCAATCTGTAGTGCCAGGGAAGTGCTAGTGAACCCCAAAAGACCAGACAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATCTGTAGTGCCAGGGAAGTGCTAGTGAACCCCAAAAGACCAGACAG  100

seq1  GAGCCGATCTGATGCAATCACACCAAGGCCTTTATTCGAGCTAGCTTGGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCGATCTGATGCAATCACACCAAGGCCTTTATTCGAGCTAGCTTGGG  150

seq1  CCTCTCAGCCCCCAGCTGACACATAGTTCGGTTTTGGTGGAGAGGAGCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTCAGCCCCCAGCTGACACATAGTTCGGTTTTGGTGGAGAGGAGCCC  200

seq1  CAGACATCTACCAGGGTAATGTTTTATAGAAAGCAGCAAGAGGGAGGTGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACATCTACCAGGGTAATGTTTTATAGAAAGCAGCAAGAGGGAGGTGA  250

seq1  GTGTTTGTAGCCTGGCAAGCATCTAATTGGAGAGCTACTGTGTCCTTTAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTTGTAGCCTGGCAAGCATCTAATTGGAGAGCTACTGTGTCCTTTAG  300

seq1  CATAATTGGCTGGTGCTGGGAGTCAAACCATAAACTTAACTTCTGTTTCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAATTGGCTGGTGCTGGGAGTCAAACCATAAACTTAACTTCTGTTTCC  350

seq1  TTCTGCATTGGTGCATGTCAGACAGAAGGTGGGCTTGTTGGGCAGAAACC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCATTGGTGCATGTCAGACAGAAGGTGGGCTTGTTGGGCAGAAACC  400

seq1  TAGAAACTAATGCTAGGTACCAACCGGTTACTTTACCCGAATTCAAACTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAACTAATGCTAGGTACCAACCGGTTACTTTACCCGAATTCAAACTT  450

seq1  AGGTCAGGTTCTCTACAATGGAGTCTGAACTTAAAAGATTTGGTCTCTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCAGGTTCTCTACAATGGAGTCTGAACTTAAAAGATTTGGTCTCTCA  500

seq1  AATACAATCAAGATGTTGCAAGTGCCCTGGAATTC  535
      |||||||||||||||||||||||||||||||||||
seq2  AATACAATCAAGATGTTGCAAGTGCCCTGGAATTC  535

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information