MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-225J14
Chromosome	9 (Build37)
Map Location	65,543,643 - 65,679,637
singlet/doublet	doublet
Overlap gene	Zfp609, LOC100041180
Upstream gene	Megf11, Rab11a, AI115600, F730015K02Rik, Slc24a1, 2010321M09Rik, Ptplad1, Dpp8, Nope, Punc, Parp16, Cilp, Clpx, Pdcd7, Gm514, 5430433E21Rik, Rasl12, Ostb, Mtfmt, Spg21, Ankdd1a, Plekhq1, Pif1, LOC100041121, Rbpms2, Oaz2
Downstream gene	Trip4, 2810417H13Rik, Csnk1g1, Ppib, Snx22, Snx1, 5730536A07Rik, Dapk2, Herc1, Fbxl22, Usp3, Car12, Aph1b, LOC623488, Aph1c
Link	Open Mouse BAC browser

Click to get alignment info.

name	Megf11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214058 MGI:1920951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab11a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53869 MGI:1858202
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AI115600 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102442 MGI:2142979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 76 ESTs, 2 Proteins

name	F730015K02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319526 MGI:2442199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Slc24a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214111 MGI:2384871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010321M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69882 MGI:1917132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ptplad1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57874 MGI:1889341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dpp8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74388 MGI:1921638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nope (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56741 MGI:1858497
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Punc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19289 MGI:1202390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Parp16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214424 MGI:2446133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cilp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214425 MGI:2444507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clpx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270166 MGI:1346017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Pdcd7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50996 MGI:1859170
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm514 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208080 MGI:2685360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs

name	5430433E21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74492 MGI:1921742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs, 2 Proteins

name	Rasl12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70784 MGI:1918034
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ostb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:330962 MGI:3582052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtfmt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69606 MGI:1916856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Spg21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27965 MGI:106403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ankdd1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384945 MGI:2686319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Plekhq1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102595 MGI:2143132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pif1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208084 MGI:2143057
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041121 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Rbpms2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71973 MGI:1919223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Oaz2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18247 MGI:109492
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp609 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214812 MGI:2674092
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Trip4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56404 MGI:1928469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810417H13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68026 MGI:1915276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Csnk1g1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214897 MGI:2660884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ppib (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19035 MGI:97750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382083 MGI:2685966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56440 MGI:1928395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5730536A07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68250 MGI:1915500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dapk2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13143 MGI:1341297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Herc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235439 MGI:2384589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 224 ESTs, 6 Proteins

name	Fbxl22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74165 MGI:1921415
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235441 MGI:2152450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Car12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76459 MGI:1923709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aph1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208117 MGI:3522097
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623488 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623488
definition	note : protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene pseudo : _no_value

name	Aph1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68318 MGI:1915568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Megf11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362961 GeneID:214058 MGI:1920951
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : multiple EGF-like-domains 11 transcript_id : NM_172522.2

name	Rab11a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373351 GeneID:53869 MGI:1858202
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB11a, member RAS oncogene family transcript_id : NM_017382.4

name	AI115600 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260033 GeneID:102442 MGI:2142979
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 76 ESTs, 2 Proteins product : expressed sequence AI115600 transcript_id : XM_001476259.1

name	F730015K02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260035 GeneID:319526 MGI:2442199
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA F730015K02 gene transcript_id : XM_001487795.1

name	Slc24a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21450182 GeneID:214111 MGI:2384871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 transcript_id : NM_144813.1

name	2010321M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647252 GeneID:69882 MGI:1917132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010321M09 gene transcript_id : NM_001077631.1

name	2010321M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117647250 GeneID:69882 MGI:1917132
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2010321M09 gene transcript_id : NM_175153.3

name	Ptplad1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:28916662 GeneID:57874 MGI:1889341
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein tyrosine phosphatase-like A domain containing 1 transcript_id : NM_021345.1

name	Dpp8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542570 GeneID:74388 MGI:1921638
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dipeptidylpeptidase 8 transcript_id : NM_028906.2

name	Nope (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910463 GeneID:56741 MGI:1858497
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neighbor of Punc E11 transcript_id : NM_020043.1

name	Punc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892646 GeneID:19289 MGI:1202390
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : putative neuronal cell adhesion molecule transcript_id : NM_008988.2

name	Parp16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328418 GeneID:214424 MGI:2446133
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly (ADP-ribose) polymerase family, member 16 transcript_id : NM_177460.3

name	Cilp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373302 GeneID:214425 MGI:2444507
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage intermediate layer protein, nucleotide pyrophosphohydrolase transcript_id : NM_173385.2

name	Clpx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205070 GeneID:270166 MGI:1346017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caseinolytic peptidase X (E.coli) transcript_id : NM_011802.2

name	Clpx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113205068 GeneID:270166 MGI:1346017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caseinolytic peptidase X (E.coli) transcript_id : NM_001044389.1

name	Pdcd7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7710019 GeneID:50996 MGI:1859170
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death protein 7 transcript_id : NM_016688.1

name	Gm514 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386174 GeneID:208080 MGI:2685360
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs product : gene model 514, (NCBI) transcript_id : XM_146931.5

name	5430433E21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386175 GeneID:74492 MGI:1921742
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs, 2 Proteins product : RIKEN cDNA 5430433E21 gene transcript_id : XM_134954.7

name	Rasl12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75677525 GeneID:70784 MGI:1918034
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAS-like, family 12 transcript_id : NM_001033158.1

name	Ostb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341457 GeneID:330962 MGI:3582052
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : organic solute transporter beta transcript_id : NM_178933.2

name	Mtfmt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802994 GeneID:69606 MGI:1916856
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial methionyl-tRNA formyltransferase transcript_id : NM_027134.2

name	Spg21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88900518 GeneID:27965 MGI:106403
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spastic paraplegia 21 homolog (human) transcript_id : NM_138584.2

name	Ankdd1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260003 GeneID:384945 MGI:2686319
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : ankyrin repeat and death domain containing 1A transcript_id : XM_357954.6

name	Plekhq1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:26986535 GeneID:102595 MGI:2143132
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pleckstrin homology domain containing, family Q member 1 transcript_id : NM_153119.2

name	Pif1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801689 GeneID:208084 MGI:2143057
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae) transcript_id : NM_172453.2

name	LOC100041121 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260046 GeneID:100041121
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to Sec61-complex gamma-subunit transcript_id : XM_001476757.1

name	Rbpms2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130420 GeneID:71973 MGI:1919223
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding protein with multiple splicing 2 transcript_id : NM_028030.3

name	Oaz2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37596299 GeneID:18247 MGI:109492
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine decarboxylase antizyme 2 transcript_id : NM_010952.2

name	Zfp609 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369755 GeneID:214812 MGI:2674092
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 609 transcript_id : NM_172536.1

name	Trip4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71773828 GeneID:56404 MGI:1928469
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thyroid hormone receptor interactor 4 transcript_id : NM_019797.3

name	2810417H13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71773931 GeneID:68026 MGI:1915276
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810417H13 gene transcript_id : NM_026515.2

name	Csnk1g1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71773562 GeneID:214897 MGI:2660884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : casein kinase 1, gamma 1 transcript_id : NM_173185.2

name	Ppib (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71774132 GeneID:19035 MGI:97750
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peptidylprolyl isomerase B transcript_id : NM_011149.2

name	Snx22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131181 GeneID:382083 MGI:2685966
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 22 transcript_id : NM_001025612.2

name	Snx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043943 GeneID:56440 MGI:1928395
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 1 transcript_id : NM_019727.2

name	5730536A07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71773979 GeneID:68250 MGI:1915500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5730536A07 gene transcript_id : NM_026635.3

name	Dapk2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328166 GeneID:13143 MGI:1341297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : death-associated kinase 2 transcript_id : NM_010019.2

name	Herc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260053 GeneID:235439 MGI:2384589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 224 ESTs, 6 Proteins product : hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 transcript_id : XM_001477062.1

name	Fbxl22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349543 GeneID:74165 MGI:1921415
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 22 transcript_id : NM_175206.3

name	Usp3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361676 GeneID:235441 MGI:2152450
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 3 transcript_id : NM_144937.3

name	Car12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560837 GeneID:76459 MGI:1923709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anyhydrase 12 transcript_id : NM_178396.3

name	Aph1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372127 GeneID:208117 MGI:3522097
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anterior pharynx defective 1b homolog (C. elegans) transcript_id : NM_177583.3

name	Aph1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129861 GeneID:68318 MGI:1915568
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : anterior pharynx defective 1c homolog (C. elegans) transcript_id : NM_026674.3

name	Megf11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369722 CCDS:CCDS23281.1 GeneID:214058 MGI:1920951
definition	codon_start : 1 product : MEGF11 protein protein_id : NP_766110.1

name	Rab11a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980840 CCDS:CCDS23282.1 GeneID:53869 MGI:1858202
definition	GO_component : GO:0000178 - exosome (RNase complex) [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0003924 - GTPase activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0019905 - syntaxin binding [Evidence ISS] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0048227 - plasma membrane to endosome transport [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0007046 - ribosome biogenesis [Evidence IEA]; GO:0006364 - rRNA processing [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB11a, member RAS oncogene family protein_id : NP_059078.2

name	F730015K02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260036 GeneID:319526 MGI:2442199
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487845.1

name	AI115600 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260034 GeneID:102442 MGI:2142979
definition	codon_start : 1 product : hypothetical protein LOC102442 protein_id : XP_001476309.1

name	Slc24a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450183 CCDS:CCDS23283.1 GeneID:214111 MGI:2384871
definition	codon_start : 1 product : solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 protein_id : NP_659062.1

name	2010321M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647253 GeneID:69882 MGI:1917132
definition	GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69882 protein_id : NP_001071099.1

name	2010321M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117647251 GeneID:69882 MGI:1917132
definition	GO_process : GO:0007229 - integrin-mediated signaling pathway [Evidence IEA] codon_start : 1 product : hypothetical protein LOC69882 protein_id : NP_780362.2

name	Ptplad1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28916663 CCDS:CCDS23284.1 GeneID:57874 MGI:1889341
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence IDA]; GO:0007254 - JNK cascade [Evidence IDA]; GO:0007266 - Rho protein signal transduction [Evidence IDA] codon_start : 1 exception : mismatches in translation product : butyrate-induced transcript 1 protein_id : NP_067320.1

name	Dpp8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542571 CCDS:CCDS23285.1 GeneID:74388 MGI:1921638
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004274 - dipeptidyl-peptidase IV activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA]; GO:0008236 - serine-type peptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : dipeptidylpeptidase 8 protein_id : NP_083182.2

name	Nope (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910464 GeneID:56741 MGI:1858497
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : amplimer WI-18508, mouse homolog product : neighbor of Punc e11 protein protein_id : NP_064427.1

name	Punc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679571 GeneID:19289 MGI:1202390
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 note : amplimer WI-14920, mouse homolog product : putative neuronal cell adhesion molecule protein_id : NP_033014.1

name	Parp16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328419 CCDS:CCDS23286.1 GeneID:214424 MGI:2446133
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003950 - NAD+ ADP-ribosyltransferase activity [Evidence IEA] GO_process : GO:0006471 - protein amino acid ADP-ribosylation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : poly (ADP-ribose) polymerase family, member 16 protein_id : NP_803411.2

name	Cilp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734196 CCDS:CCDS23287.1 GeneID:214425 MGI:2444507
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : cartilage intermediate layer protein, nucleotide pyrophosphohydrolase protein_id : NP_775561.1

name	Clpx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205071 CCDS:CCDS23288.1 GeneID:270166 MGI:1346017
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; caseinolytic protease X product : caseinolytic protease X isoform 1 protein_id : NP_035932.2

name	Clpx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113205069 GeneID:270166 MGI:1346017
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; caseinolytic protease X product : caseinolytic protease X isoform 2 protein_id : NP_001037854.1

name	Pdcd7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710020 GeneID:50996 MGI:1859170
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : programmed cell death protein 7 protein_id : NP_057897.1

name	Gm514 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51764923 GeneID:208080 MGI:2685360
definition	codon_start : 1 product : hypothetical protein protein_id : XP_146931.3

name	5430433E21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38089943 GeneID:74492 MGI:1921742
definition	codon_start : 1 product : hypothetical protein LOC74492 protein_id : XP_134954.2

name	Rasl12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677526 CCDS:CCDS23290.1 GeneID:70784 MGI:1918034
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : RAS-like, family 12 protein_id : NP_001028330.1

name	Ostb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30725804 CCDS:CCDS23291.1 GeneID:330962 MGI:3582052
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005215 - transporter activity [Evidence IPI] GO_process : GO:0006810 - transport [Evidence IPI] codon_start : 1 note : Ost beta product : organic solute transporter beta protein_id : NP_849264.1

name	Mtfmt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312348 CCDS:CCDS23292.1 GeneID:69606 MGI:1916856
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016742 - hydroxymethyl-, formyl- and related transferase activity [Evidence IEA]; GO:0004479 - methionyl-tRNA formyltransferase activity [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : mitochondrial methionyl-tRNA formyltransferase protein_id : NP_081410.1

name	Spg21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070390 CCDS:CCDS23293.1 GeneID:27965 MGI:106403
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0030140 - trans-Golgi network transport vesicle [Evidence ISS] GO_function : GO:0042609 - CD4 receptor binding [Evidence ISS] GO_process : GO:0050851 - antigen receptor-mediated signaling pathway [Evidence ISS] codon_start : 1 product : spastic paraplegia 21 homolog protein_id : NP_613050.1

name	Ankdd1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260004 GeneID:384945 MGI:2686319
definition	codon_start : 1 product : similar to ankyrin repeat and death domain containing 1A protein_id : XP_357954.6

name	Plekhq1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:24025665 CCDS:CCDS23294.1 GeneID:102595 MGI:2143132
definition	codon_start : 1 product : PH domain-containing protein homolog protein_id : NP_694759.1

name	Pif1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369615 CCDS:CCDS23295.1 GeneID:208084 MGI:2143057
definition	GO_function : GO:0004386 - helicase activity [Evidence IEA] codon_start : 1 note : DNA helicase-like protein; Pif1/Rrm3 DNA helicase-like protein product : PIF1 homolog protein_id : NP_766041.1

name	LOC100041121 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260047 GeneID:100041121
definition	codon_start : 1 product : similar to Sec61-complex gamma-subunit protein_id : XP_001476807.1

name	Rbpms2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980694 CCDS:CCDS23296.1 GeneID:71973 MGI:1919223
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding protein with multiple splicing 2 protein_id : NP_082306.2

name	Oaz2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:11136624 GeneID:18247 MGI:109492
definition	GO_function : GO:0004857 - enzyme inhibitor activity [Evidence IEA]; GO:0008073 - ornithine decarboxylase inhibitor activity [Evidence TAS] GO_process : GO:0006595 - polyamine metabolism [Evidence TAS] codon_start : 1 note : protein translation dependent on +1 ribosomal frameshift; antizyme 2 product : ornithine decarboxylase antizyme 2 protein_id : NP_035082.1 ribosomal_slippage : _no_value

name	Zfp609 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369756 CCDS:CCDS23297.1 GeneID:214812 MGI:2674092
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 609 protein_id : NP_766124.1

name	Trip4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71773829 CCDS:CCDS23298.1 GeneID:56404 MGI:1928469
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : transcription coactivator ASC-1 product : thyroid hormone receptor interactor 4 protein_id : NP_062771.2

name	2810417H13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71773932 CCDS:CCDS23299.1 GeneID:68026 MGI:1915276
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : hypothetical protein LOC68026 protein_id : NP_080791.2

name	Csnk1g1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71773563 CCDS:CCDS23300.1 GeneID:214897 MGI:2660884
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : casein kinase I, gamma 1 product : casein kinase 1, gamma 1 protein_id : NP_775277.2

name	Ppib (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71774133 CCDS:CCDS23301.1 GeneID:19035 MGI:97750
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0042277 - peptide binding [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 note : cyclophilin B product : peptidylprolyl isomerase B protein_id : NP_035279.2

name	Snx22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71774067 GeneID:382083 MGI:2685966
definition	codon_start : 1 product : sorting nexin 22 protein_id : NP_001020783.1

name	Snx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71043944 GeneID:56440 MGI:1928395
definition	GO_component : GO:0005768 - endosome [Evidence IDA] GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] [Evidence IPI]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : sorting nexin 1 protein_id : NP_062701.2

name	5730536A07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386128 CCDS:CCDS23302.1 GeneID:68250 MGI:1915500
definition	codon_start : 1 product : family with sequence similarity 96, member A protein_id : NP_080911.1

name	Dapk2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328167 CCDS:CCDS23303.1 GeneID:13143 MGI:1341297
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0004685 - calcium- and calmodulin-dependent protein kinase activity [Evidence ISS]; GO:0005516 - calmodulin binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence ISS]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0007243 - protein kinase cascade [Evidence ISS] codon_start : 1 product : death-associated kinase 2 protein_id : NP_034149.2

name	Herc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260054 GeneID:235439 MGI:2384589
definition	codon_start : 1 product : hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 protein_id : XP_001477112.1

name	Fbxl22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29171324 CCDS:CCDS23304.1 GeneID:74165 MGI:1921415
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 22 protein_id : NP_780415.1

name	Usp3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21450103 CCDS:CCDS23305.1 GeneID:235441 MGI:2152450
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : ubiquitin specific protease 3 protein_id : NP_659186.1

name	Car12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541884 CCDS:CCDS23306.1 GeneID:76459 MGI:1923709
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : CA XII product : carbonic anyhydrase 12 protein_id : NP_848483.2

name	Aph1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29243936 CCDS:CCDS23307.1 GeneID:208117 MGI:3522097
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IGI]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043085 - positive regulation of enzyme activity [Evidence IEA]; GO:0016485 - protein processing [Evidence IEA] codon_start : 1 note : APH1B homolog; anterior pharynx defective 1c homolog product : anterior pharynx defective 1b homolog protein_id : NP_808251.1

name	Aph1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21492616 CCDS:CCDS23308.1 GeneID:68318 MGI:1915568
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004175 - endopeptidase activity [Evidence IGI]; GO:0008233 - peptidase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0001656 - metanephros development [Evidence IMP]; GO:0007219 - Notch signaling pathway [Evidence IEA]; GO:0043085 - positive regulation of enzyme activity [Evidence IEA]; GO:0016485 - protein processing [Evidence ISS] [Evidence IGI] codon_start : 1 note : anterior pharynx defective 1b product : anterior pharynx defective 1c homolog protein_id : NP_080950.1

name	LOC100041180 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041180
definition	number : 1 pseudo : _no_value

clone name	MSMg01-480D17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-479G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-061A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-452C17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-459H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516G13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-089B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-331F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-445I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-353M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518N10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-375G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-081K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404H17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-214J01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-547M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-182C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500F19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-534D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-441H12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-054P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-155O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067P03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-449P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375E24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072H10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-339G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-300A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409H18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-506F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-185N08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-410H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-327F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-092B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-382A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-499D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391P21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-232H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-481A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297A11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-302D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-509P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410P06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165E17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-134H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-369F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-263P23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231P16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-435J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499N03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271O12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-488J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-507M03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-069P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-183L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-238H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248M16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-152H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284B10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-027B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044C01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-070E05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-160E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-114O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-348F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-181G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-016N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230C15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-085D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211E23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150A22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-090M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L21
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-225J14.b	B6Ng01-225J14.g
ACC	GA039751	GA039752
length	345	1,140
definition	B6Ng01-225J14.b	B6Ng01-225J14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(65,543,643 - 65,543,987)	(65,678,525 - 65,679,637)
sequence	catcatccacagttcgaagagggaactccctgtaaattgttctttgagct ctgctcacaagcactacccttcacagcaaagttaaaaacaacccaaaaag aactgcagcaccagctggtgctggtcctccgcaggccttcaaatgcacat agcttcacaagaggctgctgtcacaggcctggccaacagtctcccttttc cagattactgacatcacatagttaaccctcacttgcagagattctgtgga tccaagtagcagctacccctgttaatctgtcactgcaaattaacaaaatc tacttaccattctcacctccgggggggtgggtagagtgagggagt	gaattccatgctgaaattgtctggctttcttaatatcacaataaaattga aaggtaggatgggaagagaaaagaaggggttggaagttctctgttctttt atttgaagacagcctttacacagaagagtatggattgttttttctatgtg ggtaatttgaatgcacaccttaaaagaaaaaagtcaggaatgtcaacaga tgagctcatctgcccgagctttgcaagtttctaagaacccacctcagctt ctcaaacacacagccagaaccacataaataaatggcagagctactcggaa acttctccttttcatggttaggctgggaaagtctgtctttggtttacatg gcagtggtagtataaggtctctcttctgtttgctgagacacaagggagga agtgtgggagaagtttgcgggtagatggccctcagttgctcactgatgaa tagtatactttaaagtcagatggaaattcttagtagcctgagttcaagct tgtccaagaatagcttgttagtgtattatgacacttcactctgaccctgt tactctggggcagtttcgcctaagaaagttctgaatttccgagatgcctt tttgttgtagcttctgtgttcccttttgaatgactgaattaagatgccat taattcatacagtaaaggaattggctttttctttttgtttttcccagaca agactcagtttcctttgtatgagctcacagttagggaatgatggaaacta tggggctttgtcagcgttgatgagaccttatctttagtgaagtgtttaga atagattaagaattttggccagatgtgatagtatacaccttaaatcccca gcactgggggaggctgatctcttactatctcttatatagtaagtccctat cacaaaggagacattaaaaagaatttggggtttttgttgcttcttttagc taatacagaacctaagatattaaagaactaagttgtcctatcttttcttt ttaaactgaaaattttagtgtaaaccctattttttcccccctagccatgt aaaatgtgagaacacttaccgaaggatttagtttttaccaataagttata gctcatggacttatttgattatgtaccattttattttttt
quality values	Open. Hide. 31 20 62 41 42 62 62 37 26 47 44 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 43 38 40 23 34 37 54 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 50 54 46 50 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 25 14	Open. Hide. 62 49 42 41 62 62 47 31 62 62 16 11 13 16 13 13 21 22 28 25 27 27 46 56 59 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 39 23 46 36 28 32 32 32 40 59 59 62 43 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 59 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 51 62 62 50 62 59 62 59 62 62 62 54 54 62 54 54 54 62 62 62 62 54 54 46 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 59 59 50 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 50 59 51 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 59 59 59 54 50 62 62 62 62 62 62 62 62 62 49 54 54 56 59 59 59 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 56 54 54 51 56 56 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 44 62 59 62 62 62 62 59 59 62 47 59 56 56 59 59 62 62 62 56 62 47 47 62 51 62 62 62 62 56 62 62 62 62 62 62 62 47 47 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 45 56 46 30 46 56 51 56 42 39 56 56 47 49 62 62 62 56 62 62 62 62 47 62 47 47 62 47 41 43 42 62 56 62 56 62 62 62 56 62 62 62 47 62 62 62 62 56 62 56 54 39 54 56 62 56 52 62 62 52 42 43 47 43 46 52 43 62 62 54 62 52 62 52 62 54 49 52 52 62 33 52 62 47 48 54 62 62 62 54 62 62 62 54 32 58 50 52 54 52 58 39 46 41 31 52 39 39 54 47 54 58 54 46 54 42 54 52 52 33 35 33 41 24 38 58 33 52 46 43 25 29 47 46 54 54 39 52 36 54 54 54 58 54 42 54 54 54 54 50 54 52 52 39 52 37 19 52 47 45 42 54 45 33 35 52 52 54 52 46 52 51 24 34 34 38 35 50 51 21 51 51 50 39 42 37 25 14 10 22 37 51 50 51 22 25 51 50 18 51 41 47 33 28 38 40 47 30 41 50 54 36 50 53 36 28 50 39 39 32 26 51 50 30 27 30 28 21 46 50 17 23 19 30 37 40 46 34 32 20 58 47 46 37 51 49 40 24 50 39 58 26 49 40 40 35 44 43 31 40 9 24 38 14 22 20 17 51 37 10 43 42 28 53 35 13 29 11 16 44 23 49 37 49 28 18 28 13 32 16 29 32 35 21 42 40 28 37 7 44 11 22 18 50 50 19 18 23 37 32 31 39 39 50 37 32 8 19 29 34 17 40 32 39 21 14 32 29 15 21 33 24 34 26 27 38 33 21 11 25 14 21 32 32 33 27 6 15 19 15 12 19 14 13 37 15 23 33 19 29 29 47 23 30 18 14 9 22 6 17 16 19 32 45 52 52 37 32 31 47 13 41 35 32 40 40 16 33 52 45 47 8 31 22 14 16 13 11 18 9 6 40 26 31 27 31 34 28 18 36 13 14 32 21 9 29 28 12 6 13 18 9 6 33 10 19 9 10 9 19 21 13 33 24 15 25 30 26 7 10 9 10 18 42 7 9 30 27 14 26 30 28 15 14 14 35 21 31 6 11 24 10 22 22 12 9 46 46 9 9 46 46 31 29 6 9 12 10 22 38 19 6 29 23 8 26 10 35 16 31 21 9 19 31 30 31 30 25 11 9 19 17 12 12 11 7 5 18 28 20 6 5 9 16 32 17 9 7 18 15 10 27 11 17 12 5 5 5 5 5 6 6 11 8 20 15 13 6 5 28 41 42 27 9 6 6 11 9 11 6 12 5 4 4 7 15 19 10 27 10 6 6 4 4 4 6 30 19 23 9 6 6 4 4 9 7 11 9 11 21 11 18 9 15 10 6 16 15 10 21 4 21 27 18 10 22 30

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_65543643_65543987
seq2: B6Ng01-225J14.b_52_396

seq1  CATCATCCACAGTTCGAAGAGGGAACTCCCTGTAAATTGTTCTTTGAGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCATCCACAGTTCGAAGAGGGAACTCCCTGTAAATTGTTCTTTGAGCT  50

seq1  CTGCTCACAAGCACTACCCTTCACAGCAAAGTTAAAAACAACCCAAAAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCTCACAAGCACTACCCTTCACAGCAAAGTTAAAAACAACCCAAAAAG  100

seq1  AACTGCAGCACCAGCTGGTGCTGGTCCTCCGCAGGCCTTCAAATGCACAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGCAGCACCAGCTGGTGCTGGTCCTCCGCAGGCCTTCAAATGCACAT  150

seq1  AGCTTCACAAGAGGCTGCTGTCACAGGCCTGGCCAACAGTCTCCCTTTTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTCACAAGAGGCTGCTGTCACAGGCCTGGCCAACAGTCTCCCTTTTC  200

seq1  CAGATTACTGACATCACATAGTTAACCCTCACTTGCAGAGATTCTGTGGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATTACTGACATCACATAGTTAACCCTCACTTGCAGAGATTCTGTGGA  250

seq1  TCCAAGTAGCAGCTACCCCTGTTAATCTGTCACTGCAAATTAACAAAATC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAGTAGCAGCTACCCCTGTTAATCTGTCACTGCAAATTAACAAAATC  300

seq1  TACTTACCATTCTCACCTCCGGGGGGGTGGGTAGAGTGAGGGAGT  345
      |||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTACCATTCTCACCTCCGGGGGGGTGGGTAGAGTGAGGGAGT  345

seq1: chr9_65678525_65679637
seq2: B6Ng01-225J14.g_69_1208 (reverse)

seq1  AAAAAAATTAAATG--TCATAATCATATAAGTCCAT-AGCTAT-ACTTAT  46
      |||||||| |||||   |||||||| |||||||||| |||||| ||||||
seq2  AAAAAAATAAAATGGTACATAATCAAATAAGTCCATGAGCTATAACTTAT  50

seq1  TTGT-AAAACT-AATC--TCTGT-AGTG-TCTCACA-TTTACAT-GCTAG  88
      | || |||||| ||||  || || |||| ||||||| ||||||| |||||
seq2  TGGTAAAAACTAAATCCTTCGGTAAGTGTTCTCACATTTTACATGGCTAG  100

seq1  GGGG---AAAATA-GGTTTACACTAAAA-TTTCAGTTTAAAAAGAAAAGA  133
      ||||   |||||| |||||||||||||| |||||||||||||||||||||
seq2  GGGGGAAAAAATAGGGTTTACACTAAAATTTTCAGTTTAAAAAGAAAAGA  150

seq1  TAGGAC-ACTTAGTTCTTTATTATCTTA-GTTCTGTATTAGCT-AAAGAA  180
      |||||| ||||||||||||| ||||||| |||||||||||||| ||||||
seq2  TAGGACAACTTAGTTCTTTAATATCTTAGGTTCTGTATTAGCTAAAAGAA  200

seq1  GCAACAAAAA-CCCAAATTCTTTTTATGTTCTCCTTTGTGATAGGGACTT  229
      |||||||||| |||||||||||||||   |||||||||||||||||||||
seq2  GCAACAAAAACCCCAAATTCTTTTTAATGTCTCCTTTGTGATAGGGACTT  250

seq1  ACTATATAAGAGATAGTAAGAGATCAGCCT-CCCCAGTGCTGGG--ATTA  276
      |||||||||||||||||||||||||||||| |||||||||||||   |||
seq2  ACTATATAAGAGATAGTAAGAGATCAGCCTCCCCCAGTGCTGGGGATTTA  300

seq1  AGGTGTATACTATCACATCTGGCC-AAATTCTTAATCTATTCTAAACACT  325
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  AGGTGTATACTATCACATCTGGCCAAAATTCTTAATCTATTCTAAACACT  350

seq1  TCACTAAAGATAAGGTCTCATCAACGCTGACAAAG-CCCATAGTTTCCAT  374
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  TCACTAAAGATAAGGTCTCATCAACGCTGACAAAGCCCCATAGTTTCCAT  400

seq1  CATTCCCT-ACTGTGAGCTCATACAAAGGAAACTGAGTCTTGTCTGGGAA  423
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CATTCCCTAACTGTGAGCTCATACAAAGGAAACTGAGTCTTGTCTGGGAA  450

seq1  AAACAAAAAGAAAAAGCCAATTCCTTTACTGTATGAATTAATGGCATCTT  473
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAAAAGAAAAAGCCAATTCCTTTACTGTATGAATTAATGGCATCTT  500

seq1  AATTCAGTCATTCAAAAGGGAACACAGAAGCTACAACAAAAAGGCATCTC  523
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCAGTCATTCAAAAGGGAACACAGAAGCTACAACAAAAAGGCATCTC  550

seq1  GGAAATTCAGAACTTTCTTAGGCGAAACTGCCCCAGAGTAACAGGGTCAG  573
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATTCAGAACTTTCTTAGGCGAAACTGCCCCAGAGTAACAGGGTCAG  600

seq1  AGTGAAGTGTCATAATACACTAACAAGCTATTCTTGGACAAGCTTGAACT  623
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGAAGTGTCATAATACACTAACAAGCTATTCTTGGACAAGCTTGAACT  650

seq1  CAGGCTACTAAGAATTTCCATCTGACTTTAAAGTATACTATTCATCAGTG  673
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGCTACTAAGAATTTCCATCTGACTTTAAAGTATACTATTCATCAGTG  700

seq1  AGCAACTGAGGGCCATCTACCCGCAAACTTCTCCCACACTTCCTCCCTTG  723
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAACTGAGGGCCATCTACCCGCAAACTTCTCCCACACTTCCTCCCTTG  750

seq1  TGTCTCAGCAAACAGAAGAGAGACCTTATACTACCACTGCCATGTAAACC  773
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCAGCAAACAGAAGAGAGACCTTATACTACCACTGCCATGTAAACC  800

seq1  AAAGACAGACTTTCCCAGCCTAACCATGAAAAGGAGAAGTTTCCGAGTAG  823
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGACAGACTTTCCCAGCCTAACCATGAAAAGGAGAAGTTTCCGAGTAG  850

seq1  CTCTGCCATTTATTTATGTGGTTCTGGCTGTGTGTTTGAGAAGCTGAGGT  873
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGCCATTTATTTATGTGGTTCTGGCTGTGTGTTTGAGAAGCTGAGGT  900

seq1  GGGTTCTTAGAAACTTGCAAAGCTCGGGCAGATGAGCTCATCTGTTGACA  923
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTTCTTAGAAACTTGCAAAGCTCGGGCAGATGAGCTCATCTGTTGACA  950

seq1  TTCCTGACTTTTTTCTTTTAAGGTGTGCATTCAAATTACCCACATAGAAA  973
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTGACTTTTTTCTTTTAAGGTGTGCATTCAAATTACCCACATAGAAA  1000

seq1  AAACAATCCATACTCTTCTGTGTAAAGGCTGTCTTCAAATAAAAGAACAG  1023
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAATCCATACTCTTCTGTGTAAAGGCTGTCTTCAAATAAAAGAACAG  1050

seq1  AGAACTTCCAACCCCTTCTTTTCTCTTCCCATCCTACCTTTCAATTTTAT  1073
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACTTCCAACCCCTTCTTTTCTCTTCCCATCCTACCTTTCAATTTTAT  1100

seq1  TGTGATATTAAGAAAGCCAGACAATTTCAGCATGGAATTC  1113
      ||||||||||||||||||||||||||||||||||||||||
seq2  TGTGATATTAAGAAAGCCAGACAATTTCAGCATGGAATTC  1140

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information