MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-239F17
Chromosome	9 (Build37)
Map Location	99,408,589 - 99,529,834
singlet/doublet	doublet
Overlap gene	Armc8, Dbr1, A4gnt
Upstream gene	Rbp2, 4930579K19Rik, Copb2, Mrps22, EG623166, EG623186, 2410012M07Rik, LOC546155, LOC100040370, 7420426K07Rik, LOC100040380, LOC667347, Foxl2os, Foxl2, Faim, Gm1123, Pik3cb, LOC100040442, LOC100040757, EG623459, Cep70, D9Ertd280e, Mras, LOC623534
Downstream gene	Dzip1l, Cldn18, EG667429, Sox14, LOC667456, 4930519F24Rik, LOC100040590, Il20rb, Nck1, LOC633385, Tmem22, LOC667486
Link	Open Mouse BAC browser

Click to get alignment info.

name	Rbp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19660 MGI:97877
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930579K19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75881 MGI:1923131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs, 1 Protein

name	Copb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50797 MGI:1354962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mrps22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:64655 MGI:1928137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG623166 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623166 MGI:3645743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins

name	EG623186 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623186 MGI:3645937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	2410012M07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71979 MGI:1919229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 3 Proteins

name	LOC546155 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 350 ESTs, 2 Proteins pseudo : _no_value

name	LOC100040370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	7420426K07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546157 MGI:3588253
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC667347 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Foxl2os (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:768252 MGI:3614944
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Foxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26927 MGI:1349428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Faim (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23873 MGI:1344387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1123 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382097 MGI:2685969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pik3cb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74769 MGI:1922019
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040442 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040442
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100040757 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040757
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG623459 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623459 MGI:3647754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins

name	Cep70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68121 MGI:1915371
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D9Ertd280e (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272636 MGI:1098699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mras (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17532 MGI:1100856
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623534 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Armc8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74125 MGI:1921375
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dbr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83703 MGI:1931520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A4gnt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333424 MGI:2143261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dzip1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72507 MGI:1919757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56492 MGI:1929209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667429 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667429 MGI:3644692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein pseudo : _no_value

name	Sox14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20669 MGI:98362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 49 Proteins

name	LOC667456 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 51 ESTs pseudo : _no_value

name	4930519F24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108970 MGI:1922047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040590 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Il20rb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213208 MGI:2143266
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Nck1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17973 MGI:109601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC633385 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Tmem22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245020 MGI:2685365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins

name	LOC667486 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667486
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 Proteins pseudo : _no_value

name	Rbp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362018 GeneID:19660 MGI:97877
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinol binding protein 2, cellular transcript_id : NM_009034.3

name	Copb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344213 GeneID:50797 MGI:1354962
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coatomer protein complex, subunit beta 2 (beta prime) transcript_id : NM_015827.2

name	Mrps22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801504 GeneID:64655 MGI:1928137
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitochondrial ribosomal protein S22 transcript_id : NM_025485.2

name	EG623166 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260181 GeneID:623166 MGI:3645743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG623166 transcript_id : XM_887600.3

name	EG623186 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260182 GeneID:623186 MGI:3645937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG623186 transcript_id : XM_887617.2

name	2410012M07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386334 GeneID:71979 MGI:1919229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 3 Proteins product : RIKEN cDNA 2410012M07 gene transcript_id : XM_486251.3

name	LOC100040370 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260165 GeneID:100040370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040370 transcript_id : XM_001474560.1

name	7420426K07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803508 GeneID:546157 MGI:3588253
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 7420426K07 gene transcript_id : NM_001033983.2

name	LOC100040380 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260167 GeneID:100040380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040380 transcript_id : XM_001474580.1

name	Foxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22779927 GeneID:26927 MGI:1349428
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box L2 transcript_id : NM_012020.1

name	Faim (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981397 GeneID:23873 MGI:1344387
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fas apoptotic inhibitory molecule transcript_id : NM_011810.2

name	Gm1123 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124249110 GeneID:382097 MGI:2685969
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 1123, (NCBI) transcript_id : NM_001080776.1

name	Pik3cb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801344 GeneID:74769 MGI:1922019
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol 3-kinase, catalytic, beta polypeptide transcript_id : NM_029094.2

name	EG623459 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386339 GeneID:623459 MGI:3647754
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : predicted gene, EG623459 transcript_id : XM_887913.2

name	Cep70 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606315 GeneID:68121 MGI:1915371
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrosomal protein 70 transcript_id : NM_023873.3

name	D9Ertd280e (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:119433660 GeneID:272636 MGI:1098699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr 9, ERATO Doi 280, expressed transcript_id : NM_177775.3

name	Mras (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982419 GeneID:17532 MGI:1100856
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : muscle and microspikes RAS transcript_id : NM_008624.2

name	LOC623534 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260175 GeneID:623534
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to thioredoxin-like 2 transcript_id : XM_888010.3

name	Armc8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348917 GeneID:74125 MGI:1921375
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing 8 transcript_id : NM_028768.2

name	Dbr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377002 GeneID:83703 MGI:1931520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : debranching enzyme homolog 1 (S. cerevisiae) transcript_id : NM_031403.3

name	A4gnt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116734844 GeneID:333424 MGI:2143261
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha-1,4-N-acetylglucosaminyltransferase transcript_id : NM_001077424.1

name	Dzip1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130444 GeneID:72507 MGI:1919757
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DAZ interacting protein 1-like transcript_id : NM_028258.3

name	Cldn18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130563 GeneID:56492 MGI:1929209
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 18 transcript_id : NM_019815.2

name	Sox14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260177 GeneID:20669 MGI:98362
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 49 Proteins product : SRY-box containing gene 14 transcript_id : XM_284529.7

name	4930519F24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386346 GeneID:108970 MGI:1922047
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519F24 gene, transcript variant 2 transcript_id : XM_897583.2

name	Il20rb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370392 GeneID:213208 MGI:2143266
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 20 receptor beta transcript_id : NM_001033543.2

name	Il20rb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82524393 GeneID:213208 MGI:2143266
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 20 receptor beta transcript_id : NM_001037246.1

name	Nck1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328186 GeneID:17973 MGI:109601
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-catalytic region of tyrosine kinase adaptor protein 1 transcript_id : NM_010878.2

name	LOC633385 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260185 GeneID:633385
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical LOC633385 transcript_id : XM_001475636.1

name	Tmem22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260187 GeneID:245020 MGI:2685365
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : transmembrane protein 22 transcript_id : XM_147067.6

name	Rbp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982061 CCDS:CCDS23425.1 GeneID:19660 MGI:97877
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0016918 - retinal binding [Evidence IEA]; GO:0005501 - retinoid binding [Evidence TAS]; GO:0019841 - retinol binding [Evidence IEA] GO_process : GO:0001523 - retinoid metabolism [Evidence TAS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : retinol binding protein 2, cellular protein_id : NP_033060.2

name	Copb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789080 GeneID:50797 MGI:1354962
definition	GO_component : GO:0030126 - COPI vesicle coat [Evidence ISS]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : coatomer protein complex, subunit beta 2 (beta prime) protein_id : NP_056642.1

name	Mrps22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384904 CCDS:CCDS23427.1 GeneID:64655 MGI:1928137
definition	GO_component : GO:0005763 - mitochondrial small ribosomal subunit [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence ISS] codon_start : 1 product : ribosomal protein, mitochondrial, S22 protein_id : NP_079761.1

name	EG623166 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82930646 GeneID:623166 MGI:3645743
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892693.1

name	EG623186 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260183 GeneID:623186 MGI:3645937
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892710.2

name	2410012M07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51765068 GeneID:71979 MGI:1919229
definition	codon_start : 1 product : hypothetical protein LOC71979 protein_id : XP_486251.1

name	LOC100040370 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260166 GeneID:100040370
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474610.1

name	7420426K07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702183 CCDS:CCDS23429.1 GeneID:546157 MGI:3588253
definition	codon_start : 1 product : hypothetical protein LOC546157 protein_id : NP_001029155.1

name	LOC100040380 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260168 GeneID:100040380
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474630.1

name	Foxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779928 CCDS:CCDS23430.1 GeneID:26927 MGI:1349428
definition	GO_component : GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0043028 - caspase regulator activity [Evidence ISS]; GO:0003677 - DNA binding [Evidence IDA]; GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence TAS] [Evidence IDA] GO_process : GO:0006309 - DNA fragmentation during apoptosis [Evidence ISS]; GO:0019101 - female somatic sex determination [Evidence IMP]; GO:0042703 - menstruation [Evidence ISS]; GO:0001541 - ovarian follicle development [Evidence ISS]; GO:0043065 - positive regulation of apoptosis [Evidence ISS]; GO:0043280 - positive regulation of caspase activity [Evidence ISS]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : forkhead L2; pituitary forkhead factor; putative transcription factor foxl2 product : forkhead box L2 protein_id : NP_036150.1

name	Faim (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981398 CCDS:CCDS23431.1 GeneID:23873 MGI:1344387
definition	GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0006915 - apoptosis [Evidence IEA]; GO:0043066 - negative regulation of apoptosis [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Fas apoptotic inhibitory molecule protein_id : NP_035940.2

name	Gm1123 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124249111 GeneID:382097 MGI:2685969
definition	codon_start : 1 note : CAR-like soluble protein product : coxsackie adenovirus receptor-like protein_id : NP_001074245.1

name	Pik3cb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789235 CCDS:CCDS23432.1 GeneID:74769 MGI:1922019
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005942 - phosphoinositide 3-kinase complex [Evidence IEA] GO_function : GO:0004428 - inositol or phosphatidylinositol kinase activity [Evidence IEA]; GO:0043560 - insulin receptor substrate binding [Evidence IPI]; GO:0016301 - kinase activity [Evidence IEA]; GO:0016303 - phosphatidylinositol 3-kinase activity [Evidence IMP]; GO:0046934 - phosphatidylinositol-4,5-bisphosphate 3-kinase activity [Evidence IEA]; GO:0016773 - phosphotransferase activity, alcohol group as acceptor [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006874 - calcium ion homeostasis [Evidence IMP]; GO:0040016 - embryonic cleavage [Evidence IMP]; GO:0007156 - homophilic cell adhesion [Evidence IMP]; GO:0030168 - platelet activation [Evidence IMP]; GO:0001952 - regulation of cell-matrix adhesion [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation product : phosphatidylinositol 3-kinase, catalytic, beta polypeptide protein_id : NP_083370.1

name	EG623459 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82930662 GeneID:623459 MGI:3647754
definition	codon_start : 1 product : similar to Fas apoptotic inhibitory molecule protein_id : XP_893006.1

name	Cep70 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606316 GeneID:68121 MGI:1915371
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : p10-binding protein protein_id : NP_076362.2

name	D9Ertd280e (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:119433661 GeneID:272636 MGI:1098699
definition	codon_start : 1 product : chr3 synaptotagmin protein_id : NP_808443.2

name	Mras (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678930 CCDS:CCDS23433.1 GeneID:17532 MGI:1100856
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 function : GTPase product : muscle and microspikes RAS protein_id : NP_032650.1

name	LOC623534 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260176 GeneID:623534
definition	codon_start : 1 product : hypothetical protein protein_id : XP_893103.3

name	Armc8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229175 CCDS:CCDS23434.1 GeneID:74125 MGI:1921375
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : armadillo repeat containing 8 protein_id : NP_083044.1

name	Dbr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50399860 CCDS:CCDS23435.1 GeneID:83703 MGI:1931520
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008419 - RNA lariat debranching enzyme activity [Evidence IDA] GO_process : GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IDA] codon_start : 1 product : debranching enzyme homolog 1 protein_id : NP_113580.2

name	A4gnt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116734845 GeneID:333424 MGI:2143261
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005795 - Golgi stack [Evidence IEA] GO_function : GO:0008375 - acetylglucosaminyltransferase activity [Evidence ISS]; GO:0008378 - galactosyltransferase activity [Evidence IEA] GO_process : GO:0009101 - glycoprotein biosynthesis [Evidence ISS] codon_start : 1 product : alpha-1,4-N-acetylglucosaminyltransferase protein_id : NP_001070892.1

name	Dzip1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71896653 CCDS:CCDS23436.1 GeneID:72507 MGI:1919757
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] [Evidence ISS]; GO:0043234 - protein complex [Evidence ISS] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007281 - germ cell development [Evidence ISS] codon_start : 1 product : DAZ interacting protein 1-like protein_id : NP_082534.2

name	Cldn18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790075 CCDS:CCDS23437.1 GeneID:56492 MGI:1929209
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence ISS] [Evidence IEA] GO_function : GO:0042802 - identical protein binding [Evidence ISS]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence ISS] codon_start : 1 note : Claudin-18 product : claudin 18 protein_id : NP_062789.1

name	Sox14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260178 GeneID:20669 MGI:98362
definition	codon_start : 1 product : SRY-box 14 protein_id : XP_284529.4

name	4930519F24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82930608 GeneID:108970 MGI:1922047
definition	codon_start : 1 product : hypothetical protein LOC108970 isoform 2 protein_id : XP_902676.1

name	Il20rb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702053 CCDS:CCDS23438.1 GeneID:213208 MGI:2143266
definition	codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; fibronectin type III domain containing 6 product : fibronectin type III domain containing 6 isoform 2 protein_id : NP_001028715.1

name	Il20rb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82524394 CCDS:CCDS23439.1 GeneID:213208 MGI:2143266
definition	codon_start : 1 note : isoform 1 is encoded by transcript variant 1; fibronectin type III domain containing 6 product : fibronectin type III domain containing 6 isoform 1 protein_id : NP_001032323.1

name	Nck1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328187 CCDS:CCDS23440.1 GeneID:17973 MGI:109601
definition	GO_component : GO:0012506 - vesicle membrane [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007015 - actin filament organization [Evidence IMP]; GO:0016477 - cell migration [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0030032 - lamellipodium biogenesis [Evidence IMP] codon_start : 1 product : non-catalytic region of tyrosine kinase adaptor protein 1 protein_id : NP_035008.2

name	LOC633385 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260186 GeneID:633385
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475686.1

name	Tmem22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260188 GeneID:245020 MGI:2685365
definition	codon_start : 1 product : similar to Transmembrane protein 22 protein_id : XP_147067.5

name	LOC667347 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667347
definition	number : 1 pseudo : _no_value

name	LOC100040442 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040442
definition	number : 1 pseudo : _no_value

name	LOC100040442 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040442
definition	number : 2 pseudo : _no_value

name	LOC100040442 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040442
definition	number : 3 pseudo : _no_value

name	LOC100040757 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040757
definition	number : 1 pseudo : _no_value

name	LOC100040590 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040590
definition	number : 1 pseudo : _no_value

name	LOC667486 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667486
definition	number : 4 pseudo : _no_value

name	4930579K19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260180 GeneID:75881 MGI:1923131
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 13 ESTs, 1 Protein product : RIKEN cDNA 4930579K19 gene transcript_id : XR_035250.1

name	LOC546155 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260164 GeneID:546155
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 350 ESTs, 2 Proteins product : similar to F-actin capping protein subunit alpha-1 (CapZ 36/32) (Beta-actinin subunit I) pseudo : _no_value transcript_id : XR_031804.1

name	Foxl2os (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:141803134 GeneID:768252 MGI:3614944
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : forkhead box L2 opposite strand transcript transcript_id : NR_003248.2

name	EG667429 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149260184 GeneID:667429 MGI:3644692
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 Protein product : predicted gene, EG667429 pseudo : _no_value transcript_id : XR_032281.1

name	LOC667456 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260179 GeneID:667456
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 51 ESTs product : similar to membrane-associated ring finger (C3HC4) 5 pseudo : _no_value transcript_id : XR_031975.1

clone name	MSMg01-471A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-463J23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050H23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398C08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307K17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-059P11
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-463I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-402N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-536E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-237L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-370E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-176O06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-420N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173F12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-166O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115O05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136L15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-377E24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-209O06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382D05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-070M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-106O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478G18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-298G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-425G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-085K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-091G05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443P24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-383G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260P20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304D22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110P22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-087H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-033D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-129P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-301E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210L23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-239F17.b	B6Ng01-239F17.g
ACC	GA049804	GA049805
length	1,180	949
definition	B6Ng01-239F17.b	B6Ng01-239F17.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(99,408,589 - 99,409,771)	(99,529,051 - 99,529,834)
sequence	gaattcatcagaggctatgtgtgtgtaggagaatgagacacagaattact ttctaacaaaacactagtggctctcacttcaggtgcttaggaagctagca tgggcaagacctgaaagagactaatggaccatgtttactggccacactta gtcaaagaagtaaccctgcgaagtgacgggctagtataacagtcatgtaa cacctaataaagacgatctcaatatagtaccaggtcatcagtacctgagc tgggaaggggcttgccaccaagcttgacaacctgagtctgattcctagaa cccacattgggaagaactgacttccaaaagttatcctctaacctccacac atgcaccacagcacctacgtacacatacaacagttgtgtaaatattcctc acaaacagacatatgtaaaaataaagaaatgtttgaaaccgcttagccta tgaaagttctaattctacagaagtgatgggctagagaattctgaaagctt cctatggctccacatcaaggctatgacctccttcccaatgctattacggc cagcaatcaaacagcccccagggagaggaaataaggcgttgaccaaaata aaatagtggatagtcaaacctgtgggagagggtgtaatacagtatcatgc agtggtctgctatagaatcgtaggcaatccattttgcctctcggagactt cagcaaaatgaaaccattccaagttatcaatgggaaacagcaactggcct ctctggacaagaccatcatgctgttcagaagcaatatagaaagcaaggta agcaggagaaaaaacaggggctgacttagaccgagagatatacacaccaa accagggaaggtaattattaatccagtttccacctgcattcctggcctca tttattcagcaaatatgggtgtctagtagtgaacatgggtttacaacgca agaaaacagtagtgatgggagagattccttccttcatcaaacttgtgctg aaacaactaccatttaactggtggtgctatgaacacttgtatctaacaga atgcaaagcatctaaagaaatgacagattatggggataaaggggacagaa atgagagaaaacatgaattaaagcaggtagcacatagccattcctgagat gacttgctatgaatggggaatgaccaccaa	ttaaggaaatccagcatccaagttcccaggccttgatgagcggcaggaca gactctgtcaccatcccttcacttcacatggcaggatgcagcgactgttg gcaagcccgcaaaattaaaggaatttgacctgagccacattaggagaccc ataggtgtgctccaatttgatcagatggcaatcacctttcagatccctta tccattaacgttgcccagaaagctccggcaggagttgggggtattatatt ttctctcctgattatagatccctgccccctctcgttgggactctcatctc gtgactttaagttctgggagggtttgttgtatcttagggcctttctctca acacagcttcaaaatgccaagctctgcatcttggggacagcaaggacaaa agccctaggaataaacgttgccaagggtggggagaaactcaaatttctgt gcgttattgatgggaattcaaaatggtactgccactgtgggaaacaaaat ggtttgccatgattcagcactatttgaaaatattacaaggattaggaggt atagccttgttggagaaagtgtgacactggaggtgggctttgaggtttca aaacgcccatgtcagacccagtcttcgcccacccttacgggtcaggtggg tcaggatgtaactcttaactatttctccaacaccaggcctgcctgctacc atactccctgcaattatgataaatggactaagcctctgatactgtaagca agcctccagttaagtacttttctttttcataagagttaccttggtcatgg ggtctcttctcagcaacagaataataaataaggcacatgtctagatctat atccaaagaagcttaaagcaagaccccaaacaaactcttggacacttgta tttaatgagctgtcaaaatggctcagcaggtaaagggctttgtcatcaa
quality values	Open. Hide. 58 31 33 32 58 38 18 47 47 25 40 62 62 62 62 62 62 47 62 62 62 62 62 62 43 62 62 62 62 59 47 59 59 28 49 59 50 35 45 59 59 59 62 59 62 62 62 62 62 54 49 62 62 59 62 62 59 51 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 54 62 62 59 62 54 54 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 59 59 59 62 54 62 62 62 59 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 49 54 62 62 62 62 62 62 59 62 62 62 59 62 59 62 62 59 59 62 62 62 62 59 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 41 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 47 47 58 50 49 49 49 53 58 29 49 58 58 42 51 58 58 58 58 50 58 58 58 58 42 37 41 37 58 58 58 53 52 58 58 54 54 47 51 54 58 54 51 49 58 58 54 53 53 58 51 50 58 58 58 58 58 58 58 58 50 58 37 58 49 46 58 50 51 58 51 53 52 53 53 49 54 49 47 51 54 58 53 53 53 34 58 58 50 53 51 54 49 58 52 53 53 39 58 41 50 47 49 50 51 32 58 41 52 51 50 37 50 50 51 58 58 51 53 50 54 49 49 49 53 54 50 39 19 32 35 49 49 53 33 42 53 42 54 54 50 40 47 29 36 37 40 50 32 54 53 44 27 24 45 41 54 53 45 52 52 39 32 49 54 33 33 51 54 33 42 40 42 47 29 47 45 40 54 44 31 51 51 39 52 39 41 41 44 38 30 35 51 34 53 26 47 37 52 45 40 40 52 37 47 42 33 47 32 39 40 53 37 31 53 32 46 42 32 45 34 32 51 52 53 32 32 39 29 28 46 33 53 46 32 47 20 24 22 42 20 51 49 51 51 51 37 31 24 31 46 46 31 30 45 30 27 29 31 51 30 24 12 9 38 31 31 26 33 28 25 28 30 32 33 30 29 45 32 30 51 42 46 30 21 31 20 33 48 36 31 35 34 42 18 37 31 31 42 30 24 27 29 26 41 42 31 21 29 35 48 35 37 37 26 27 33 31 37 31 27 39 21 23 33 25 31 31 18 23 31 32 26 24 47 39 29 31 37 27 23 30 32 30 46 31 30 25 31 31 47 33 20 31 31 32 36 36 36 31 29 6 33 37 38 27 16 11 18 8 47 14 31 36 31 16 13 10 31 31 14 25 24 29 27 32 44 44 23 22 17 19 28 32 13 17 23 21 21 12 34 11 24 14 28 22 24 21 29 17 8 16 14 12 23 7 9 5 17 34 27 32 43 16 17 17 13 8 4 9 32 26 27 16 47 12 30 26 33 30 21 12 17 10 28 13 38 13 19 16 28 19 17 13 11 10 3 5 26 20 28 24 27 27 21 5 4 8 11 21 9 13 11 16 27 26 16 9 8 9 6 6 7 13 10 11 28 16 47 17 7 12 7 13 26 22 28 21 17 5 15 27 18 6 11 22 13 9 4 2 5 23 15 11 8 14 3 3 1 3 3 25 6 17 29 26 15 4 4 4 12 8 26 14 8 6 5 4 5 6 11 25 28 14 14 5 14 9 14 22 5 6 21 12 4 3 2 5 11 15 10 6 3 2 4 3 2 3 7 16 23 25 7 11 10 8 4 4 5 14 4 9 4 6 3 2 3 3 7 15 6 5 10 6 11 17 4 8 17 30 17 11 15 7 7 6 4 22 6 7 14 4 8	Open. Hide. 62 44 62 59 56 62 43 46 56 59 62 35 46 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 20 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 59 59 62 62 62 62 59 62 49 49 54 62 62 62 62 59 62 62 62 62 62 59 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 56 62 54 33 54 56 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 38 62 62 62 62 62 62 62 62 37 46 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 54 58 58 58 58 58 54 54 58 58 45 45 58 54 47 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 42 42 54 58 54 49 58 41 58 54 54 54 54 54 54 58 58 58 58 58 58 58 58 58 52 58 58 58 51 54 58 51 58 45 51 51 54 51 58 58 54 39 58 51 54 58 47 47 54 51 58 51 46 41 58 50 58 51 49 34 58 58 51 42 41 45 38 39 48 58 54 58 49 54 46 58 24 48 54 46 47 41 52 51 52 50 46 49 44 44 42 29 41 41 48 51 42 42 49 58 58 49 50 48 16 58 37 51 58 49 50 40 50 33 58 32 32 58 50 50 50 34 53 53 58 40 50 34 32 33 41 51 58 46 41 47 40 37 17 49 38 33 49 49 39 37 54 35 54 47 51 40 49 34 50 29 37 43 49 45 42 37 35 47 42 32 54 54 42 51 42 47 39 42 49 41 33 53 54 40 31 54 44 35 54 44 34 30 33 25 27 28 47 35 47 39 41 37 41 25 32 45 37 41 32 37 33 32 45 33 44 39 38 42 31 32 47 32 29 51 46 30 53 31 40 31 33 53 51 52 45 33 29 52 52 53 52 28 22 34 29 51 33 53 21 22 23 30 15 31 40 34 41 17 25 35 31 32 31 46 46 45 29 30 31 36 39 39 43 34 31 30 14 31 21 28 33 23 32 35 30 31 24 29 31 31 51 42 32 33 31 18 38 19 30 28 23 33 32 43 31 36 37 31 31 32 32 25 28 30 29 43 33 33 24 40 31 30 35 46 22 32 30 28 21 46 29 31 18 7 29 29 25 15 32 32 29 19 38 32 20 27 46 7 22 33 30 26 32 25 32 30 20 24 24 27 30 30 30 25 30 48 31 22 23 31 36 31 24 34 36 31 26 23 12 41 43 22 23 27 34 23 33 32 31 9 32 11 4 9 18 31 47 9 17 41 21 21 33 48 17 17 22 31 27 32 21 16 23

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_99408589_99409771
seq2: B6Ng01-239F17.b_44_1223

seq1  GAATTCATCAGAGGCTATGTGTGTGTAGGAGAATGAGACACAGAATTACT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCAGAGGCTATGTGTGTGTAGGAGAATGAGACACAGAATTACT  50

seq1  TTCTAACAAAACACTAGTGGCTCTCACTTCAGGTGCTTAGGAAGCTAGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAACAAAACACTAGTGGCTCTCACTTCAGGTGCTTAGGAAGCTAGCA  100

seq1  TGGGCAAGACCTGAAAGAGACTAATGGACCATGTTTACTGGCCACACTTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCAAGACCTGAAAGAGACTAATGGACCATGTTTACTGGCCACACTTA  150

seq1  GTCAAAGAAGTAACCCTGCGAAGTGACGGGCTAGTATAACAGTCATGTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAAAGAAGTAACCCTGCGAAGTGACGGGCTAGTATAACAGTCATGTAA  200

seq1  CACCTAATAAAGACGATCTCAATATAGTACCAGGTCATCAGTACCTGAGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTAATAAAGACGATCTCAATATAGTACCAGGTCATCAGTACCTGAGC  250

seq1  TGGGAAGGGGCTTGCCACCAAGCTTGACAACCTGAGTCTGATTCCTAGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAAGGGGCTTGCCACCAAGCTTGACAACCTGAGTCTGATTCCTAGAA  300

seq1  CCCACATTGGGAAGAACTGACTTCCAAAAGTTATCCTCTAACCTCCACAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCACATTGGGAAGAACTGACTTCCAAAAGTTATCCTCTAACCTCCACAC  350

seq1  ATGCACCACAGCACCTACGTACACATACAACAGTTGTGTAAATATTCCTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCACCACAGCACCTACGTACACATACAACAGTTGTGTAAATATTCCTC  400

seq1  ACAAACAGACATATGTAAAAATAAAGAAATGTTTGAAACCGCTTAGCCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAACAGACATATGTAAAAATAAAGAAATGTTTGAAACCGCTTAGCCTA  450

seq1  TGAAAGTTCTAATTCTACAGAAGTGATGGGCTAGAGAATTCTGAAAGCTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAGTTCTAATTCTACAGAAGTGATGGGCTAGAGAATTCTGAAAGCTT  500

seq1  CCTATGGCTCCACATCAAGGCTATGACCTCCTTCCCAATGCTATTACGGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATGGCTCCACATCAAGGCTATGACCTCCTTCCCAATGCTATTACGGC  550

seq1  CAGCAATCAAACAGCCCCCAGGGAGAGGAAATAAGGCGTTGACCAAAATA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAATCAAACAGCCCCCAGGGAGAGGAAATAAGGCGTTGACCAAAATA  600

seq1  AAATAGTGGATAGTCAAACCTGTGGGAGAGGGTGTAATACAGTATCATGC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGTGGATAGTCAAACCTGTGGGAGAGGGTGTAATACAGTATCATGC  650

seq1  AGTGGTCTGCTATAGAATCGTAGGCAATCCATTTTGCCTCTCGGAGACTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGTCTGCTATAGAATCGTAGGCAATCCATTTTGCCTCTCGGAGACTT  700

seq1  CAGCAAAATGAAACCATTCCAAGTTATCAATGGGAAACAGCAACTGGCCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCAAAATGAAACCATTCCAAGTTATCAATGGGAAACAGCAACTGGCCT  750

seq1  CTCTGGACAAGACCATCATGCTGTTCAGAAGCAATATAGAAAGCAAGGTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGGACAAGACCATCATGCTGTTCAGAAGCAATATAGAAAGCAAGGTA  800

seq1  AGCAGGAGAAAAAACAGGGGCTGACTTAGACCGAGAGATATACACACCAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGGAGAAAAAACAGGGGCTGACTTAGACCGAGAGATATACACACCAA  850

seq1  ACCAGGGAAGGTAATTATTAATCCAGTTTCCACCTGCATTCCTGGCCTCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGGGAAGGTAATTATTAATCCAGTTTCCACCTGCATTCCTGGCCTCA  900

seq1  TTTATTCAGCAAATATGGGTGTCTAGTAGTGAACAT-GGTTTACAACGCA  949
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  TTTATTCAGCAAATATGGGTGTCTAGTAGTGAACATGGGTTTACAACGCA  950

seq1  AGAAAACAGTAGTGAT-GGAGAGATTCCTTCCTTTCATCAAACTTGGTGC  998
      |||||||||||||||| ||||||||||||||| |||||||||||| ||||
seq2  AGAAAACAGTAGTGATGGGAGAGATTCCTTCC-TTCATCAAACTT-GTGC  998

seq1  TG-AACAACTACCA-TTAACT-GTGGTGCTATG-ACACTTGTATCT-ACA  1043
      || ||||||||||| |||||| ||||||||||| |||||||||||| |||
seq2  TGAAACAACTACCATTTAACTGGTGGTGCTATGAACACTTGTATCTAACA  1048

seq1  G-ATGCAAAAGCATCTAAAAGAATGACAGGATTATGGGGTTAAGGGGGAC  1092
      | |||| ||||||||||||  ||||||| |||||||||| ||| ||||||
seq2  GAATGC-AAAGCATCTAAAGAAATGACA-GATTATGGGGATAAAGGGGAC  1096

seq1  AG-AATGAGAG-AAACATGAATAAAAGGCAGGTAGGAACCATAGCCATTC  1140
      || |||||||| |||||||||| ||| |||||||| |  |||||||||||
seq2  AGAAATGAGAGAAAACATGAATTAAA-GCAGGTAGCA--CATAGCCATTC  1143

seq1  TGAAGAATGAGGGTTTTGCTATGAATTGGGGAATGACCACCAA  1183
         || ||||     |||||||||| |||||||||||||||||
seq2  CTGAG-ATGA----CTTGCTATGAA-TGGGGAATGACCACCAA  1180

seq1: chr9_99529051_99529834
seq2: B6Ng01-239F17.g_72_855 (reverse)

seq1  TCTTATGAAAAAGAAAAGTACTTAACTGGAGGCTTGCTTACAGTATCAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATGAAAAAGAAAAGTACTTAACTGGAGGCTTGCTTACAGTATCAGA  50

seq1  GGCTTAGTCCATTTATCATAATTGCAGGGAGTATGGTAGCAGGCAGGCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTTAGTCCATTTATCATAATTGCAGGGAGTATGGTAGCAGGCAGGCCT  100

seq1  GGTGTTGGAGAAATAGTTAAGAGTTACATCCTGACCCACCTGACCCGTAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGTTGGAGAAATAGTTAAGAGTTACATCCTGACCCACCTGACCCGTAA  150

seq1  GGGTGGGCGAAGACTGGGTCTGACATGGGCGTTTTGAAACCTCAAAGCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGGGCGAAGACTGGGTCTGACATGGGCGTTTTGAAACCTCAAAGCCC  200

seq1  ACCTCCAGTGTCACACTTTCTCCAACAAGGCTATACCTCCTAATCCTTGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTCCAGTGTCACACTTTCTCCAACAAGGCTATACCTCCTAATCCTTGT  250

seq1  AATATTTTCAAATAGTGCTGAATCATGGCAAACCATTTTGTTTCCCACAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATTTTCAAATAGTGCTGAATCATGGCAAACCATTTTGTTTCCCACAG  300

seq1  TGGCAGTACCATTTTGAATTCCCATCAATAACGCACAGAAATTTGAGTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCAGTACCATTTTGAATTCCCATCAATAACGCACAGAAATTTGAGTTT  350

seq1  CTCCCCACCCTTGGCAACGTTTATTCCTAGGGCTTTTGTCCTTGCTGTCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCCACCCTTGGCAACGTTTATTCCTAGGGCTTTTGTCCTTGCTGTCC  400

seq1  CCAAGATGCAGAGCTTGGCATTTTGAAGCTGTGTTGAGAGAAAGGCCCTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGATGCAGAGCTTGGCATTTTGAAGCTGTGTTGAGAGAAAGGCCCTA  450

seq1  AGATACAACAAACCCTCCCAGAACTTAAAGTCACGAGATGAGAGTCCCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATACAACAAACCCTCCCAGAACTTAAAGTCACGAGATGAGAGTCCCAA  500

seq1  CGAGAGGGGGCAGGGATCTATAATCAGGAGAGAAAATATAATACCCCCAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGAGAGGGGGCAGGGATCTATAATCAGGAGAGAAAATATAATACCCCCAA  550

seq1  CTCCTGCCGGAGCTTTCTGGGCAACGTTAATGGATAAGGGATCTGAAAGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGCCGGAGCTTTCTGGGCAACGTTAATGGATAAGGGATCTGAAAGG  600

seq1  TGATTGCCATCTGATCAAATTGGAGCACACCTATGGGTCTCCTAATGTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGCCATCTGATCAAATTGGAGCACACCTATGGGTCTCCTAATGTGG  650

seq1  CTCAGGTCAAATTCCTTTAATTTTGCGGGCTTGCCAACAGTCGCTGCATC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGTCAAATTCCTTTAATTTTGCGGGCTTGCCAACAGTCGCTGCATC  700

seq1  CTGCCATGTGAAGTGAAGGGATGGTGACAGAGTCTGTCCTGCCGCTCATC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCATGTGAAGTGAAGGGATGGTGACAGAGTCTGTCCTGCCGCTCATC  750

seq1  AAGGCCTGGGAACTTGGATGCTGGATTTCCTTAA  784
      ||||||||||||||||||||||||||||||||||
seq2  AAGGCCTGGGAACTTGGATGCTGGATTTCCTTAA  784

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information