MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-259N07
Chromosome	9 (Build37)
Map Location	114,138,472 - 114,266,418
singlet/doublet	doublet
Overlap gene	4921528I07Rik, Bcl2a1c
Upstream gene	LOC100043802, LOC636680, Pdcd6ip, Clasp2, Ubp1, Fbxl2, Susd5, EG665719
Downstream gene	4930520O04Rik, Crtap, Glb1, Ccr4, Trim71, LOC100043808, Cnot10, LOC665772, Dync1li1, Cmtm6, Cmtm7, Cmtm8, Gpd1l, LOC100043813, Osbpl10, LOC100043812, Stt3b, LOC100039567
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043802 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC636680 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636680
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 24 Proteins pseudo : _no_value

name	Pdcd6ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18571 MGI:1333753
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Clasp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76499 MGI:1923749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Ubp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22221 MGI:104889
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Fbxl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72179 MGI:1919429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Susd5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382111 MGI:2685972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs

name	EG665719 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665719 MGI:3643335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	4921528I07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77049 MGI:1924299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein

name	Bcl2a1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12046 MGI:1278327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930520O04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75116 MGI:1922366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Crtap (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56693 MGI:1891221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12091 MGI:88151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12773 MGI:107824
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trim71 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636931 MGI:2685973
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043808 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Cnot10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78893 MGI:1926143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665772 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 9 Proteins pseudo : _no_value

name	Dync1li1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:235661 MGI:2135610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67213 MGI:2447165
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102545 MGI:2447166
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cmtm8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70031 MGI:2447167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpd1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333433 MGI:1289257
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043813 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043813
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 497 ESTs, 1 Protein

name	Osbpl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74486 MGI:1921736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Stt3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68292 MGI:1915542
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039567 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC100043802 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260393 GeneID:100043802
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100043802 transcript_id : XM_001481080.1

name	Pdcd6ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755001 GeneID:18571 MGI:1333753
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : programmed cell death 6 interacting protein transcript_id : NM_011052.1

name	Clasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506305 GeneID:76499 MGI:1923749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLIP associating protein 2 transcript_id : NM_001081960.1

name	Clasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126506303 GeneID:76499 MGI:1923749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CLIP associating protein 2 transcript_id : NM_029633.2

name	Ubp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134032031 GeneID:22221 MGI:104889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding protein 1 transcript_id : NM_001083319.1

name	Ubp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134031988 GeneID:22221 MGI:104889
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : upstream binding protein 1 transcript_id : NM_013699.2

name	Fbxl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363633 GeneID:72179 MGI:1919429
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : F-box and leucine-rich repeat protein 2 transcript_id : NM_178624.4

name	Susd5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386581 GeneID:382111 MGI:2685972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs product : sushi domain containing 5 transcript_id : XM_356198.5

name	EG665719 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386582 GeneID:665719 MGI:3643335
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : predicted gene, EG665719 transcript_id : XM_978968.1

name	4921528I07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94386584 GeneID:77049 MGI:1924299
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs, 1 Protein product : RIKEN cDNA 4921528I07 gene transcript_id : XM_486266.3

name	Bcl2a1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113679690 GeneID:12046 MGI:1278327
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell leukemia/lymphoma 2 related protein A1c transcript_id : NM_007535.2

name	4930520O04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149260396 GeneID:75116 MGI:1922366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 4930520O04 gene transcript_id : XM_001481086.1

name	Crtap (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910169 GeneID:56693 MGI:1891221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cartilage associated protein transcript_id : NM_019922.1

name	Glb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753189 GeneID:12091 MGI:88151
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactosidase, beta 1 transcript_id : NM_009752.1

name	Ccr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6857772 GeneID:12773 MGI:107824
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-C motif) receptor 4 transcript_id : NM_009916.1

name	Trim71 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:109948299 GeneID:636931 MGI:2685973
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tripartite motif-containing 71 transcript_id : NM_001042503.1

name	LOC100043808 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260398 GeneID:100043808
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100043808 transcript_id : XM_001481088.1

name	Cnot10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387942 GeneID:78893 MGI:1926143
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CCR4-NOT transcription complex, subunit 10 transcript_id : NM_153585.4

name	Dync1li1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130200 GeneID:235661 MGI:2135610
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein cytoplasmic 1 light intermediate chain 1 transcript_id : NM_146229.2

name	Cmtm6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383888 GeneID:67213 MGI:2447165
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 6 transcript_id : NM_026036.2

name	Cmtm7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527197 GeneID:102545 MGI:2447166
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 7 transcript_id : NM_133978.1

name	Cmtm8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373686 GeneID:70031 MGI:2447167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CKLF-like MARVEL transmembrane domain containing 8 transcript_id : NM_027294.2

name	Gpd1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388353 GeneID:333433 MGI:1289257
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerol-3-phosphate dehydrogenase 1-like transcript_id : NM_175380.4

name	LOC100043813 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260403 GeneID:100043813
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 497 ESTs, 1 Protein product : similar to metallopanstimulin transcript_id : XM_001481092.1

name	Osbpl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130153 GeneID:74486 MGI:1921736
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oxysterol binding protein-like 10 transcript_id : NM_148958.2

name	LOC100043812 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260401 GeneID:100043812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical protein LOC100043812 transcript_id : XM_001481091.1

name	Stt3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61651672 GeneID:68292 MGI:1915542
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) transcript_id : NM_024222.2

name	LOC100039567 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149260337 GeneID:100039567
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to Ubtf protein transcript_id : XM_001473117.1

name	LOC100043802 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260394 GeneID:100043802
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481130.1

name	Pdcd6ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755002 CCDS:CCDS23588.1 GeneID:18571 MGI:1333753
definition	GO_component : GO:0005829 - cytosol [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006915 - apoptosis [Evidence TAS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : programmed cell death 6 interacting protein protein_id : NP_035182.1

name	Clasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126506306 GeneID:76499 MGI:1923749
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IDA] codon_start : 1 note : isoform b is encoded by transcript variant 2; CLASP2alpha; CLASP2gamma product : CLIP-associating protein CLASP2 isoform b protein_id : NP_001075429.1

name	Clasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126506304 GeneID:76499 MGI:1923749
definition	GO_component : GO:0005881 - cytoplasmic microtubule [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008017 - microtubule binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IDA] codon_start : 1 note : isoform a is encoded by transcript variant 1; CLASP2alpha; CLASP2gamma product : CLIP-associating protein CLASP2 isoform a protein_id : NP_083909.2

name	Ubp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:134032032 GeneID:22221 MGI:104889
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : upstream binding protein 1 isoform a protein_id : NP_001076788.1

name	Ubp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305605 GeneID:22221 MGI:104889
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0001525 - angiogenesis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : upstream binding protein 1 isoform b protein_id : NP_038727.1

name	Fbxl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519963 GeneID:72179 MGI:1919429
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : F-box and leucine-rich repeat protein 2 protein_id : NP_848739.1

name	Susd5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63595304 GeneID:382111 MGI:2685972
definition	codon_start : 1 product : similar to KIAA0527 protein protein_id : XP_356198.3

name	EG665719 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386583 GeneID:665719 MGI:3643335
definition	codon_start : 1 product : hypothetical protein protein_id : XP_984062.1

name	4921528I07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94386585 GeneID:77049 MGI:1924299
definition	codon_start : 1 product : hypothetical protein LOC77049 protein_id : XP_486266.3

name	Bcl2a1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113679691 CCDS:CCDS23591.1 GeneID:12046 MGI:1278327
definition	GO_process : GO:0042981 - regulation of apoptosis [Evidence IEA] codon_start : 1 note : hematopoietic-specific early-response A1-c protein product : B-cell leukemia/lymphoma 2 related protein A1c protein_id : NP_031561.2

name	4930520O04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149260397 GeneID:75116 MGI:1922366
definition	codon_start : 1 product : hypothetical protein LOC75116 protein_id : XP_001481136.1

name	Crtap (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910170 CCDS:CCDS23592.1 GeneID:56693 MGI:1891221
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cartilage associated protein protein_id : NP_064306.1

name	Glb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753190 CCDS:CCDS23593.1 GeneID:12091 MGI:88151
definition	GO_component : GO:0009341 - beta-galactosidase complex [Evidence IEA]; GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004565 - beta-galactosidase activity [Evidence IDA]; GO:0043169 - cation binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : beta-galactosidase temporal; beta-galactosidase electrophoretic; beta-galactosidase systemic regulator; beta-galactosidase complex product : galactosidase, beta 1 protein_id : NP_033882.1

name	Ccr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6857773 CCDS:CCDS23594.1 GeneID:12773 MGI:107824
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IMP]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IMP]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IMP]; GO:0001764 - neuron migration [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : fusin; chemokine (C-C) receptor 4; CC CKR-4; leukocyte-expressed seven-transmembrane-domain receptor product : chemokine (C-C motif) receptor 4 protein_id : NP_034046.1

name	Trim71 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:109948300 GeneID:636931 MGI:2685973
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : lin-41 homolog product : tripartite motif-containing 71 protein_id : NP_001035968.1

name	LOC100043808 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260399 GeneID:100043808
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481138.1

name	Cnot10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31324571 GeneID:78893 MGI:1926143
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : CCR4-NOT transcription complex, subunit 10 protein_id : NP_705813.2

name	Dync1li1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122795 CCDS:CCDS23595.1 GeneID:235661 MGI:2135610
definition	GO_component : GO:0005868 - cytoplasmic dynein complex [Evidence ISS]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005525 - GTP binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence ISS]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence ISS]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : dynein, cytoplasmic, light intermediate chain 1 protein_id : NP_666341.1

name	Cmtm6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313082 CCDS:CCDS23596.1 GeneID:67213 MGI:2447165
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 note : chemokine-like factor super family 6 product : chemokine-like factor superfamily 6 protein_id : NP_080312.1

name	Cmtm7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527198 GeneID:102545 MGI:2447166
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 7 protein_id : NP_598739.1

name	Cmtm8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312514 CCDS:CCDS23597.1 GeneID:70031 MGI:2447167
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA] codon_start : 1 product : chemokine-like factor super family 8 protein_id : NP_081570.1

name	Gpd1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34594657 CCDS:CCDS23598.1 GeneID:333433 MGI:1289257
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0051287 - NAD binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0046168 - glycerol-3-phosphate catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glycerol-3-phosphate dehydrogenase 1-like protein_id : NP_780589.2

name	LOC100043813 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260404 GeneID:100043813
definition	codon_start : 1 product : similar to metallopanstimulin protein_id : XP_001481142.1

name	Osbpl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22507367 GeneID:74486 MGI:1921736
definition	GO_process : GO:0006869 - lipid transport [Evidence IEA]; GO:0008202 - steroid metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : oxysterol-binding protein-like protein 10 protein_id : NP_683761.1

name	LOC100043812 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260402 GeneID:100043812
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481141.1

name	Stt3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61651673 CCDS:CCDS23599.1 GeneID:68292 MGI:1915542
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence ISS] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence IEA] [Evidence ISS]; GO:0003674 - molecular_function [Evidence ND]; GO:0004576 - oligosaccharyl transferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006486 - protein amino acid glycosylation [Evidence IEA]; GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence ISS] codon_start : 1 product : source of immunodominant MHC-associated peptides protein_id : NP_077184.2

name	LOC100039567 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149260338 GeneID:100039567
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473167.1

name	LOC636680 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260395 GeneID:636680
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 24 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_034977.1

name	LOC665772 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149260400 GeneID:665772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 ESTs, 9 Proteins product : similar to ribosomal protein S17 pseudo : _no_value transcript_id : XR_034988.1

clone name	MSMg01-062I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-211J05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-431A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504E20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-355J17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-053N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-140O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315N23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-500M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318F19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-365N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-176H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-472C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-403E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294N02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532G11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-075I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054C22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-410E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-294P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-338B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-366B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-403P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-340H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-379E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-126L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-216F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-082A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-157A20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-373C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-215J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321C10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082D23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149H02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-270G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-220H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-029F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188P01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-293O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140I22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-075F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140H21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-264B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-087B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338K06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N19
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-259N07.b	B6Ng01-259N07.g
ACC	GA064912	GA064913
length	1,175	1,120
definition	B6Ng01-259N07.b	B6Ng01-259N07.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(114,265,245 - 114,266,418)	(114,138,472 - 114,139,594)
sequence	gaattcacttgatctccttcagttgtcttttttcccccaattttattagg tatttacttcatttacatttcaaatgctattccaaaattcttctataccc tccccaaccccctgctcccctacccacccactcctacttctttgccctgg cgttcccctgtactggggcatataaagtttgcaagaccaaggggcctctc ttcccaatgatggctgactaggccatcttctgctacatatgcagctagag acacgagctctgggggtactgattagctcttattgttgttccacctatag ggatacagaccccttcagatccttgggtactttctctagctcctccattg ggagccttgtgttccacccaatagctgactgtgtgcatccacttttgtgt ttgccaggcatggcatagcttcacaagagacaacaatatcagggtccttt cagcaaaattaaaggcaggcctatagacgttttcatttttactgatctcc agtacagcttgaaatcaggaatggtgataccttcagaagtcttttattgt acattagggatttagctatcctggagttctgttgttccatatgaaggtga gaggtgttctttcaaggtctgtagagttgtgttggaattttaatgggaat tgtagattgcttttggtaagatggctatttccacacgatatttgtgacta tggcccacacttgaatagcccagcgatagggcacttactcatggaagaaa gttctgcccagcagcatgatttccaaaacgtaaattttcaagcagctttc tataaactgcacattaagttagaatgcagagggacaagatttctggaaaa tacgcattttgacaactctcccgtgacattcttatgcgagttaaagttag aggcacattcttacaaagatccaagatctgatttctagatgtcaaactaa tacagagctaggtgaatgtcagatgtggataaggaagagatcgagcttat cctgccatcaggatattaaagtgactataataaaataaattaattaatga aaataaataaatttcactttgacaagaggataagggaaaaggacaagaag aattcaaattacccccagccccaattcttcaaggcatgaaaatcaaagcc agttatttattatgtgcagatgttt	gaattcaaggcaaggacctggaggcaggaactggtgcacaggccaaggaa aaattctgtctacctgcttgcttcttatgacttgatgagcctgctttttt tgccatacctaggaccagtagcccagcaccactgcccaaagggagctggg ccctccttcatgaatcactaactgagaaaatgaaccacagacttgcccac tggcttacccacaggccactctggcggtggaggtcattttcccagttgag gttccctcttcccaaatgactctagcttgtgtcaacttgaagaaataaga ctcacagaagtgtagaagggatttgagatcaggtaagcaggttttgagtg agggccctgcctagttttccacttaataatacactatagagttttagccc aaaagaatattagagaccatgaacttcagtggactttggacaaattgagc tctctgtgagcctttgaggagtgatgggcctgtgtagtttccagattcaa ggagcctagtttggacaactctgatgcctgcaatggagactggtttagaa taggtttaggtgtaagagagacgtggaatgaagaagaagatgttatttta attatatttggagagaccgtctctcttcctacaagttgtatacagaagga aactgtgcctgagagtagattcctttaaaaaccactcccaggatgcaaca gaggcagttggggagatttaagggtattcatcttttcacctgttggcatg actgagtgttcctcagacctagggtgccattgtgagaagaaagcagggga ggctggaagcaccaaggagcctcaattagtgtcacattggcacagattca gcagttggtttgtaatgtactgggacaacataatgtctttcagggtctaa taattatctgttggagcctggaagggagaagttaattccattttgctttg ttggagttcgtcaaagaccctcactcacaagaccacagagactgccattg ctgcaaactgcagaggatttttttttatgattcatcattttgggaaccct ccctctcagcacacaggccagaaggagagacccagaacgatgaagaccta cctttttataccttgtatag
quality values	Open. Hide. 62 41 52 41 62 37 30 47 62 62 62 41 47 62 62 62 62 62 62 44 39 62 62 62 62 62 62 62 62 59 59 56 43 49 59 59 54 54 56 59 62 62 62 59 62 62 59 59 62 54 62 62 59 62 59 62 62 54 49 54 59 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 54 54 42 62 59 62 62 54 54 62 62 62 62 54 49 54 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 62 54 62 56 62 62 47 42 62 62 62 52 62 62 62 62 62 62 62 62 62 62 52 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 38 33 58 58 43 58 48 58 54 58 54 58 54 58 58 58 54 46 58 54 58 58 58 58 58 58 58 52 58 54 54 58 54 52 54 58 58 58 58 58 54 36 58 58 54 52 52 49 58 58 54 58 54 42 58 54 50 54 37 48 37 54 58 52 54 58 58 54 54 54 52 52 58 47 58 50 58 58 46 54 38 28 58 58 58 42 28 51 50 51 50 58 53 46 42 58 58 58 46 58 51 47 48 50 50 51 23 13 44 48 50 40 53 50 54 49 50 58 38 40 53 50 51 51 50 35 42 54 49 43 46 50 50 49 48 32 23 32 51 54 40 49 50 29 16 50 26 20 28 51 16 12 31 24 39 46 42 40 50 47 26 58 50 42 26 52 37 31 53 39 41 46 39 37 58 37 18 16 40 58 58 32 30 52 35 8 51 10 14 58 58 27 32 31 31 41 49 37 32 51 58 58 37 53 42 28 49 39 54 49 30 29 46 32 35 49 28 41 38 28 54 45 53 52 53 27 54 28 28 49 28 38 25 31 10 31 38 19 11 19 19 15 12 6 40 23 31 34 26 12 9 44 36 31 40 29 24 17 25 17 30 54 54 47 45 29 31 30 30 37 41 32 42 37 51 46 35 25 46 19 24 26 31 41 32 31 22 16 28 34 22 27 34 28 21 15 25 33 22 27 33 26 31 17 45 22 53 28 31 21 10 9 16 20 10 15 26 18 18 41 33 25 27 25 18 30 29 30 14 28 19 25 21 19 17 15 51 31 31 26 33 23 28 35 32 31 28 18 46 27 17 30 34 33 35 29 31 31 31 51 14 30 30 15 31 41 25 31 30 22 26 30 20 17 31 9 24 17 30 33 43 18 11 16 6 15 17 28 25 28 18 42 21 31 26 27 6 12 16 25 21 25 5 7 13 7 10 19 7 12 16 24 25 11 18 21 33 21 10 6 12 13 39 31 21 11 30 33 30 27 6 8 10 18 16 5 20 27 20 20 9 33 31 8 6 10 30 11 11 11 6 14 21 27 41 36 21 21 10 36 13 18 28 24 28 10 13 16 13 7 8 19 38 33 6 7 4 14 28 16 30 9 14 33 15 20 23 4 37 6 34 18 6 4 5 5 4 4 4 4 4 9 4 4 4 4 6 7 7 19 39 13 12 8 27 21 30 34 30 16 13 7 28 47 27 21 5 8 7 11 15 13 20 13 7 7 9 18 8 19 13 8 22 38 30 19 16 10 27 28 16 7 11 8 7 8 7 7 4 12 32 18 5 3 4 3 3 5 7 16 12 5 6 18 4 2 3 5 2	Open. Hide. 62 47 47 42 62 47 42 54 62 62 44 51 56 56 37 20 59 59 56 59 62 59 59 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 50 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 52 54 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 54 46 62 58 45 45 58 54 58 54 58 58 52 58 58 54 52 58 58 58 58 58 54 58 49 54 58 54 58 54 58 46 54 41 49 58 58 58 58 54 54 58 58 58 50 58 58 46 58 58 52 54 35 58 54 54 52 53 58 58 54 51 40 45 45 54 54 42 58 58 58 58 43 58 54 58 51 42 37 58 51 51 54 58 58 51 58 50 50 54 58 37 41 50 41 47 50 58 51 58 41 50 38 39 49 46 50 58 47 25 58 58 58 40 40 58 58 53 54 58 58 58 58 58 17 38 26 34 39 46 46 33 50 50 49 50 51 49 37 58 58 58 32 33 50 40 51 50 50 58 50 42 39 50 31 29 51 53 42 40 50 50 39 54 36 49 42 50 47 46 41 58 41 58 50 50 33 33 16 58 42 40 50 21 58 37 39 32 33 27 25 29 40 39 39 54 54 50 32 23 34 54 25 38 40 29 49 50 32 33 40 33 41 32 37 42 33 11 44 51 49 27 37 53 45 45 37 29 33 15 51 36 27 28 54 47 37 46 18 51 25 41 30 40 30 47 47 26 47 44 26 47 54 52 28 29 24 6 49 47 31 22 8 31 20 32 41 34 32 31 23 42 29 42 33 18 21 12 47 35 16 42 31 22 24 31 13 21 30 31 31 31 30 23 36 18 23 19 46 28 30 30 30 28 34 23 17 35 23 31 39 21 25 37 35 31 41 28 51 33 31 51 30 31 17 36 31 26 39 19 34 30 21 21 46 6 27 20 27 30 38 31 31 46 13 14 36 21 31 30 47 15 24 8 9 33 21 25 28 30 24 29 27 21 30 19 15 12 28 32 34 35 32 18 32 21 26 10 18 31 24 21 34 15 15 11 46 34 29 15 25 32 22 37 21 24 30 21 30 16 14 16 11 27 43 7 31 20 18 44 22 20 10 37 24 31 34 23 22 18 26 10 11 25 8 28 25 20 29 16 36 26 25 21 23 27 32 32 12 7 10 13 15 22 24 6 14 13 8 14 33 7 14 24 19 29 11 18 21 33 28 32 21 26 32 27 19 21 5 14 27 33 19 10 7 18 5 10 17 15 28 17 26 13 17 18 18 8 11 26 17 18 20 7 7 10 12 9 20 27 30 28 6 3 17 9 7 10 27 34 21 8 9 34 8 10 8 23 10 13 13 8 3 7 15 16 10 15 7 22 14 7 8 18 23 7 9 30 5 7 6 12 7 20 20 6 7 19 16 10 7 16 8 7 14 11 4 3 2 8 8 16 8 7 3 19 26 28 7 5 12 10 14 17 7 18 4 2 1 7 3 5

Alignment Information

BAC End 1

BAC End 2

seq1: chr9_114265245_114266418
seq2: B6Ng01-259N07.b_44_1218 (reverse)

seq1  AAACATCTGCACAT-ATAAATAACTGGCTTTGATTTTCATGCCTGGAAGA  49
      |||||||||||||| ||||||||||||||||||||||||||||| |||||
seq2  AAACATCTGCACATAATAAATAACTGGCTTTGATTTTCATGCCTTGAAGA  50

seq1  ATTGGGGGCTGGGGTTTATTTGATTTCTTTCTTTTTCTTTTTTCCTTTAT  99
      ||| |||||||||| | |||||| ||| ||||| | |  |||||| ||||
seq2  ATT-GGGGCTGGGGGTAATTTGAATTC-TTCTTGTCC--TTTTCCCTTAT  96

seq1  CCTCTTGTTCAAAGTGAATTTTATTTATTTTTCATTTATTTATTTATTTT  149
      ||||||| |||||||||| |||||||| |||||||| ||| |||||||||
seq2  CCTCTTG-TCAAAGTGAAATTTATTTA-TTTTCATTAATTAATTTATTTT  144

seq1  ATTTATAGTCACTTT-ATATCCTGATGGCA-GATAAGCTCGATCTCTTCC  197
      | ||||||||||||| |||||||||||||| |||||||||||||||||||
seq2  A-TTATAGTCACTTTAATATCCTGATGGCAGGATAAGCTCGATCTCTTCC  193

seq1  -TATCCACATCTGACATTCACCTAGCTCTGTATTAGTTTGACATCTAGAA  246
       |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATCCACATCTGACATTCACCTAGCTCTGTATTAGTTTGACATCTAGAA  243

seq1  ATCAGATCTTGGATCTTTGT-AGAATGTGCCTCTAACTTTAACTCGCATA  295
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  ATCAGATCTTGGATCTTTGTAAGAATGTGCCTCTAACTTTAACTCGCATA  293

seq1  AGAATGTCACGGGAGAGTTGTCAAAATGCGTA-TTTCCAG-AATCTTGTC  343
      |||||||||||||||||||||||||||||||| ||||||| |||||||||
seq2  AGAATGTCACGGGAGAGTTGTCAAAATGCGTATTTTCCAGAAATCTTGTC  343

seq1  CCTCTGCATTCTAACTTAATGTGCAGTTTATAGAAAGCTGCTTGAAAA-T  392
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  CCTCTGCATTCTAACTTAATGTGCAGTTTATAGAAAGCTGCTTGAAAATT  393

seq1  TACGTTTTGGAAATCATGCTGCTGGGCAGAACTTTCTTCCATGAGTAAGT  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACGTTTTGGAAATCATGCTGCTGGGCAGAACTTTCTTCCATGAGTAAGT  443

seq1  GCCCTATCGCTGGGCTATTCAAGTGTGGGCCATAGTCACAAATATCGTGT  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCCTATCGCTGGGCTATTCAAGTGTGGGCCATAGTCACAAATATCGTGT  493

seq1  GGAAATAGCCATCTTACCAAAAGCAATCTACAATTCCCATTAAAATTCCA  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATAGCCATCTTACCAAAAGCAATCTACAATTCCCATTAAAATTCCA  543

seq1  ACACAACTCTACAGACCTTGAAAGAACACCTCTCACCTTCATATGGAACA  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAACTCTACAGACCTTGAAAGAACACCTCTCACCTTCATATGGAACA  593

seq1  ACAGAACTCCAGGATAGCTAAATCCCTAATGTACAATAAAAGACTTCTGA  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAACTCCAGGATAGCTAAATCCCTAATGTACAATAAAAGACTTCTGA  643

seq1  AGGTATCACCATTCCTGATTTCAAGCTGTACTGGAGATCAGTAAAAATGA  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTATCACCATTCCTGATTTCAAGCTGTACTGGAGATCAGTAAAAATGA  693

seq1  AAACGTCTATAGGCCTGCCTTTAATTTTGCTGAAAGGACCCTGATATTGT  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACGTCTATAGGCCTGCCTTTAATTTTGCTGAAAGGACCCTGATATTGT  743

seq1  TGTCTCTTGTGAAGCTATGCCATGCCTGGCAAACACAAAAGTGGATGCAC  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCTCTTGTGAAGCTATGCCATGCCTGGCAAACACAAAAGTGGATGCAC  793

seq1  ACAGTCAGCTATTGGGTGGAACACAAGGCTCCCAATGGAGGAGCTAGAGA  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGTCAGCTATTGGGTGGAACACAAGGCTCCCAATGGAGGAGCTAGAGA  843

seq1  AAGTACCCAAGGATCTGAAGGGGTCTGTATCCCTATAGGTGGAACAACAA  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTACCCAAGGATCTGAAGGGGTCTGTATCCCTATAGGTGGAACAACAA  893

seq1  TAAGAGCTAATCAGTACCCCCAGAGCTCGTGTCTCTAGCTGCATATGTAG  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAGCTAATCAGTACCCCCAGAGCTCGTGTCTCTAGCTGCATATGTAG  943

seq1  CAGAAGATGGCCTAGTCAGCCATCATTGGGAAGAGAGGCCCCTTGGTCTT  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAGATGGCCTAGTCAGCCATCATTGGGAAGAGAGGCCCCTTGGTCTT  993

seq1  GCAAACTTTATATGCCCCAGTACAGGGGAACGCCAGGGCAAAGAAGTAGG  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAACTTTATATGCCCCAGTACAGGGGAACGCCAGGGCAAAGAAGTAGG  1043

seq1  AGTGGGTGGGTAGGGGAGCAGGGGGTTGGGGAGGGTATAGAAGAATTTTG  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGGTGGGTAGGGGAGCAGGGGGTTGGGGAGGGTATAGAAGAATTTTG  1093

seq1  GAATAGCATTTGAAATGTAAATGAAGTAAATACCTAATAAAATTGGGGGA  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATAGCATTTGAAATGTAAATGAAGTAAATACCTAATAAAATTGGGGGA  1143

seq1  AAAAAGACAACTGAAGGAGATCAAGTGAATTC  1174
      ||||||||||||||||||||||||||||||||
seq2  AAAAAGACAACTGAAGGAGATCAAGTGAATTC  1175

seq1: chr9_114138472_114139594
seq2: B6Ng01-259N07.g_69_1188

seq1  GAATTCAAGGCAAGGACCTGGAGGCAGGAACTGGTGCACAGGCCAAGGAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAAGGCAAGGACCTGGAGGCAGGAACTGGTGCACAGGCCAAGGAA  50

seq1  AAATTCTGTCTACCTGCTTGCTTCTTATGACTTGATGAGCCTGCTTTTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTCTGTCTACCTGCTTGCTTCTTATGACTTGATGAGCCTGCTTTTTT  100

seq1  TGCCATACCTAGGACCAGTAGCCCAGCACCACTGCCCAAAGGGAGCTGGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCATACCTAGGACCAGTAGCCCAGCACCACTGCCCAAAGGGAGCTGGG  150

seq1  CCCTCCTTCATGAATCACTAACTGAGAAAATGAACCACAGACTTGCCCAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCCTTCATGAATCACTAACTGAGAAAATGAACCACAGACTTGCCCAC  200

seq1  TGGCTTACCCACAGGCCACTCTGGCGGTGGAGGTCATTTTCCCAGTTGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTTACCCACAGGCCACTCTGGCGGTGGAGGTCATTTTCCCAGTTGAG  250

seq1  GTTCCCTCTTCCCAAATGACTCTAGCTTGTGTCAACTTGAAGAAATAAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCCTCTTCCCAAATGACTCTAGCTTGTGTCAACTTGAAGAAATAAGA  300

seq1  CTCACAGAAGTGTAGAAGGGATTTGAGATCAGGTAAGCAGGTTTTGAGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCACAGAAGTGTAGAAGGGATTTGAGATCAGGTAAGCAGGTTTTGAGTG  350

seq1  AGGGCCCTGCCTAGTTTTCCACTTAATAATACACTATAGAGTTTTAGCCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGCCCTGCCTAGTTTTCCACTTAATAATACACTATAGAGTTTTAGCCC  400

seq1  AAAAGAATATTAGAGACCATGAACTTCAGTGGACTTTGGACAAATTGAGC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAATATTAGAGACCATGAACTTCAGTGGACTTTGGACAAATTGAGC  450

seq1  TCTCTGTGAGCCTTTGAGGAGTGATGGGCCTGTGTAGTTTCCAGATTCAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCTGTGAGCCTTTGAGGAGTGATGGGCCTGTGTAGTTTCCAGATTCAA  500

seq1  GGAGCCTAGTTTGGACAACTCTGATGCCTGCAATGGAGACTGGTTTAGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGCCTAGTTTGGACAACTCTGATGCCTGCAATGGAGACTGGTTTAGAA  550

seq1  TAGGTTTAGGTGTAAGAGAGACGTGGAATGAAGAAGAAGATGTTATTTTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTTTAGGTGTAAGAGAGACGTGGAATGAAGAAGAAGATGTTATTTTA  600

seq1  ATTATATTTGGAGAGACCGTCTCTCTTCCTACAAGTTGTATACAGAAGGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATATTTGGAGAGACCGTCTCTCTTCCTACAAGTTGTATACAGAAGGA  650

seq1  AACTGTGCCTGAGAGTAGATTCCTTTAAAAACCACTCCCAGGATGCAACA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGTGCCTGAGAGTAGATTCCTTTAAAAACCACTCCCAGGATGCAACA  700

seq1  GAGGCAGTTGGGGAGATTTAAGGGTATTCATCTTTTCACCTGTTGGCATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGCAGTTGGGGAGATTTAAGGGTATTCATCTTTTCACCTGTTGGCATG  750

seq1  ACTGAGTGTTCCTCAGACCTAGGGTGCCATTGTGAGAAGAAAGCAGGGGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGTGTTCCTCAGACCTAGGGTGCCATTGTGAGAAGAAAGCAGGGGA  800

seq1  GGCTGGAAGCACCAAGGAGCCTCAATTAGTGTCACATTGGCACAGATTCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGGAAGCACCAAGGAGCCTCAATTAGTGTCACATTGGCACAGATTCA  850

seq1  GCAGTTGGTTTGTAATGTACT-GGACAACATAATGTCTTTCAGGGTCTAA  899
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GCAGTTGGTTTGTAATGTACTGGGACAACATAATGTCTTTCAGGGTCTAA  900

seq1  TAATTTATCTGTTTGGAGCCTGG-AGGGAGAAGTTAATTCCATTTTGCTT  948
      ||| ||||||| ||||||||||| ||||||||||||||||||||||||||
seq2  TAA-TTATCTG-TTGGAGCCTGGAAGGGAGAAGTTAATTCCATTTTGCTT  948

seq1  TGTTGGAGTTCGTCAAAAGACCCTCACTCACAAAGACCACAGAGACTGCC  998
      |||||||||||||| |||||||||||||||| ||||||||||||||||||
seq2  TGTTGGAGTTCGTC-AAAGACCCTCACTCAC-AAGACCACAGAGACTGCC  996

seq1  ATTGCTGCAAACTGCAAGAGGATTTTTTTTTATTGATTCATCATTTTGGG  1048
      ||||||||||||||| |||||||||||||||| |||||||||||||||||
seq2  ATTGCTGCAAACTGC-AGAGGATTTTTTTTTA-TGATTCATCATTTTGGG  1044

seq1  GACCC-CCCTCTCAGCACACAGGCCAG-AGGAGAGACCCAGAACGATGAA  1096
       |||| ||||||||||||||||||||| |||||||||||||||||||| |
seq2  AACCCTCCCTCTCAGCACACAGGCCAGAAGGAGAGACCCAGAACGATG-A  1093

seq1  AGAACACACTTTTTATACCTTGTATAG  1123
      ||| |   |||||||||||||||||||
seq2  AGACCTACCTTTTTATACCTTGTATAG  1120

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information