MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-198J24
Chromosome	9 (Build37)
Map Location	120,900,233 - 121,051,428
singlet/doublet	doublet
Overlap gene	Ulk4
Upstream gene	Cmya1, Cx3cr1, Ccr8, Slc25a38, Rpsa, Snora62, EG546166, Mobp, LOC100039898, Myrip, LOC666044, Eif1b, LOC638068, Entpd3, Rpl14, 5830454E08Rik, LOC100040010, Ctnnb1
Downstream gene	Trak1, Cck, Lyzl4, Vipr1, LOC100040063, Sec22c, Deb1, Nktr, Kbtbd5, Hhatl, Ccdc13, Higd1a, Ccbp2, Cyp8b1, C730027P07Rik, C85492, LOC100040121, Snrk
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cmya1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22437 MGI:1333878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cx3cr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13051 MGI:1333815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12776 MGI:1201402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a38 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208638 MGI:2384782
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpsa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16785 MGI:105381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snora62 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104433 MGI:2148179
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546166 MGI:3647932
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mobp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	LOC100039898 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039898
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Myrip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245049 MGI:2384407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666044 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins pseudo : _no_value

name	Eif1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68969 MGI:1916219
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC638068 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:638068
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 9 Proteins pseudo : _no_value

name	Entpd3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215446 MGI:1321386
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67115 MGI:1914365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5830454E08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76100 MGI:1923350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs

name	LOC100040010 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Ctnnb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12387 MGI:88276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ulk4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209012 MGI:1921622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein

name	Trak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67095 MGI:1914345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12424 MGI:88297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lyzl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69032 MGI:1916282
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vipr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22354 MGI:109272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040063 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	Sec22c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215474 MGI:2447871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Deb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26901 MGI:1349474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nktr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18087 MGI:97346
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kbtbd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72330 MGI:1919580
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hhatl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74770 MGI:1922020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccdc13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434446 MGI:1920144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Higd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56295 MGI:1930666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59289 MGI:1891697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cyp8b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13124 MGI:1338044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C730027P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245050 MGI:3041196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C85492 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215494 MGI:2143424
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Snrk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20623 MGI:108104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmya1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486754 GeneID:22437 MGI:1333878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cardiomyopathy associated 1 transcript_id : NM_001081339.1

name	Cx3cr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299631 GeneID:13051 MGI:1333815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X3-C) receptor 1 transcript_id : NM_009987.3

name	Ccr8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331154 GeneID:12776 MGI:1201402
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 8 transcript_id : NM_007720.2

name	Slc25a38 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450144 GeneID:208638 MGI:2384782
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25, member 38 transcript_id : NM_144793.1

name	Rpsa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347305 GeneID:16785 MGI:105381
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein SA transcript_id : NM_011029.3

name	EG546166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803427 GeneID:546166 MGI:3647932
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546166 transcript_id : NM_001024730.2

name	Mobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31543261 GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated oligodendrocytic basic protein transcript_id : NM_008614.2

name	Mobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:108860693 GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated oligodendrocytic basic protein transcript_id : NM_001039364.2

name	Mobp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802901 GeneID:17433 MGI:108511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myelin-associated oligodendrocytic basic protein transcript_id : NM_001039365.2

name	Myrip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802457 GeneID:245049 MGI:2384407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myosin VIIA and Rab interacting protein transcript_id : NM_144557.3

name	Eif1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803572 GeneID:68969 MGI:1916219
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : eukaryotic translation initiation factor 1B transcript_id : NM_026892.2

name	Entpd3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142380176 GeneID:215446 MGI:1321386
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectonucleoside triphosphate diphosphohydrolase 3 transcript_id : NM_178676.3

name	Rpl14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373739 GeneID:67115 MGI:1914365
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L14 transcript_id : NM_025974.2

name	5830454E08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260352 GeneID:76100 MGI:1923350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs product : RIKEN cDNA 5830454E08 gene transcript_id : XM_001473897.1

name	LOC100040010 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260354 GeneID:100040010
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040010 transcript_id : XM_001473936.1

name	Ctnnb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560726 GeneID:12387 MGI:88276
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : catenin (cadherin associated protein), beta 1 transcript_id : NM_007614.2

name	Ulk4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260413 GeneID:209012 MGI:1921622
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 13 ESTs, 1 Protein product : unc-51-like kinase 4 (C. elegans) transcript_id : XM_001481114.1

name	Trak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124517684 GeneID:67095 MGI:1914345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trafficking protein, kinesin binding 1 transcript_id : NM_175114.3

name	Cck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130260 GeneID:12424 MGI:88297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cholecystokinin transcript_id : NM_031161.2

name	Lyzl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982636 GeneID:69032 MGI:1916282
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysozyme-like 4 transcript_id : NM_026915.2

name	Vipr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367730 GeneID:22354 MGI:109272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vasoactive intestinal peptide receptor 1 transcript_id : NM_011703.3

name	Sec22c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372397 GeneID:215474 MGI:2447871
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SEC22 vesicle trafficking protein-like C (S. cerevisiae) transcript_id : NM_178677.3

name	Deb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982638 GeneID:26901 MGI:1349474
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : differentially expressed in B16F10 1 transcript_id : NM_026794.2

name	Nktr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62526129 GeneID:18087 MGI:97346
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : natural killer tumor recognition sequence transcript_id : NM_010918.2

name	Kbtbd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802237 GeneID:72330 MGI:1919580
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch repeat and BTB (POZ) domain containing 5 transcript_id : NM_028202.2

name	Hhatl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312881 GeneID:74770 MGI:1922020
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hedgehog acyltransferase-like transcript_id : NM_029095.1

name	Ccdc13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702098 GeneID:434446 MGI:1920144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coiled-coil domain containing 13 transcript_id : NM_001033784.1

name	Higd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361374 GeneID:56295 MGI:1930666
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIG1 domain family, member 1A transcript_id : NM_019814.3

name	Ccbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371177 GeneID:59289 MGI:1891697
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine binding protein 2 transcript_id : NM_021609.3

name	Cyp8b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981807 GeneID:13124 MGI:1338044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome P450, family 8, subfamily b, polypeptide 1 transcript_id : NM_010012.2

name	C730027P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142386694 GeneID:245050 MGI:3041196
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA C730027P07 gene transcript_id : NM_177743.3

name	C85492 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:60593062 GeneID:215494 MGI:2143424
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence C85492 transcript_id : NM_153540.3

name	LOC100040121 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260356 GeneID:100040121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040121 transcript_id : XM_001474116.1

name	Snrk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526941 GeneID:20623 MGI:108104
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SNF related kinase transcript_id : NM_133741.1

name	Cmya1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486755 GeneID:22437 MGI:1333878
definition	GO_component : GO:0005913 - cell-cell adherens junction [Evidence IDA] codon_start : 1 note : cardiac morphogenesis; mXin alpha product : cardiomyopathy associated 1 protein_id : NP_001074808.1

name	Cx3cr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:87299632 GeneID:13051 MGI:1333815
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : C-X3-C chemokine receptor 1 product : chemokine (C-X3-C) receptor 1 protein_id : NP_034117.3

name	Ccr8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671774 CCDS:CCDS23621.1 GeneID:12776 MGI:1201402
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA] [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IDA]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-C) receptor 8; C-C motif chemokine receptor 8 product : chemokine (C-C motif) receptor 8 protein_id : NP_031746.1

name	Slc25a38 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450145 CCDS:CCDS23622.1 GeneID:208638 MGI:2384782
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25, member 38 protein_id : NP_659042.1

name	Rpsa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560560 CCDS:CCDS23623.1 GeneID:16785 MGI:105381
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence IEA]; GO:0015935 - small ribosomal subunit [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : P40-3, functional; P40-8, functional; laminin receptor 1 (67kD, ribosomal protein SA) product : laminin receptor 1 (ribosomal protein SA) protein_id : NP_035159.2

name	EG546166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701562 GeneID:546166 MGI:3647932
definition	codon_start : 1 product : hypothetical protein LOC546166 protein_id : NP_001019901.1

name	Mobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86355497 GeneID:17433 MGI:108511
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0019911 - structural constituent of myelin sheath [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 2 product : myelin-associated oligodendrocytic basic protein isoform a protein_id : NP_001034453.1

name	Mobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678910 GeneID:17433 MGI:108511
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0019911 - structural constituent of myelin sheath [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : myelin-associated oligodendrocytic basic protein isoform a protein_id : NP_032640.1

name	Mobp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86355503 CCDS:CCDS23626.1 GeneID:17433 MGI:108511
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0019911 - structural constituent of myelin sheath [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 3 product : myelin-associated oligodendrocytic basic protein isoform b protein_id : NP_001034454.1

name	Myrip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21362371 CCDS:CCDS23627.1 GeneID:245049 MGI:2384407
definition	GO_component : GO:0015629 - actin cytoskeleton [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017022 - myosin binding [Evidence ISS] [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEA]; GO:0017137 - Rab GTPase binding [Evidence ISS] [Evidence IEA] [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0030050 - vesicle transport along actin filament [Evidence TAS] codon_start : 1 note : exophilin 8; rab effector MYRIP product : myosin VIIA and Rab interacting protein protein_id : NP_653140.1

name	Eif1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312159 CCDS:CCDS23628.1 GeneID:68969 MGI:1916219
definition	GO_function : GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA]; GO:0006413 - translational initiation [Evidence IEA] codon_start : 1 product : translation factor sui1 homolog protein_id : NP_081168.1

name	Entpd3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520059 CCDS:CCDS23629.1 GeneID:215446 MGI:1321386
definition	GO_component : GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0008253 - 5'-nucleotidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0017110 - nucleoside-diphosphatase activity [Evidence IDA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IDA] GO_process : GO:0009134 - nucleoside diphosphate catabolism [Evidence IDA]; GO:0009143 - nucleoside triphosphate catabolism [Evidence IDA] codon_start : 1 exception : mismatches in translation note : CD39 antigen-like 3 product : ectonucleoside triphosphate diphosphohydrolase 3 protein_id : NP_848791.1

name	Rpl14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385472 GeneID:67115 MGI:1914365
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 product : ribosomal protein L14 protein_id : NP_080250.1

name	5830454E08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260353 GeneID:76100 MGI:1923350
definition	codon_start : 1 product : hypothetical protein LOC76100 protein_id : XP_001473947.1

name	LOC100040010 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260355 GeneID:100040010
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473986.1

name	Ctnnb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671684 CCDS:CCDS23630.1 GeneID:12387 MGI:88276
definition	GO_component : GO:0005912 - adherens junction [Evidence IDA]; GO:0045177 - apical part of cell [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005913 - cell-cell adherens junction [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005911 - intercellular junction [Evidence IDA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0016328 - lateral plasma membrane [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IDA]; GO:0005624 - membrane fraction [Evidence IDA]; GO:0031528 - microvillus membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0045294 - alpha-catenin binding [Evidence IPI]; GO:0005488 - binding [Evidence IEA]; GO:0045296 - cadherin binding [Evidence IPI]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0003713 - transcription coactivator activity [Evidence IDA]; GO:0003700 - transcription factor activity [Evidence IDA] GO_process : GO:0045453 - bone resorption [Evidence IMP] [Evidence IGI]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IMP]; GO:0001709 - cell fate determination [Evidence IMP]; GO:0001708 - cell fate specification [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0016337 - cell-cell adhesion [Evidence IMP]; GO:0000904 - cellular morphogenesis during differentiation [Evidence IMP]; GO:0050875 - cellular physiological process [Evidence IDA]; GO:0009950 - dorsal/ventral axis specification [Evidence IMP]; GO:0009953 - dorsal/ventral pattern formation [Evidence IMP]; GO:0007398 - ectoderm development [Evidence IMP]; GO:0035117 - embryonic arm morphogenesis [Evidence IDA]; GO:0042733 - embryonic digit morphogenesis [Evidence IMP]; GO:0035116 - embryonic hindlimb morphogenesis [Evidence IMP]; GO:0001706 - endoderm formation [Evidence IMP]; GO:0001711 - endodermal cell fate commitment [Evidence IMP]; GO:0048595 - eye morphogenesis (sensu Mammalia) [Evidence IMP]; GO:0030900 - forebrain development [Evidence IMP]; GO:0010003 - gastrulation (sensu Mammalia) [Evidence IMP]; GO:0007507 - heart development [Evidence IMP]; GO:0030097 - hemopoiesis [Evidence IDA]; GO:0030324 - lung development [Evidence IMP]; GO:0016331 - morphogenesis of embryonic epithelium [Evidence IMP]; GO:0045596 - negative regulation of cell differentiation [Evidence IMP]; GO:0045671 - negative regulation of osteoclast differentiation [Evidence IMP]; GO:0000122 - negative regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IMP]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0030316 - osteoclast differentiation [Evidence IMP]; GO:0031016 - pancreas development [Evidence IMP]; GO:0001569 - patterning of blood vessels [Evidence IMP]; GO:0030858 - positive regulation of epithelial cell differentiation [Evidence IMP]; GO:0045669 - positive regulation of osteoblast differentiation [Evidence IMP]; GO:0045941 - positive regulation of transcription [Evidence IMP]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IMP] [Evidence IGI] [Evidence IDA]; GO:0009954 - proximal/distal pattern formation [Evidence IMP]; GO:0045595 - regulation of cell differentiation [Evidence IDA]; GO:0042127 - regulation of cell proliferation [Evidence IDA]; GO:0045667 - regulation of osteoblast differentiation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IDA]; GO:0001501 - skeletal development [Evidence IMP]; GO:0050808 - synapse organization and biogenesis [Evidence IMP]; GO:0007268 - synaptic transmission [Evidence IMP]; GO:0048489 - synaptic vesicle transport [Evidence IMP]; GO:0006350 - transcription [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IDA] codon_start : 1 note : cadherin associated protein; beta-catenin; beta catenin; catenin beta; catenin (cadherin-associated protein), beta 1, 88kDa product : catenin (cadherin associated protein), beta 1, 88kDa protein_id : NP_031640.1

name	Ulk4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260414 GeneID:209012 MGI:1921622
definition	codon_start : 1 product : unc-51-like kinase 4 protein_id : XP_001481164.1

name	Trak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124517685 GeneID:67095 MGI:1914345
definition	GO_component : GO:0005634 - nucleus [Evidence ISS]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0050811 - GABA receptor binding [Evidence IDA] GO_process : GO:0006493 - protein amino acid O-linked glycosylation [Evidence ISS]; GO:0006605 - protein targeting [Evidence ISS]; GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 product : trafficking protein, kinesin binding 1 protein_id : NP_780323.2

name	Cck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624301 CCDS:CCDS23631.1 GeneID:12424 MGI:88297
definition	GO_component : GO:0030424 - axon [Evidence IDA]; GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005184 - neuropeptide hormone activity [Evidence IDA] GO_process : GO:0007409 - axonogenesis [Evidence IDA]; GO:0042755 - eating behavior [Evidence IDA]; GO:0001764 - neuron migration [Evidence IDA] codon_start : 1 product : cholecystokinin protein_id : NP_112438.1

name	Lyzl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312181 CCDS:CCDS23632.1 GeneID:69032 MGI:1916282
definition	GO_function : GO:0003796 - lysozyme activity [Evidence IEA] GO_process : GO:0016998 - cell wall catabolism [Evidence IEA] codon_start : 1 product : lysozyme-like protein 4 protein_id : NP_081191.1

name	Vipr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543948 CCDS:CCDS23633.1 GeneID:22354 MGI:109272
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0004999 - vasoactive intestinal polypeptide receptor activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : VIP receptor subtype 1 product : vasoactive intestinal peptide receptor 1 protein_id : NP_035833.2

name	Sec22c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520061 CCDS:CCDS23634.1 GeneID:215474 MGI:2447871
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_process : GO:0016192 - vesicle-mediated transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SEC22 vesicle trafficking protein-like 3 protein_id : NP_848792.1

name	Deb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312078 GeneID:26901 MGI:1349474
definition	codon_start : 1 note : Band 47B product : differentially expressed in B16F10 1 protein_id : NP_081070.1

name	Nktr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62526130 CCDS:CCDS23636.1 GeneID:18087 MGI:97346
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : cyclophilin-related protein; natural killer tumor recognition protein product : natural killer tumor recognition protein_id : NP_035048.3

name	Kbtbd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625935 CCDS:CCDS23637.1 GeneID:72330 MGI:1919580
definition	codon_start : 1 product : kelch repeat and BTB (POZ) domain containing 5 protein_id : NP_082478.1

name	Hhatl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312882 CCDS:CCDS23638.1 GeneID:74770 MGI:1922020
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : Gup1, glycerol uptake/transporter homolog protein_id : NP_083371.1

name	Ccdc13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702099 CCDS:CCDS23639.1 GeneID:434446 MGI:1920144
definition	codon_start : 1 product : coiled-coil domain containing 13 protein_id : NP_001028956.1

name	Higd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789977 GeneID:56295 MGI:1930666
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : hypoxia induced gene 1 protein_id : NP_062788.1

name	Ccbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542483 CCDS:CCDS23640.1 GeneID:59289 MGI:1891697
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IDA]; GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : D6 beta-chemokine receptor product : chemokine binding protein 2 protein_id : NP_067622.2

name	Cyp8b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981808 CCDS:CCDS23641.1 GeneID:13124 MGI:1338044
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005792 - microsome [Evidence IEA] GO_function : GO:0020037 - heme binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004497 - monooxygenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : cytochrome P450, 8b1, sterol 12 alpha-hydrolase; sterol 12-alpha-hydrolase product : cytochrome P450, family 8, subfamily b, polypeptide 1 protein_id : NP_034142.2

name	C730027P07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244228 GeneID:245050 MGI:3041196
definition	codon_start : 1 product : hypothetical protein LOC245050 protein_id : NP_808411.1

name	C85492 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:60593063 CCDS:CCDS23643.1 GeneID:215494 MGI:2143424
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycosyltransferase protein_id : NP_705768.3

name	LOC100040121 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260357 GeneID:100040121
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474166.1

name	Snrk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526942 CCDS:CCDS23644.1 GeneID:20623 MGI:108104
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SNF related kinase protein_id : NP_598502.1

name	LOC100039898 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039898
definition	number : 1 pseudo : _no_value

name	LOC100039898 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039898
definition	number : 2 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 1 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 2 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 3 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 4 pseudo : _no_value

name	LOC100040063 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040063
definition	number : 5 pseudo : _no_value

name	Snora62 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604693 GeneID:104433 MGI:2148179
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 62 transcript_id : NR_002902.1

name	LOC666044 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260412 GeneID:666044
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to Ribosomal protein L19 pseudo : _no_value transcript_id : XR_035008.1

name	LOC638068 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260351 GeneID:638068
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 9 Proteins product : similar to Interleukin-1 receptor-associated kinase 2d pseudo : _no_value transcript_id : XR_031411.1

clone name	MSMg01-496G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-544M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269E11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-305J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-277C16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-139C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-320J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-118D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-393H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-329A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340G03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-354C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-274M02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381K02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-390C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-312C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457I04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-066H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372F09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-477H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442H09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-028F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348L13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333B05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-307D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234L03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-336E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-154F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115D17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-299I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200L22
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-198J24.b	B6Ng01-198J24.g
ACC	GA020173	GA020174
length	1,166	1,039
definition	B6Ng01-198J24.b	B6Ng01-198J24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(120,900,233 - 120,901,403)	(121,050,403 - 121,051,428)
sequence	gaattcagcaaggaaacagatttctgaatatcaaacaccaaggttggaaa tgaaagcttcagacaatgagataaaagttacggagatggcgtagccaggc accaaagagaagcatcagagggatggaagtcgaggtgctgaagctttgca cttgaaaaccaacaagaaattatgtaggcacagccacaatgcccccccaa actccgggatacagtccagagaacctgcagaatccatggggcagaagaag gagcacagaatgtgaaaactagtgaaactgtggacacacaatttcccagg ttgagagaaagtcagacactcaaactccaggggcatctagaacagacatg acgcaagagacatttctccacagcacaaatacaagaaacaatgcccaaca ctgtaagcgggaaacctcaactcatctaacggtcagaaatggcagaatag cagtcgatccctaaaagcgagcagagcgtgcgtggatgcatctcaagcct tgaaaataaataaaataaagccaagactgctgtgcccagcaaactatctt caaaaacagaaggagggataaggacctttcatgacaagcacagaccaaga caggtcatgaccactgacccagccctgcagaagacatctgtttgcctctg ttggtgtgataaaaaccaaaccaaaccaatacaaaaacccactctgaccc aaagcaacttaggggataaagggatttatctgttttatactttcaggtca cagtccatcatggagggagtcagggcaggaactcactcagagcttgaagc agaaaccatggaggaacttgctggctttgctagcttgctggcttgctggc tggctggctggctggctggctggctggctggctggctggctggctggctg gctttgctctcagcccatgcttagcgagcttccttagaaggatgatgctg cccacagtgggctgggccctctgattatttaatattcaaaacaaaccccc acagacatacctcaggccagtctgatctggggcattccctttgatgaacc ctcgcagggtacttccagcttagtccagtgacatgtagctatcaggaata ggaaacagctgctttgtgaattttaacgtagatgctgtaatgacccactt gtacttgagctacctg	gaattctttcttcatccggcgtctgtccccttgtgattgaccacgtgtcc actgccactgtgctctgttttagccatgaatgtcactgtgggcacagctg tgggtgcaacactgggcctcatgtccaccacaggacccaaatgtggagtg gcttggagacactagcatggtcaacccgtgcccaggtctcttgctggctg cacagctcagcgctggctggctttcccttgtgctttatgcagtgggcgtt ggcttcaccaagagagtaatctgtgcgagtgctatgctcatagccagatg ttggcatgtaccaatctgtcactccctaacatcgggccgtctgaggaggg agactgaggcgtgacgggtggtttcgtttctcaggtatgagcacatcctc atggagcctgaccccgttcctgcctatgcgctgaagctgctcgtcgccat gacggaacacaaccccgctttcaccaggtactgggaggccagcgttgtag ctgccaaggggcagggtcactgttcagtctcccactttgtgtcgctgaca ctgtgttggcccaagttcacatgttttaaccccttacttgagtttgcacc ccatggaatgggtgatacttcaaactgaggaagtgtggagttagggagct agcccggaggcctgagttagattctcagaagtcacacaatgcttgggtaa gcagtgtgagcatctgtagttgctgcattcctagagacaggagaatcctc agatgccagcaggccagctaactagaacatagagaccttgcttcgaaaca ggcaacagaagctgggaccaacagacaacagatgacaacagatgttatct atttatgactgacatgtgtggccttgtgtgagcacacttggcacacacat aagtgtatacatacacatgtctgtcttacacatacagccctgaaatgata aacacctttaaaggggaaaaaaaccctcaacacataccagtatttttaat gtggtgttatgaagccgtgtgaacagaattgtgtacgtg
quality values	Open. Hide. 52 14 27 31 58 41 17 52 54 54 58 62 49 31 62 43 52 41 62 47 47 62 62 62 62 62 54 62 62 56 47 16 13 11 15 27 16 19 21 21 27 28 38 25 34 44 56 59 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 59 62 62 62 62 50 43 51 46 36 29 27 49 33 32 32 42 54 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 54 49 54 59 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 43 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 43 62 62 62 48 62 62 62 62 62 62 62 62 62 54 54 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 54 58 49 40 49 46 41 41 54 58 38 58 58 39 58 58 58 58 54 54 58 58 58 54 39 58 54 58 54 54 58 54 31 30 58 52 58 54 54 52 54 58 58 45 58 54 58 58 58 48 44 52 58 58 54 54 54 58 51 49 50 49 58 58 58 58 54 52 41 58 45 38 42 33 53 45 58 58 58 58 58 58 58 37 58 54 51 53 58 52 53 58 51 53 58 50 58 51 40 51 58 58 58 52 53 50 50 58 51 54 48 32 51 48 48 48 50 51 58 50 50 34 58 49 49 39 50 54 54 51 54 58 53 53 51 49 23 58 43 34 58 58 40 50 31 49 50 37 43 39 6 33 35 51 54 26 49 49 44 44 54 49 39 31 54 39 35 49 54 49 54 32 54 54 49 42 52 38 49 54 54 42 45 37 23 54 32 37 37 47 35 53 53 47 38 30 53 40 34 40 51 54 25 13 49 35 31 24 37 31 37 32 54 49 38 31 30 52 34 27 31 52 39 33 42 53 43 7 10 8 19 42 41 35 52 46 52 24 42 34 21 51 32 21 18 26 21 23 30 28 17 13 51 51 31 34 36 42 51 31 31 32 51 30 29 51 9 29 29 31 34 28 43 46 31 42 31 43 30 37 29 29 31 43 24 37 28 43 31 35 31 41 31 31 29 30 31 32 29 37 28 37 31 36 19 34 33 33 27 31 39 36 26 31 39 44 32 31 28 39 29 41 25 25 25 39 32 31 31 39 26 32 27 32 27 25 20 37 22 33 21 24 44 32 28 25 33 19 11 8 24 17 17 36 34 32 33 38 32 21 21 14 9 27 18 31 33 22 32 30 27 31 7 29 21 19 31 16 25 21 19 12 32 21 12 33 30 32 32 23 31 11 14 28 22 14 10 31 27 26 20 32 33 48 18 19 37 24 18 6 7 9 32 4 24 20 5 43 9 25 7 17 11 14 23 24 11 38 38 24 14 21 28 13 25 29 28 34 8 8 19 18 10 15 6 5 9 21 21 24 11 17 13 17 17 15 13 26 27 21 22 27 27 29 24 24 20 19 30 30 21 16 27 6 13 28 40 19 8 28 11 17 28 13 24 20 15 3 26 17 18 18 7 6 10 10 29 3 1 3 9 5 12 10 25 8 11 12 9 5 25 7 6 5 6 23 4 3 2 14 10 11 3 3 7 18 10 22 15 3 1 8 14 11 14 3 3 4 7 8 4 12 17 13 10 6 5 21 7 6 12 17 12 7 6 5 15 6 6 13 5 14 18 3 11 9 17 3 3 3 1 3 18 17 15 8 4 11 11 3 3 5 20 8 5 5 12 5 5 15 7 2 1 1 5 4 7 4 19 9 8 18 14 11 7	Open. Hide. 62 47 35 38 62 62 62 62 56 62 56 27 39 6 20 20 20 21 26 20 30 24 56 56 62 62 62 62 62 54 62 59 59 59 62 59 59 62 62 44 44 44 59 62 62 59 59 59 62 59 56 59 59 59 62 46 51 59 59 54 35 59 56 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 59 62 59 59 59 62 62 62 59 62 62 62 62 54 59 59 59 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 59 59 62 62 62 62 62 59 59 59 56 56 59 50 59 56 59 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 56 62 62 62 62 54 54 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 47 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 49 56 62 47 62 46 62 56 56 43 62 56 56 62 56 62 62 62 62 62 62 56 62 62 62 56 62 62 62 56 54 62 62 47 54 62 62 62 62 62 62 62 41 54 54 52 62 62 62 62 62 62 62 62 47 42 62 62 43 62 47 62 62 62 52 52 43 62 62 62 62 62 42 62 46 62 62 62 58 58 58 52 54 58 58 54 58 39 58 58 58 54 42 42 58 58 58 38 40 52 58 58 58 52 52 58 54 58 52 58 42 50 52 54 58 58 52 54 58 58 52 54 58 45 26 58 49 58 50 54 54 52 54 58 45 42 54 42 46 52 52 54 45 33 44 54 32 42 52 52 52 52 52 45 11 51 40 51 52 51 42 30 53 45 39 41 53 52 47 45 53 42 41 26 58 38 32 41 46 32 41 39 49 32 42 50 58 40 58 50 51 58 44 50 40 53 17 47 53 26 34 58 35 39 26 22 49 53 53 40 50 58 53 49 40 50 58 50 53 53 52 40 27 39 39 38 52 50 37 34 41 31 29 40 29 46 51 54 23 35 30 20 25 40 50 31 35 35 36 32 50 34 47 25 29 32 30 21 20 6 22 32 34 51 42 23 37 37 53 34 28 44 40 41 39 53 25 39 54 40 21 19 46 35 45 52 40 34 33 31 24 51 54 14 13 41 38 51 28 17 18 24 37 21 31 31 18 34 40 34 49 26 13 10 33 27 31 31 30 18 34 23 10 33 31 20 14 32 31 27 39 23 23 33 40 22 19 29 32 45 27 33 32 31 28 18 32 25 51 45 31 31 31 32 29 31 32 18 21 10 27 30 16 18 28 27 33 14 27 13 46 30 26 31 31 34 29 27 33 29 31 17 30 25 7 14 32 23 29 37 33 36 29 32 20 16 27 25 13 31 30 14 31 30 28 38 21 29 12 29 26 31 21 31 37 31 27 19 31 29 31 31 15 21 29 21 31 13 30 24 31 24 36 16 46 11 19 31 15 48 18 22 31 25 27 27 42 27 11 8 8 7 27 44 31 18 38 25 31 44 41 17 5 28 36 41 24 36 19 5 28 11 36 33 24 10 17 11 18 8 19 11 5 10 10 14 5 5 4 22 43 43 28 11 8 7 5 18 19 10 5 4 5 6 6 17 14 25 13 5 14 23 21 18 23 31 10 7 20 24 7 5 6 6 4 5 6 6 11 8 7 5 3 3 6

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_120900233_120901403
seq2: B6Ng01-198J24.b_46_1211

seq1  GAATTCAGCAAGGAAACAGATTTCTGAATATCAAACACCAAGGTTGGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGCAAGGAAACAGATTTCTGAATATCAAACACCAAGGTTGGAAA  50

seq1  TGAAAGCTTCAGACAATGAGATAAAAGTTACGGAGATGGCGTAGCCAGGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAGCTTCAGACAATGAGATAAAAGTTACGGAGATGGCGTAGCCAGGC  100

seq1  ACCAAAGAGAAGCATCAGAGGGATGGAAGTCGAGGTGCTGAAGCTTTGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAAAGAGAAGCATCAGAGGGATGGAAGTCGAGGTGCTGAAGCTTTGCA  150

seq1  CTTGAAAACCAACAAGAAATTATGTAGGCACAGCCACAATGCCCCCCCAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAAAACCAACAAGAAATTATGTAGGCACAGCCACAATGCCCCCCCAA  200

seq1  ACTCCGGGATACAGTCCAGAGAACCTGCAGAATCCATGGGGCAGAAGAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCGGGATACAGTCCAGAGAACCTGCAGAATCCATGGGGCAGAAGAAG  250

seq1  GAGCACAGAATGTGAAAACTAGTGAAACTGTGGACACACAATTTCCCAGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCACAGAATGTGAAAACTAGTGAAACTGTGGACACACAATTTCCCAGG  300

seq1  TTGAGAGAAAGTCAGACACTCAAACTCCAGGGGCATCTAGAACAGACATG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGAGAAAGTCAGACACTCAAACTCCAGGGGCATCTAGAACAGACATG  350

seq1  ACGCAAGAGACATTTCTCCACAGCACAAATACAAGAAACAATGCCCAACA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGCAAGAGACATTTCTCCACAGCACAAATACAAGAAACAATGCCCAACA  400

seq1  CTGTAAGCGGGAAACCTCAACTCATCTAACGGTCAGAAATGGCAGAATAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTAAGCGGGAAACCTCAACTCATCTAACGGTCAGAAATGGCAGAATAG  450

seq1  CAGTCGATCCCTAAAAGCGAGCAGAGCGTGCGTGGATGCATCTCAAGCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCGATCCCTAAAAGCGAGCAGAGCGTGCGTGGATGCATCTCAAGCCT  500

seq1  TGAAAATAAATAAAATAAAGCCAAGACTGCTGTGCCCAGCAAACTATCTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAATAAATAAAATAAAGCCAAGACTGCTGTGCCCAGCAAACTATCTT  550

seq1  CAAAAACAGAAGGAGGGATAAGGACCTTTCATGACAAGCACAGACCAAGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAACAGAAGGAGGGATAAGGACCTTTCATGACAAGCACAGACCAAGA  600

seq1  CAGGTCATGACCACTGACCCAGCCCTGCAGAAGACATCTGTTTGCCTCTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGTCATGACCACTGACCCAGCCCTGCAGAAGACATCTGTTTGCCTCTG  650

seq1  TTGGTGTGATAAAAACCAAACCAAACCAATACAAAAACCCACTCTGACCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTGTGATAAAAACCAAACCAAACCAATACAAAAACCCACTCTGACCC  700

seq1  AAAGCAACTTAGGGGATAAAGGGATTTATCTGTTTTATACTTTCAGGTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCAACTTAGGGGATAAAGGGATTTATCTGTTTTATACTTTCAGGTCA  750

seq1  CAGTCCATCATGGAGGGAGTCAGGGCAGGAACTCACTCAGGAGCTTGAAG  800
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  CAGTCCATCATGGAGGGAGTCAGGGCAGGAACTCACTCA-GAGCTTGAAG  799

seq1  CAGAAACCATGGAGGAACTTGCTGGC-TTGCTAGCTTGCTGGCTTGCTGG  849
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CAGAAACCATGGAGGAACTTGCTGGCTTTGCTAGCTTGCTGGCTTGCTGG  849

seq1  CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCT  899

seq1  GGCTTTGCTCTCAAGCCCATGCTTAGCGAGCTTCCTTAG-AGGATGATGC  948
      |||||||||||| |||||||||||||||||||||||||| ||||||||||
seq2  GGCTTTGCTCTC-AGCCCATGCTTAGCGAGCTTCCTTAGAAGGATGATGC  948

seq1  TGCCCACAGTGGGCTGGGCCCTCTTGAATTAATTAATATTCAAAACAAA-  997
      ||||||||||||||||||||||||   |||| ||||||||||||||||| 
seq2  TGCCCACAGTGGGCTGGGCCCTCT--GATTATTTAATATTCAAAACAAAC  996

seq1  CCCCACAGACATACCCTCAGGCCAGTCTGATCT-GGGCAATCCC-TTGAT  1045
      ||||||||||||| ||||||||||||||||||| ||||| |||| |||||
seq2  CCCCACAGACATA-CCTCAGGCCAGTCTGATCTGGGGCATTCCCTTTGAT  1045

seq1  GAAACCCTCCGCAGGGAAC-TCCAGCTAAGTCAAGTTGACAATTGTAGCT  1094
      | |||||| ||||||| || ||||||| |||| || |||||  |||||||
seq2  G-AACCCT-CGCAGGGTACTTCCAGCTTAGTCCAG-TGACA--TGTAGCT  1090

seq1  AACCAGGATAGAAAACAGCTGCTTTGTGGATTTTTTAAGGTTAGTATGCT  1144
      | |  | |||| |||||||||||||||| |  |||||| | ||| |||||
seq2  ATCAGGAATAGGAAACAGCTGCTTTGTGAA--TTTTAACG-TAG-ATGCT  1136

seq1  GTAATGACCCAC-TGTAGT--AGCTACCTG  1171
      |||||||||||| |||| |  |||||||||
seq2  GTAATGACCCACTTGTACTTGAGCTACCTG  1166

seq1: chr9_121050403_121051428
seq2: B6Ng01-198J24.g_73_1111 (reverse)

seq1  CACGTACAC-ACTCTG-TCACACG--CTCAT-ACA-CACAT--AAAATAC  42
      ||||||||| | |||| |||||||   |||| ||| |||||  |||||||
seq2  CACGTACACAATTCTGTTCACACGGCTTCATAACACCACATTAAAAATAC  50

seq1  TGTTATGTGTTGAGGG-TTTTTTCCCCTTTAAA-GTGTTTATCA-TTCA-  88
      || ||||||||||||| |||||||||||||||| |||||||||| |||| 
seq2  TGGTATGTGTTGAGGGTTTTTTTCCCCTTTAAAGGTGTTTATCATTTCAG  100

seq1  GGCTGTATGTGTAAGACAGACATGTGTATGTATACACTTATGTGTGTGCC  138
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGTATGTGTAAGACAGACATGTGTATGTATACACTTATGTGTGTGCC  150

seq1  -AGTGTGCTCACACAAGGCCACACATGTCAGTCATAAATAGATAACATCT  187
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGTGCTCACACAAGGCCACACATGTCAGTCATAAATAGATAACATCT  200

seq1  GTTGTCATCTGTTGTCTGTTGGTCCCAGCTTCTGTTGCCTGTTTCGAAGC  237
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTCATCTGTTGTCTGTTGGTCCCAGCTTCTGTTGCCTGTTTCGAAGC  250

seq1  AAGGTCTCTATGTTCTAGTTAGCTGGCCTGCTGGCATCTGAGGATTCTCC  287
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTCTCTATGTTCTAGTTAGCTGGCCTGCTGGCATCTGAGGATTCTCC  300

seq1  TGTCTCTAGGAATGCAGCAACTACAGATGCTCACACTGCTTACCCAAGCA  337
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTAGGAATGCAGCAACTACAGATGCTCACACTGCTTACCCAAGCA  350

seq1  TTGTGTGACTTCTGAGAATCTAACTCAGGCCTCCGGGCTAGCTCCCTAAC  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGTGACTTCTGAGAATCTAACTCAGGCCTCCGGGCTAGCTCCCTAAC  400

seq1  TCCACACTTCCTCAGTTTGAAGTATCACCCATTCCATGGGGTGCAAACTC  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACACTTCCTCAGTTTGAAGTATCACCCATTCCATGGGGTGCAAACTC  450

seq1  AAGTAAGGGGTTAAAACATGTGAACTTGGGCCAACACAGTGTCAGCGACA  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAAGGGGTTAAAACATGTGAACTTGGGCCAACACAGTGTCAGCGACA  500

seq1  CAAAGTGGGAGACTGAACAGTGACCCTGCCCCTTGGCAGCTACAACGCTG  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGTGGGAGACTGAACAGTGACCCTGCCCCTTGGCAGCTACAACGCTG  550

seq1  GCCTCCCAGTACCTGGTGAAAGCGGGGTTGTGTTCCGTCATGGCGACGAG  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCCCAGTACCTGGTGAAAGCGGGGTTGTGTTCCGTCATGGCGACGAG  600

seq1  CAGCTTCAGCGCATAGGCAGGAACGGGGTCAGGCTCCATGAGGATGTGCT  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTTCAGCGCATAGGCAGGAACGGGGTCAGGCTCCATGAGGATGTGCT  650

seq1  CATACCTGAGAAACGAAACCACCCGTCACGCCTCAGTCTCCCTCCTCAGA  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATACCTGAGAAACGAAACCACCCGTCACGCCTCAGTCTCCCTCCTCAGA  700

seq1  CGGCCCGATGTTAGGGAGTGACAGATTGGTACATGCCAACATCTGGCTAT  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGCCCGATGTTAGGGAGTGACAGATTGGTACATGCCAACATCTGGCTAT  750

seq1  GAGCATAGCACTCGCACAGATTACTCTCTTGGTGAAGCCAACGCCCACTG  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCATAGCACTCGCACAGATTACTCTCTTGGTGAAGCCAACGCCCACTG  800

seq1  CATAAAGCACAAGGGAAAGCCAGCCAGCGCTGAGCTGTGCAGCCAGCAAG  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATAAAGCACAAGGGAAAGCCAGCCAGCGCTGAGCTGTGCAGCCAGCAAG  850

seq1  AGACCTGGGCACGGGTTGACCATGCTAGTGTCTCCAAGCCACTCCACATT  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACCTGGGCACGGGTTGACCATGCTAGTGTCTCCAAGCCACTCCACATT  900

seq1  TGGGTCCTGTGGTGGACATGAGGCCCAGTGTTGCACCCACAGCTGTGCCC  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTCCTGTGGTGGACATGAGGCCCAGTGTTGCACCCACAGCTGTGCCC  950

seq1  ACAGTGACATTCATGGCTAAAACAGAGCACAGTGGCAGTGGACACGTGGT  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTGACATTCATGGCTAAAACAGAGCACAGTGGCAGTGGACACGTGGT  1000

seq1  CAATCACAAGGGGACAGACGCCGGATGAAGAAAGAATTC  1026
      |||||||||||||||||||||||||||||||||||||||
seq2  CAATCACAAGGGGACAGACGCCGGATGAAGAAAGAATTC  1039

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information